Bio Study Guide: Ch 10-13

Which letter indicates the terminator code sequence?

far right arrow, structural genes

mRNA is translated once the ribosome binds to the initiator codon: codes for methionine. What is the amino acid sequence produced from this piece of mRNA?

methionine, proline, cysteine, serine, histidine, leucine, stop

A substitution mutation occurs in the DNA that codes for this mRNA. As a result the initial code sequence is changed from AAAUGCCC to AAAUGCCU. What effect will this have on the process of translation?

no effect since CCC and CCU both code for proline

A frameshift mutation occurred in the DNA that codes for this mRNA. As a result there is an extra uracil located at nucleotide #24 so that the end sequence is now AAUGGGGCA. What effect will this have on the translated mRNA?

no effect since the stop codon has already been reached

A scientist identifies the following piece of DNA: ATGCGACTACCATATT. After analysis he identifies pre-mRNA sections from this DNA sequence. Which of the 5 RNA's shown below would not be a possible mRNA sequence from this DNA.

resulting mRNA is UACGCUGAUGGUAUAA, pre-mRNA includes introns and exons and the introns are non-coding segments that need to be removed

Which term describes a genome?

the complete genetic material in an individual

In pedigree #1 which letter(s) indicates individuals who may be carriers?

the grandparents and mother are carriers, and possibly one of the unaffected grandchildren

What would happen if a substitution gene mutation were to occur in the operator region of an operon?

the operator gene wouldn't easily bind to the repressor protein, and (in prescence of inducer) transcription would continually occur

What would happen if non-coding DNA from a eukaryotic cell were placed in a bacterial plasmid?

the plasmid wouldn't be able to produce proteins and the resulting transgenic organism wouldn't express the genes

The purpose of this process it to...

the purpose is to identify a person using DNA fingerprinting, especially for a crime or to trace human origins

If an insertion point mutation were to occur at location 5` ATGGCCGAX what would happen?

the restriciton enzyme Alul will only make one cut instead of 2

What process do the scissors represent?

the restriction enzyme cuts out a DNA fragment from the plasmid, resulting in sticky ends

What would happen at B if the DNA sequence of the sticky ends was changed by a mutation.

the sticky ends would no longer be complementary and couldn't bind

Which letter indicates a substance (the inducer) which controls gene function by either the presence or absence of that molecule?

the top arrow, lac operon binded to repressor protein

Which letter represents the production of a transgenic organism?

the very last arrow, represents the recombinant DNA in the bacterium, which leads to a transgenic organism

What would happen to this process if the correct restriction enzymes were not used in this process?

you could cut the wrong DNA fragment/ nucleotide sequence which could lead to the wrong segments moving when the gel electrophoresis is added, and a false fingerprint identification

During S phase of mitosis DNA is replicated. What is needed in order for DNA replication to occur properly during this phase of the cell cycle?

(not 100% sure), primers are needed, regulatory "traffic lights" regulate when S phase starts and is ready

What is the correct sequence for the making of a DNA fingerprint?

1. cut DNA with restriction enzyme 2. run restriction fragments through gel electrophoresis 3. transfer DNA to membrane, add radioactive probes that bind with complementary DNA 4. expose X-ray film to membrane

Knowing the structure of an operon, which letter indicates the gene that controls the production of the enzyme that either allows or prevents expression of the structural genes?

1st arrow (left to right), regulator gene

Which letter indicates the part of the system that is necessary for production of the mRNA which will be used in production of a protein?

3rd arrow (left to right), RNA polymerase

A strand of a piece of DNA has the code sequence CGCGCCGCCCGGCCC. What are the number of tRNAs needed for translation and their tRNA anticodon sequences?

5 tRNAs are needed for translation (each tRNA has an anticodon), GCG/CGG/CGG/GCC/GGG

How many amino acids are needed for translation of a piece of mRNA with the code sequence of CUAGAUCGCUAAGAGAUAUUAGCGUCU?

9 amino acids, each codon codes for 1 amino acid

Which enzyme(s) will cut this DNA in two places?

AluI

What would happen in if the part of the system labeled B were absent?

B will probably be either promoter or operator, if promoter is absent the RNA polymerase won't advance because it won't recognize the promoter, if the operator is absent the RNA polymerase won't advance because it is the switch that allows the polymerase to advance

A scientist wants to determine the sequence of a number of genes on a chromosome. Using crossing-over percentages he determines the sequence of the genes A to E. Use the data below to determine the correct sequence of the genes. The distance is measured in map units. Data: AC = 20 AD = 30 AB = 80 BE = 20 CD = 50 CE = 80

C,A,D,E,B (write out chromosome map to understand better)

A eukaryotic cell has a piece of DNA with the following code: GCT/CTT/ATA/ACG/AAA/TCC/TTA What is the code for the mRNA when this Pre-mRNA is modified into its final form? Codons 2,4,& 6 are all introns.

CGA/UAU/UUU/AAU

One strand of a piece of DNA has the sequence CGCCATAATCGATATAA. What is the code for the mRNA transcribed from this piece of DNA?

GCGGUAUUAGCUAUAUU

What is a possible DNA code for a polypeptide with the following sequence? glycine-serine-glutamic acid-tryptophan

GGA/AGU/GAA/UGG

Which enzyme(s) will cut this DNA in one place?

HaeIII, HindIII

What role does polymerase chain reaction have in this process?

PCR copies a segment of DNA repeatedly so that there is a large sample of DNA that is identifiable by gel electrophoresis

Choose the correct order that genes are found on a general operon found in a prokaryotic cell.

Promoter, operator, and structural genes (regulator gene isn't included in operon)

One strand of a piece of DNA has the sequence ATCGATCGTTGCATCGAT. What is the code for the complimentary strand?

TAGCTAGCAACGTAGCAT

What process is shown in the diagram?

Translation

A piece of mRNA has the code sequence AGCAACCUCUAUACC. What is the tRNA anticodon sequence for this piece of mRNA and how many codons are present?

UCG/UUG/GAG/AUA/UGG, 5 codons are present

What will happen when the bacteria at 'C' starts to grow and reproduce?

after the bacteria reproduce/grow into colonies, the bacteria colony with the desired DNA is identified by a probe

A DNA sequence is GCCTAGCGAATGCTA. What is the amino acid sequence for the complimentary strand when it is translated?

arginine, isoleucine, alanine, tryosine, aspartic acid

What is the amino acid sequence for a piece of mRNA with the code CGGUUCAUAAAA

arginine, phenylalanine, isoleucine, lysine

Which inheritance pattern is described by pedigree #1?

autosomal recessive

Which inheritance pattern is described by pedigree #2?

autosomal recessive

Which term describes the site of active transcription of DNA?

euchromatin

In pedigree #2 which letter(s) indicate individuals who may be carriers?

every kid (2nd gen) could be carriers