unit four practice questions

A genetic counselor is working with a couple who have just had a child who has cystic fibrosis (CF). Neither parent has CF, nor does anyone in their families. What should the counselor say to this couple? "Because no one in either of your families has CF, you are not likely to have another baby with CF. You can safely have another child." "Because you have had one child with CF, you must each carry the allele. Any child you have has a 50% chance of having the disease." "Because you have had one child with CF, you must each carry the allele. Any child you have has a 25% chance of having the disease." "Because you have had one child with CF, you must both carry the allele. However, since the chance of having an affected child is 25%, you may safely have three more children without worrying about having another child with CF." "You must both be tested to see who is a carrier of the Tay-Sachs allele."

"Because you have had one child with CF, you must each carry the allele. Any child you have has a 25% chance of having the disease."

A man with hemophilia (a recessive, sex-linked condition) has a daughter of normal phenotype. She marries a man who is normal for the trait. If the couple has a daughter, what are her chances of being a hemophiliac? 0 1/4 1/2 1 (100%) none of the above

0

A man with hemophilia (a recessive, sex-linked condition) has a daughter of normal phenotype. She marries a man who is normal for the trait. If the couple has four sons, what is the probability that all four will be born with hemophilia? 0 1/12 1/16 1 (100% chance) It is impossible to know given the above information.

1/16

Imagine that a newly discovered, recessively inherited disease is expressed only in individuals with type O blood, although the disease and blood group are independently inherited. A normal man with type A blood and a normal woman with type B blood have already had one child with the disease. The woman is now pregnant for a second time. What is the probability that the second child will also have the disease? Assume that both parents are heterozygous for the gene that causes the disease.

1/16

A man with hemophilia (a recessive, sex-linked condition) has a daughter of normal phenotype. She marries a man who is normal for the trait. If the couple has a son, what are his chances of being a hemophiliac? 0 1/4 1/2 1 (100% chance) none of the above

1/2

Black fur in mice (B) is dominant to brown fur (b). Short tails (T) are dominant to long tails (t). What fraction of the progeny of the cross BbTt × BBtt should we expect to have black fur and long tails? 1/16 3/16 3/8 1/2 9/16

1/2

Red-green color blindness is caused by a sex-linked recessive allele. A color-blind man marries a woman with normal vision whose father was color-blind. If the couple has a son, what are his chances of being color-blind? 0 1/8 1/4 1/2 There is no way to know given the above information.

1/2

Nicole is a carrier for thalassemia, an autosomal recessive blood disorder, but her husband is not. Her husband is a carrier for cystic fibrosis, also an autosomal recessive disorder, but Nicole is not. What is the chance that their daughter is a carrier for BOTH thalassemia and CF?

1/4

Nicole is a carrier for thalassemia, an autosomal recessive blood disorder, but her husband is not. Her husband is a carrier for cystic fibrosis, also an autosomal recessive disorder, but Nicole is not. What is the chance that their son is not a carrier for either of these disorders?

1/4

Red-green color blindness is caused by a sex-linked recessive allele. A color-blind man marries a woman with normal vision whose father was color-blind. What is the probability that they will have a color-blind daughter? 0 1/8 1/4 1/2 none of the above

1/4

Tay-Sachs disease is an inherited disorder of the central nervous system. Homozygous recessive individuals usually die around the age of five. If two carriersfor the disease have a child, the chances of the child inheriting the disease are 0%. 25%. 50%. 75%. 100%.

25%

Imagine a locus with four different alleles for fur color in an animal, Da, Db, Dc, and Dd. If you crossed two heterozygotes, DaDb and DcDd, what genotype proportions would you expect in the offspring? 25% DaDc, 25% DaDd, 25% DbDc, 25% DbDd 50% DaDb, 50% DcDd 25% DaDa, 25% DbDb, 25% DcDc, 25% DdDd 50% DaDc, 50% DbDd 25% DaDb, 25% DcDd, 25% DcDc, 25% DdDd

25% DaDc, 25% DaDd, 25% DbDc, 25% DbDd

ABO blood type in humans exhibits codominance and multiple alleles. What is the likelihood of a type A father and a type A mother having a type O child? It is impossible. 25% if both parents are heterozygous 50% if both parents are heterozygous 25% if only the father is heterozygous 25% if only the mother is heterozygous

25% if both parents are heterozygous

Suppose you and your spouse are both carriers for an autosomal recessive disease. You plan to have three children. What are the chances that one (and only one) of those children will have the disease?

27/64

In birds, sex is determined by a ZW chromosome scheme. Males are ZZ and females are ZW. A recessive lethal allele that causes death of the embryo is sometimes present on the Z chromosome in pigeons. What would be the sex ratio in the offspring of a cross between a male that is heterozygous for the lethal allele and a normal female? 2:1 male to female 1:2 male to female 1:1 male to female 4:3 male to female 3:1 male to female

2:1 male to female

The agouti gene in mice plays a role in determining coat color. At this locus, the genotype AA produces an "agouti coat," and the heterozygote Aa produces a yellow coat. The aa homozygotes, however, die very early in development. What is the expected phenotypic ratio of live mice resulting from a cross of two Aa mice? 3:1 agouti:yellow 3:1 yellow:agouti 2:1 agouti:yellow 2:1 yellow:agouti all yellow, no agouti

2:1 yellow:agouti

Use the table below to determine which of the sequences of nucleotides below in the template strand of DNA would code for the polypeptide sequence phe-leu-ile-val. 5' TTG-CTA-CAG-TAG 3' 3' AAC-GAC-GUC-AUA 5' 5' AUG-CTG-CAG-TAT 3' 3' AAA-AAT-ATA-ACA 5' 3' AAA-GAA-TAA-CAA 5'

3' AAA-GAA-TAA-CAA 5'

Given the parents AABBCc × AabbCc, assume simple dominance and independent assortment. What proportion of the progeny will be expected to phenotypically resemble the first parent? 1/4 1/8 3/4 3/8 1/1

3/4

Consider the case of recessive epistasis in Labrador coat color. Suppose you were to cross a black lab (genotype BbEe) with a brown lab (genotype bbEe). What is the expected distribution of coat color among the offspring? 9:3:4 black:brown:yellow 3:3:2 black:brown:yellow 1:1:1 black:brown:yellow 3:1 black:brown 1:2:1 black:brown:yellow

3:3:2 black:brown:yellow

Which of the following help(s) to stabilize mRNA by inhibiting its degradation? TATA box spliceosomes 5' cap and poly-A tail introns RNA polymerase

5' cap and poly-A tail

Which of the following is the initial mRNA sequence that will result from this stretch of DNA? 3' - TATAAAACATACGGATTCACAGCGACT - 5' 3'-AUAUUUUGUAUGCCUAAGUGUCGCUGU-5' 5'-AUAUUUUGUAUGCCUAAGUGUCGCUGU-3' 3'-ATATTTTGTATGCCTAAGTGTCGCTGT-5' 5'-AUAUUUUGUAUGGGUAAGUCUCGGUGU-3' 5'-ATATTTTGTATGCCTAAGTGTCGCTGT-3'

5'-AUAUUUUGUAUGCCUAAGUGUCGCUGU-3'

John, age 47, has just been diagnosed with Huntington's disease, which is caused by a rare dominant allele. His daughter, age 25, has a 2-year-old son. No one else in the family has the disease. What is the probability that the daughter will develop the disease? 0% 25% 50% 75% 100%

50%

In humans, male-pattern baldness is controlled by an autosomal gene that occurs in two allelic forms. Allele Hn determines nonbaldness, and allele Hb determines pattern baldness. In males, because of the presence of testosterone, allele Hb is dominant over Hn. If a man and woman both with genotype HnHb have a son, what is the chance that he will eventually be bald? 0% 25% 33% 50% 75%

75%

Imagine a cross of two triple heterozygous pea plants with tall stems and axial purple flowers (genotype TtAaPp). If you were to create a Punnett square for this cross (this is not a recommended strategy!), what would be its dimensions? Recall that all three loci assort independently. 2 x 2 3 x 3 4 x 4 6 x 6 8 x 8

8 x 8

Olivia and Jake both have siblings with cystic fibrosis (CF), which is an autosomalrecessive disorder. Neither of them has CF, nor do any of their parents. Olivia is now pregnant (and Jake is the father). Based on the information above, what are their chances of having a child without CF?

8/9

Suppose you and your partner are both carriers for an autosomal recessive disorder. You wish to have two children - one boy and one girl - and you do not want either of them to have the disorder. What are the chances of you getting your wish?

9/32

In analyzing the number of different bases in a DNA sample, which result would be consistent with the base-pairing rules? A = G A + G = C + T A + T = G + T A = C

A + G = C + T

Suppose a mutant form of DNA polymerase evolved that did not require a primer. Assuming all other aspects of the DNA polymerase remain the same, which of the following would be true? Chromosomes would not become shorter every time a cell divides. There would be no leading and lagging strands during DNA replication; both strands would be replicated in the same manner. The rate of DNA replication would decrease drastically. DNA ligase would no longer be necessary. More than one of the above would occur.

Chromosomes would not become shorter every time a cell divides

A biochemist isolates and purifies various molecules needed for DNA replication. When she adds some DNA, replication occurs, but each DNA molecule consists of a normal strand paired with numerous segments of DNA a few hundred nucleotides long. What has she probably left out of the mixture? DNA polymerase DNA ligase nucleotides Okazaki fragments primase

DNA ligase

A new DNA strand elongates only in the 5' to 3' direction because DNA polymerase begins adding nucleotides at the 5' end of the template. Okazaki fragments prevent elongation in the 3' to 5' direction. the polarity of the DNA molecule prevents addition of nucleotides at the 3' end. replication must progress toward the replication fork. DNA polymerase can only add nucleotides to the free 3' end.

DNA polymerase can only add nucleotides to the free 3' end.

Why do histones bind tightly to DNA? Histones are positively charged, and DNA is negatively charged. Histones are negatively charged, and DNA is positively charged. Both histones and DNA are strongly hydrophobic. Histones are covalently linked to the DNA. Histones are highly hydrophobic, and DNA is hydrophilic.

Histones are positively charged, and DNA is negatively charged.

Which of the following occurs in eukaryotic gene expression, but not in prokaryotic gene expression? Click all that apply. Introns are spliced out of mRNA. A poly-A tail is added to the 3' end of the mRNA. A guanine cap is added to the 5' end of the mRNA. RNA polymerase requires a primer to elongate the molecule. Translation can begin as soon as transcription has begun even a little.

Introns are spliced out of mRNA. A poly-A tail is added to the 3' end of the mRNA. A guanine cap is added to the 5' end of the mRNA.

Which of the following statements describes genomic imprinting? It explains cases in which the gender of the parent from whom an allele is inherited affects the expression of that allele. It is greatest in females because of the larger maternal contribution of cytoplasm. It may explain the transmission of Duchenne muscular dystrophy. It involves an irreversible alteration in the DNA sequence of imprinted genes. It only affects females, because females have two X chromosomes.

It explains cases in which the gender of the parent from whom an allele is inherited affects the expression of that allele.

Suppose the template strand of a gene consists of 20% cytosine. When it is transcribed, what percentage of the mRNA will be cytosine? 20% 40% 60% 80% It is impossible to know based on the information given.

It is impossible to know based on the information given.

In E. coli, there is a mutation in a gene called dnaB that alters the enzyme helicase. Which of the following would you expect as a result of this mutation? No proofreading will occur. No replication fork will be formed. The DNA will supercoil. Replication will occur via RNA polymerase alone. Replication will require a DNA template from another source.

No replication fork will be formed.

Suppose a mutant form of DNA polymerase evolved that could add nucleotides to the 5' end but not the 3' end of a polynucleotide strand. Assuming all other aspects of the DNA polymerase remain the same, which of the following would be true? Chromosomes would not become shorter every time a cell divides. There would be no leading and lagging strands during DNA replication; both strands would be replicated in the same manner. Telomerase would not be essential during embryonic development. An RNA primer would no longer be necessary for DNA replication. None of these would occur; DNA replication would essentially work the same way as it does now.

None of these would occur; DNA replication would essentially work the same way as it does now.

The Rh blood factor in humans is perhaps the most important after the ABO system. The + phenotype is dominant to the - phenotype and is encoded on a separate autosome from the ABO locus (i.e., the two loci assort independently). A child is born to a woman of blood type A+ and a man of blood type AB+. Which of the following blood types would not be possible for the child? A+ B+ A- O+ AB-

O+

In which of the following actions does RNA polymerase differ from DNA polymerase? RNA polymerase uses RNA as a template, and DNA polymerase uses a DNA template. RNA polymerase works in the 3' to 5' direction while DNA polymerase works in the 5' to 3' direction. RNA polymerase is much more accurate than DNA polymerase. RNA polymerase can initiate RNA synthesis, but DNA polymerase requires a primer to initiate DNA synthesis. RNA polymerase does not need to separate the two strands of DNA in order to synthesize an RNA copy, whereas DNA polymerase must unwind the double helix before it can replicate the DNA.

RNA polymerase can initiate RNA synthesis, but DNA polymerase requires a primer to initiate DNA synthesis.

In peas, the allele for tall stems (T) is dominant to that for dwarf stems (t), and the allele for axial flowers (A) is dominant to that for terminal flowers (a). A plant of unknown genotype with tall stems and axial flowers is crossed with a plant with dwarf stems and terminal flowers. Among the offspring are 38 plants with tall stems and axial flowers, and 36 plants with tall stems and terminal flowers. What is the previously unknown genotype? TtAa TTAa TtAA TTAA cannot be determined from these data

TTAa

What is meant by the description 'antiparallel' regarding the strands that make up DNA? The twisting nature of DNA creates nonparallel strands. The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand. Base pairings create unequal spacing between the two DNA strands. One strand is positively charged and the other is negatively charged.

The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand.

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? The tRNA that was in the A site moves into the P site. The tRNA that was in the P site moves into the A site. The tRNA that was in the A site moves to the E site and is released. The tRNA that was in the A site departs from the ribosome via a tunnel. The polypeptide enters the E site.

The tRNA that was in the A site moves into the P site.

Which of the following is true of snRNPs? They bind to the TATA box of the promoter region of a gene. They bind to splice sites at each end of the exon. They join together to form a large structure called the spliceosome. They act only in the cytosol. They attach introns to exons in the correct order.

They join together to form a large structure called the spliceosome.

Which of the following occurs in prokaryotic gene expression, but not in eukaryotic gene expression? Click all that apply. Introns are spliced out of mRNA. A poly-A tail is added to the 3' end of an mRNA and a cap is added to the 5' end. Translation can begin as soon as transcription has begun even a little. RNA polymerase requires a primer to elongate the molecule. Polyribosomes are formed.

Translation can begin as soon as transcription has begun even a little.

Red-green color blindness is a sex-linked recessive trait in humans. Two people with normal color vision have a color-blind son. What are the genotypes of the parents? XcXc and XcY XcXc and XCY XCXC and XcY XCXC and XCY XCXc and XCY

XCXc and XCY

Which of the following types of mutation, resulting in an error in the mRNA just after the AUG start of translation, is likely to have the most serious effect on the polypeptide product? a deletion of a codon a deletion of two nucleotides a substitution of the third nucleotide in an ACC codon a substitution of the first nucleotide of a GGG codon an insertion of a codon

a deletion of two nucleotides

Calico cats are female because a male inherits only one of the two X-linked genes controlling hair color. it is a disadvantage for a male to be multiple colors, and this phenotype has been eliminated over time through natural selection. the Y chromosome has a gene blocking orange coloration. males have Barr bodies, which prevents them from being multiple colors. multiple crossovers on the Y chromosome prevent orange pigment production.

a male inherits only one of the two X-linked genes controlling hair color.

If nondisjunction occurs during meiosis, it can result in which of the following? Click ALL that apply. a monosomic gamete a trisomic gamete a zygote with aneuploidy a spontaneous abortion a polyploid embryo

a monosomic gamete a trisomic gamete

Which would you expect of a eukaryotic cell lacking telomerase? a high probability of becoming cancerous production of Okazaki fragments inability to repair thymine dimers a reduction in chromosome length high sensitivity to sunlight

a reduction in chromosome length

a human cell containing 22 autosomes and a Y chromosome is a sperm. an egg. a male zygote. a female zygote. a somatic cell of a male.

a sperm

Consider all the different people that you know. Based on their features, which of the following human phenotypes can likely be considered to be polygenic? height hair color eye color skin color all of the above

all of the above

Click all that apply. Alternative RNA splicing is a mechanism for increasing the rate of transcription. can allow the production of different proteins from a single mRNA. can allow the production of similar proteins from different RNAs. does not occur in prokaryotes. depends on the temperature in the cell.

can allow the production of different proteins from a single mRNA does not occur in prokaryotes

New combinations of linked genes are due to which of the following? Nondisjunction Crossing over Independent assortment Mixing of sperm and egg Deletions

crossing over

Generally speaking, inheriting a chromosome with which of the following would be the most likely to result in severe and harmful effects? translocation deletion inversion duplication point mutation

deletion

What are the coding segments of a stretch of eukaryotic DNA called? introns exons codons replicons transposons

exons

A man who is an achondroplastic dwarf with normal vision marries a color-blind woman of normal height. The man's father was six feet tall, and both the woman's parents were of average height. Achondroplastic dwarfism is autosomal dominant, and red-green color blindness is X-linked recessive. What proportion of their sons would be expected to be color-blind and of normal height? All None Half One out of four Three out of four

half

In order for a girl to inherit a sex-linked recessive disorder, which of the following must occur? Click all that apply. Her mother must be a carrier for the disorder. Her father must be a carrier for the disorder. Her father must have the disorder. Her mother must have the disorder. She must have an XXX genotype. She must have a condition in which both both of her X chromosomes remain active.

her mother must be a carrier for the disorder her father must have the disorder

In Drosophila, white eyes are due to an X-linked recessive allele (Xw), with red eyes being dominant to white eyes. Which of the following crosses could not result in a white-eyed Drosophila male? homozygous red-eyed females with white-eyed males homozygous white-eyed females with red-eyed males heterozygous red-eyed females with white-eyed males heterozygous red-eyed females with red-eyed males All of these could result in white-eyed males.

homozygous red-eyed females with white-eyed males

What type of bonds are broken by DNA helicase? hydrogen bonds peptide bonds phosphodiester bonds glycosidic bonds ionic bonds

hydrogen bonds

In eukaryotes, where in the cell does translation take place? Click all that apply. in the nucleus in the cytosol on the endoplasmic reticulum in the plasma membrane along microtubules

in the cytosol on the endoplasmic reticulum

In eukaryotes, where in the cell does transcription take place? Click all that apply. in the nucleus in the cytosol on the endoplasmic reticulum in the plasma membrane along microtubules

in the nucleus

Genes that are located near each other on an autosome are just as likely to be separated from each other as any other genes because physical location has no impact on independent assortment. sex-linked. more likely to undergo mutations. likely to be inherited together. likely to be separated during crossing over.

likely to be inherited together

When the above sequence of mRNA is translated, what will be the sequence of amino acids? leu - arg - ser - phe - ile - val met - lys - ser - arg - ile - cys met - pro - lys - cys - arg ile - phe - leu - met - pro - lys - cys - arg phe - met - ile - lys - cys - arg

met - pro - lys - cys - arg

Suppose the following point mutations occurred in the original DNA strand given above. The mutated nucleotide is underlined. What type of mutation is this? 3' - TATAAAACATACGGACTCACAGCGACT - 5' silent missense nonsense

missense

Which of the following is present in RNA but not in DNA? ribose deoxyribose thymine uracil more than one of the above

more than one of the above

Suppose a mutant form of DNA polymerase evolved that could add nucleotides to both the 5' and 3' ends of a polynucleotide strand. Assuming all other aspects of the DNA polymerase remain the same, which of the following would be true? Chromosomes would not become shorter every time a cell divides. There would be no leading and lagging strands during DNA replication; both strands would be replicated in the same manner. Telomerase would not be essential during embryonic development. An RNA primer would no longer be necessary for DNA replication. More than one of the above would occur.

more than one of the above would occur

If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the chromosome number of the four resulting gametes with respect to the normal haploid number (n)? n + 1; n + 1; n - 1; n - 1 n + 1; n - 1; n; n n + 1; n - 1; n - 1; n - 1 n + 1; n + 1; n; n n - 1; n - 1; n; n

n + 1; n + 1; n - 1; n - 1

A man who is an achondroplastic dwarf with normal vision marries a color-blind woman of normal height. The man's father was six feet tall, and both the woman's parents were of average height. Achondroplastic dwarfism is autosomal dominant, and red-green color blindness is X-linked recessive. How many of their daughters might be expected to be color-blind dwarfs? All None Half One out of four Three out of four

none

Suppose the template strand of a gene consists of 20% adenine. When it is transcribed, what percentage of the mRNA will be thymine? 20% 40% 60% 80% none of these

none of these

The spontaneous loss of amino groups from adenine results in hypoxanthine, an uncommon base, opposite thymine in DNA. What combination of molecules could repair such damage? nuclease, DNA polymerase, DNA ligase telomerase, primase, DNA polymerase telomerase, helicase, single-strand binding protein DNA ligase, replication fork proteins, adenylyl cyclase nuclease, telomerase, primase

nuclease, DNA polymerase, DNA ligase

even though females are XX and males are XY, females do not produce twice as much of the proteins encoded on the X chromosome as males. This is because each of the X chromosomes in females is partially inactivated, thereby producing ½ the amount of normal protein. one of the X chromosomes in females is inactivated, forming a Barr body. the Y chromosome has twice the number of genes on it as the X chromosome. testosterone causes the male X chromosome to produce twice the amount of a female X chromosome. the male X chromosome always comes from the father, so it produces more protein.

one of the X chromosomes in females is inactivated, forming a Barr body.

If nondisjunction occurs in meiosis II during gametogenesis, what will be the result at the completion of meiosis? All the gametes will be diploid. Half of the gametes will be n + 1, and half will be n - 1. one of the four gametes will be n + 1, one will be n - 1, and two will be n. There will be three extra gametes. Two of the four gametes will be haploid, and two will be diploid.

one of the four gametes will be n + 1, one will be n - 1, and two will be n.

What type of bonds are formed by DNA ligase? hydrogen bonds peptide bonds phosphodiester bonds glycosidic bonds ionic bonds

phosphodiester bonds

A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead of the normal phenylalanine. The consequence of this for the cell will be that none of the proteins in the cell will contain phenylalanine. proteins in the cell will include lysine instead of phenylalanine at amino acid positions specified by the codon UUU. the cell will compensate for the defect by attaching phenylalanine to tRNAs with lysine-specifying anticodons. the ribosome will skip a codon every time a UUU is encountered. there will be no major consequences because of the wobble effect.

proteins in the cell will include lysine instead of phenylalanine at amino acid positions specified by the codon UUU.

Which of the following statements are true? Click all that apply. Dominant alleles are more common than recessive alleles. Recessive diseases are more common than dominant diseases. It is not possible for a man and a woman who are both afflicted with a dominant disease to give birth to a child without the disease. Only males can be afflicted by sex-linked diseases. Only females can pass on diseases caused by mutations in mitochondrial DNA (mtDNA).

recessive diseases are more common than dominant diseases only females can pass on diseases caused by mutations in mitochondrial DNA

In cattle, roan coat color (mixed red and white hairs) occurs in the heterozygous (Rr) offspring of red (RR) and white (rr) homozygotes. Which of the following crosses would produce offspring in the ratio of 1 red : 2 roan : 1 white? red × white roan × roan white × roan red × roan The answer cannot be determined from the information provided.

roan x roan

Transcription in eukaryotes requires which of the following in addition to RNA polymerase? the protein product of the promoter start and stop codons ribosomes and tRNA several transcription factors (TFs) aminoacyl synthetase

several transcription factors (TFs)

pseudohypertrophic muscular dystrophy is an inherited disorder that causes gradual deterioration of the muscles. It is seen almost exclusively in boys born to apparently normal parents and usually results in detain the early teens. What is the mode of inheritance for this disorder? autosomal dominant autosomal recessive sex-linked dominant sex-linked recessive mitochondrial

sex-linked recessive

Suppose the following point mutations occurred in the original DNA strand given above. The mutated nucleotide is underlined. What type of mutation is this? 3' - TATAAAACATACGGGTTCACAGCGACT - 5' silent missense nonsense

silent

A Barr body is normally found in the nucleus of which kind of human cell? Unfertilized egg cells only Sperm cells only Somatic cells of a female only Somatic cells of a male only Both male and female somatic cells

somatic cells of a female only

What pattern of inheritance would lead a geneticist to suspect that an inherited disorder of cell metabolism is due to a defective mitochondrial gene? The disorder would always be inherited from the mother. The disorder would always be passed onto sons and not daughters. The disorder would always be passed on from fathers to daughters, but not to sons. The disorder would be much more common in males than in females. The disorder would be much more common in females than in males.

the disorder would always be inherited from the mother

During DNA replication, the leading and the lagging strands differ in that the leading strand is synthesized in the same direction as the movement of the replication fork, and the lagging strand is synthesized in the opposite direction. the leading strand is synthesized by adding nucleotides to the 3' end of the growing strand, and the lagging strand is synthesized by adding nucleotides to the 5' end. the lagging strand is synthesized continuously, whereas the leading strand is synthesized in short fragments that are ultimately stitched together. the leading strand is synthesized at twice the rate of the lagging strand. none of the above; the leading and lagging strands are essentially the same.

the leading strand is synthesized in the same direction as the movement of the replication fork, and the lagging strand is synthesized in the opposite direction.

What determines the nucleotide sequence of the newly synthesized strand during DNA replication? the particular DNA polymerase catalyzing the reaction the relative amounts of the four nucleoside triphosphates in the cell the nucleotide sequence of the template strand the primase used in the reaction the arrangement of histones in the sugar phosphate back

the nucleotide sequence of the template strand

The TATA sequence is found only several nucleotides away from the start site of transcription. This most probably relates to which of the following? the number of hydrogen bonds between A and T in DNA the triplet nature of the codon the ability of this sequence to bind to the start site the supercoiling of the DNA near the start site the 3-dimensional shape of a DNA molecule

the number of hydrogen bonds between A and T in DNA

Two plants are crossed, resulting in offspring with a 3:1 ratio for a particular trait. This suggests that the parents were true-breeding for contrasting traits. there is incomplete dominance. a blending of traits has occurred. the parents were both heterozygous. each offspring has the same alleles.

the parents were both heterozygous

There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that some tRNAs have anticodons that recognize four or more different codons. the rules for base pairing between the third base of a codon and tRNA are flexible. many codons are never used, so the tRNAs that recognize them are dispensable. the DNA codes for all 61 tRNAs but some are then destroyed. competitive exclusion forces some tRNAs to be destroyed by nucleases.

the rules for base pairing between the third base of a codon and tRNA are flexible.

In cats, black fur color is caused by an X-linked allele; the other allele at this locus causes orange color. The heterozygote is tortoiseshell. What kinds of offspring would you expect from the cross of a tortoiseshell female and an orange male? tortoiseshell females; tortoiseshell males black and orange females; black and orange males tortoiseshell and orange females; black and orange males tortoiseshell females; black males orange females; black males

tortoiseshell and orange females; black and orange males

In cats, black fur color is caused by an X-linked allele; the other allele at this locus causes orange color. The heterozygote is tortoiseshell. What kinds of offspring would you expect from the cross of a black female and an orange male? tortoiseshell females; tortoiseshell males black females; orange males orange females; orange males tortoiseshell females; black males orange females; black males

tortoiseshell females; black males

What was the most significant conclusion that Gregor Mendel drew from his experiments? Genes are located along chromosomes. The structure of DNA is a double helix, with a sugar-phosphate backbone and paired nitrogenous bases on the inside. Traits are inherited in discrete units, and are not the results of 'blending.' There is considerable genetic variation in garden peas. DNA is the genetic material of a cell, and not protein.

traits are inherited in discrete units and are not the results of blending

Which of the following variations on translation would be most disadvantageous for a cell? translating polypeptides directly from DNA using fewer kinds of tRNA having only one stop codon lengthening the half-life of mRNA having a second codon (besides AUG) as a start codon

translating polypeptides directly from DNA

A cell that has 2n + 1 chromosomes is trisomic. monosomic. euploid. polyploid. triploid.

trisomic

Only females can pass on diseases caused by mutations in mitochondrial DNA (mtDNA). True False

true

In a disputed parentage case, the child is blood type B, while the mother is blood type A. What blood type can the father have? Click all that apply. Type A Type B Type AB Type O

type AB type B

Straight hair shows incomplete dominance over curly hair. An individual who is heterozygous for this trait would be most likely to have straight hair. curly hair. wavy hair. brown hair. It is impossible to say from this information.

wavy hair

Imagine a cross of two triple heterozygous pea plants with tall stems and axial purple flowers (genotype TtAaPp). Using the rules of probability, determine what proportion of offspring will have dwarf stems and axial purple flowers. ¼ × ¼ × ¼ = 1/64 ¼ + ¾ + ¾ = 7/4 ¼ × ¾ × ¾ = 9/64 ½ × ½ × ½ = 1/8 ¾ × ¾ × ¾ = 27/64

¼ × ¾ × ¾ = 9/64