biology 100 final exam

in human gamete production there is an average of _____ crossover events per chromosome pair.

2-3

A gene is a sequence of DNA nucleotide bases that codes for a single protein. Approximately how many nucleotide bases would be required to code for a protein chain that is 100 amino acids long?

300

Which of the following statements about evolutionary adaptation is true?

A population that has an increase in frequency of alleles for thicker fur has become adapted to the cold.

How are adaptations beneficial to organisms?

Adaptations help organisms survive and reproduce in a particular environment.

A single cell, the zygote, can develop into an entirely new organism with many different specialized cells. Which of the following statements about this process is false?

Additional genetic information for the formation of specialized cells is passed on to the developing embryo via the mother.

The four bases contained in DNA are _____.

Adenine, Thymine, Guanine, Cytosine

Suppose that every few years, all people over 6 feet tall do not have any children. How will this affect the human population?

Alleles that promote "tallness" will decrease in frequency.

What is the transcription product of the sequence GCTAGCGATGAC?

CGAUCGCUACUG

Which statement regarding DNA packing is false?

DNA packing tends to promote gene expression.

DNA carries out two basic functions in cells: (1) information storage and transfer (genes can be copied and passed to offspring) and (2) the "blueprint" function (genes provide instructions for building proteins). The key process for information storage and transfer to offspring cells is _____.

DNA replication.

The central dogma describes how the genes in the nucleus work to produce an organism's phenotype. Another way of putting it is that the central dogma follows the flow of information from _____.

DNA to protein.

Which of the following would indicate a base pairing mutation in DNA?

G pairing with a T

If one strand of DNA is CGGTAC, then the complementary strand would be

GCCATG

The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a tRNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?

GUA

Describe the function of a gene.

Genes are a section of DNA that are in charge of different functions like making proteins.

Which of the following statements correctly describes mRNA processing in eukaryotes?

Introns are cut out, and the resulting exons are spliced together.

Which of the following is a misconception regarding natural selection?

Natural selection progressively refines organisms' adaptations, eventually leading to perfection.

A proto-oncogene is a normal gene that can change into an oncogene. Oncogenes are potentially lethal genes that can cause cancer. Why do cells continue to maintain proto-oncogenes?

Proto-oncogenes are necessary for normal control of cell division.

Which of the following enzymes catalyzes the production of a strand of RNA from DNA?

RNA polymerase

Which statement regarding skin cells and muscle cells in your body is true?

Skin cells and muscle cells each contain information about both muscle proteins and skin color.

A population of small fish lives in a lake with a sandy bottom. The major predator of these fish is a wading bird that hunts by sight. Most of the fish are light sandy brown, but about 10% are mottled. The color pattern is heritable. A construction company dumps a load of gravel in the bottom of the lake, giving it a mottled appearance. Which of these statements presents the most accurate prediction?

The proportion of mottled fish will increase over time.

Alternative RNA splicing has revealed inaccuracies in the one gene-one polypeptide hypothesis. Why?

Transcription of the same gene can lead to the production of different mRNAs and therefore different proteins.

When messenger RNA (mRNA) is being transcribed, the RNA base _____ always pairs with the base _____ in DNA.

U.........A

Proto-oncogenes have the potential to become oncogenes. Which of the following is most likely to lead to cancer?

a mutation that causes the proto-oncogene to become overactive

An anticodon is __________.

a set of triplet bases on a tRNA that is complementary to a codon triplet on mRNA

The shape of a DNA molecule is most like

a twisted rope ladder

In female mammals, the inactive X chromosome in each cell

becomes a barr body

The coding regions of a gene are called

exons

_____ is a carcinogen that promotes colon cancer.

fat

The ease with which humans travel across the globe is likely to increase _____.

gene flow

Which of the following are causes of evolutionary change?

gene flow genetic drift natural selection mutation

All the genes in a population are that population's _____.

gene pool

Modern travel along with migration reduces the probability of _____ having an effect on the evolution of humans.

genetic drift

A female that is planning to become pregnant is concerned about her exposure to environmental mutagens which may have caused DNA mutations. In order for these mutations to become heritable, they must affect the:

her egg cells

Which of the following is a function of a tRNA molecule?

joining to only one specific type of amino acid

A particular gene does NOT constantly churn out the same protein at all times in every cell. This is true for two reasons. First, _____ can allow one gene to produce several different proteins. Second, genes are constantly being turned on and off through the process of _____.

mRNA processing ... gene regulation

A virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout the organism's chromosomes. This will probably cause _____.

manufactured proteins to be short and defective

When they were first sold, certain insecticides were highly effective in killing mosquitoes. Today, dozens of mosquito generations later, a much smaller proportion of these insects die when sprayed with the same chemicals. Fewer insects are killed today because __________.

many mosquitoes today are descendants of mosquitoes with insecticide-resistant characteristics

Homologous pairs of chromosomes are lined up independently of other such pairs during _____.

metaphase 1

Generation-to-generation change in the allele frequencies in a population is _____.

microevolution

Genetic drift is __________.

more likely to have an impact on small populations

Crossing over, resulting in an increase in genetic variation, occurs between _____.

nonsister chromatids of homologous chromosomes

The smallest unit that can evolve is a _____.

population

Consider the following sequence and explain what effect the mutation has on the protein that is translated.UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type)UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

prematurely stops the translation of the protein

Which of the following best expresses the concept of natural selection?

reproductive success influenced by inherited characteristics

The tortoiseshell pattern on a cat

results from X chromosome inactivation.

A homeotic gene

serves as a master control gene that functions during embryonic development by controlling the developmental fate of groups of cells.

DNA replication occurs at an unbelievably fast rate. Once replication is complete, we can expect to find a _____ number of mistakes.

small

Which of these is NOT a carcinogen?

testosterone cigarette smoke UV light fat all of the above are carcinogens

After translation is complete, the insulin polypeptide is activated by __________.

the cutting of the initial translation product to yield two shorter chains joined together by sulfur linkages

If you analyzed the nucleotide content of DNA, you would expect to find that __________.

the ratio of A to T is close to 1:1 and the ratio of G to C is close to 1:1

Genetic drift is a process based on _____.

the role of chance

If protein production were an assembly line, a ribosome would be _____.

the worker who puts all of the pieces together

A mutation occurs when _____.

there is a change in the DNA sequence of a gene

How do mutations affect an organism?

they may cause the development of a disease-causing allele they may cause the development of a more beneficial allele they, in some cases, may have no noticeable affect

The relationship between DNA and histones is most like

thread wrapped around a spool

tRNA molecules work to _____.

translate mRNA to produce a specific amino acid sequence

Which mechanism of controlling gene expression occurs outside of the nucleus?

translation

Life on Mars is finally discovered and a new organism that has six different nucleotides that encode 30 different amino acids is found on this planet. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism?

two-nucleotide sequence (62 combinations)