Biology 202 Final Exam

Which of these same characteristics describe bacterial chromosomes? (Circle any that apply.) Circular, linear, made of DNA (single or double-stranded), made of RNA (single or double-stranded)

Circular, double stranded DNA

I- O+ Z- Y+/F'I+ O+ Z+ Y- Expression of Z and Y and conclusion

- + - + lacI+ is trans-acting

IS O+ Z+ Y+/F'I+ O+ Z+ Y+ Expression of Z and Y and conclusion

- - - - lacIS is dominant to lacI+ and is trans-acting (it affects both chromosomes)

Design 2 primers to amplify this sequence: 5' ATGTTCCAAATGCGTGCAGTCAGTCCCTATTCA 3' 3' TACAAGGTTTACGCACGTCAGTCAGGGATAAGT 5'

5' ATGTTCCAA 3' 5' TGAATAGGG 3'

Here is a complete/mature mRNA transcript. Write down the 2 ORFs, and which one is the correct ORF? 5' AUCGAUGUUCUGGUUUCAUGUCCUGAUUGCUUAAUUGAUU 3'

5' AUCG AUG UUC UGG UUU CAU GUC CUG AUU GCU UAA UUGAUU 3' (This is the correct one becaue usually the one coding for the longer polypeptide is the correct one)

Once elongation is underway, tRNAs involved in the process occupy a series of sites on the complexed ribosome. The occupation of sites occurs in the following order.

A site, P site, E site

What is the "backbone" of DNA?

A sugar phosphate backbone

Transgenic organism

An organism that contains hereditary information from two different species of organisms; GMO technology creates transgenic organisms. For example, a genetically modified soybean has a gene from the bacteria Salmonella that degrades Roundup.

What is the relationship between complexity of the organism and introns?

As the organism gets more complex, intron size increases

What is the centromere and what does the DNA sequence look like at the centromere?

At the centromere, the DNA is composed of repetitive sequences. The separation of homologs during meiosis and mitosis depends on the centromere. The centromere is the heterochromatic (remember that the heterochromatic areas are important to chromosome movement during cell division) chromosomal region at which sister chromatids remain attached after replication and the site at which spindle fibers attach to the chromosome during cell division.

What happens if the GH gene doesn't have restriction sites on either side of the gene?

Attach the EcoR1 site to the 5' sites primers that recognize the GH gene. Primer will attach to the template strand and you will get replication in the 5'-3' direction and you will end up getting the EcoR1 sites on both ends of the product. This is how you can get a restriction site attached to your gene so it can be inserted into vectors. (PRIMER CANNOT BE ON THE 3' END BECAUSE THEN IT WOULD NOT HYBRIDIZE TO THE GENE, THE PRIMER ON THE 5' END)

Do gain of function mutation create dominant or recessive alleles and why?

Dominant alleles; you get more gene product, because even in heterozygotes, if you have one wild type allele and one mutated gain of function allele you will still be functioning at a higher level because of the one allele on top of the other allele

Why do gain of function mutation create dominant or recessive alleles and why?

Dominant alleles; you get more gene product, because even in heterozygotes, if you have one wild type allele and one mutated gain of function allele you will still be functioning at a higher level because of the one allele on top of the other allele

For normal WT function of a gene, 450 units of protein are required. Allele R1 produces 400 and R2 produces 200. Is R1 haplosufficient or haploinsufficient and is it dominant or recessive?

Dominant and haploinsufficient

7 concepts or processes that require base pairing (A-T or G-C or A-U) to occur.

DNA replication, transcription, telomerase, tRNA codon recosgnition during translation, RNA folding, PCR primer annealing, hybridization of probes,

Sort the following terms based on whether it is involved in DNA replication, transcription, or both: RNA primers, RNA polymerase, DNA polymerase, promoters, origin of replication, new strand built in 5'—>3' direction, new strand built antiparallel to old strand

DNA replication: RNA primers, DNA polymerase, origin of replication Transcription: promoters, RNA polymerase Both: new strand built in 5'—>3' direction, new strand built antiparallel to old strand

How are chromosomes packaged in eukaryotic cells?

In eukaryotes, there are proteins called histones and bound more tightly around DNA and around each other and turned into chromosomes.

On a recent trip to the moon, you discovered a small bacteria-like creature. Once you returned to Earth, you examine it in a lab and discover the following: ¥ The genetic material is DNA ¥ The DNA is transcribed into mRNA ¥ The mRNA is translated into proteins ¥ It uses the same 20 amino acids as humans ¥ Human tRNAs are incompatible with their ribosomes ¥ The DNA is only made up of two nucleotides, G and C Predict what might be different about the length of codons of this alien life form.

In order for there to be enough combinations of nucleotides to create at least 20 unique codons, there would have to be 2n bases per codon, where 2n ≥ 20. N=1, 2 codons N=2, 4 codons N=3, 8 codons N=4, 16 codons N=5, 32 codons Therefore, there would have to be at least 5 nucleotides per codon in order for the DNA to code for 20 different amino acids without codon ambiguity.

_____ of translation always happens at the start codon of the mRNA.

Initiation

The CAP protein is what type of regulator for the lac operon?

Positive; when it is bound, transcription can occur

What will indicate direction of transcription?

The location of the promoter will dictate the site of RNA Polymerase binding and direction of transcription.

Heterochromatin

more tightly compacted region on the chromosomes; genetically inert; prematurely condensed; either lack genes or contain repressed genes

neutral mutation

can occur in the protein coding region of the genome or any other location and has no affect on the genetic fitness of the organism

Is

can override I+; non-inducible; super-repressor; mutant repressor molecules cannot interact with the inducer, lactose and structural genes are permanently expressed

Some proteins in eukaryotes will be secreted from the cell and these proteins are built on ribosomes that are associated with the

endoplasmic reticulum

A mutation results in an enzyme that is partially active compared to the wild-type allele. This type of "leaky" mutation is classified as

hypomorphic (loss of function

null mutation

is a mutation that results in the complete loss of function compared to the wildtype gene product

When a peptide bond is formed between two amino acids, one is attached to the tRNA occupying the P site and the other _______.

is attached to the tRNA occupying the A site

crossing over

is the exchange of genetic material between chromatids.

What is replication?

is the process that leads to the production of identical copies of the existing genetic information.

What is expression?

is the processing of genetic information that results in synthesis of proteins which contribute to the phenotype of the organism.

What does the protein do in the spliceosome?

it actually does the splicing

Why can normal activity in the lac operon be restored in an I- by adding an I+ in an F' plasmid?

it can restore inducibility because the normal wild-type repressor is a trans acting factor

Does the repressor protein in the lac operon come from the environment or synthesis?

it is synthesized from lac I

The new DNA strand that grows continuously in the 5' to 3' direction is called the

leading strand

Unicellular organism

prokaryote

The cell type that does not have introns in its genes

prokaryotes

Are bacteria prokaryotic or eukaryotic?

prokaryotic

The RNA that has an amino acid attached to it, and that binds to the codon on the mRNA, is called a

tRNA.

For the genotype, I + O+ Z+/ F' I + O+ Z+ what would happen to ß-galactosidase?

ß-galactosidase made only when there is lactose; inducible

T/F: When treating an organism with a mutagen, although it is possible that homozygous mutations will occur, it is more likely that most new mutations will be heterozygous or hemizygous.

True

T/F: Skin, neuron, and gut cells all have the same genes?

True

T/F: Some restriction endonucleases are capable of producing blunt ends; others can generate "sticky" ends.

True

T/F: The triplet AUG is commonly used as a start (initiation) codon during translation.

True

T/F: Under a system of positive control, transcription does not occur unless a regulator molecule directly stimulates RNA production.

True

T/F: When considering the structure of DNA, we would say that complementary strands are antiparallel.

True

T/F: Within a six-base DNA recognition sequence, an enzyme that cuts between the 3rd and 4th bases from the 5' end will generate blunt ends.

True

T/F: mRNA is single stranded

True

True or false. These two repetitive types of sequences do not code for genes.

True

T/F: Single‑strand binding proteins stabilize the open conformation of the unwound DNA.

True (Once helicase unwinds the double helix, single‑strand binding proteins bind to the open DNA and prevent it from winding together again.)

T/F: Eukaryotic chromosomal DNA is associated with both histone and nonhistone proteins.

True (Histone play the most important structural role in compacting DNA, but other proteins associated with DNA are involved in other processes, such as the regulation of gene transcription)

In humans, what determines maleness?

Y chromosome

The kind of genetic information passed from a father to all his sons.

Y chromosome

I+ O+Z- Y+ With and without lactose and the effect on both Y and Z.

Y is inducible

Can I+ override I-?

Yes

Do eukaryotes have enhancers?

Yes

Do eukaryotes have epigenetic markers, such as methyl groups?

Yes

Do eukaryotes have higher order transcriptional complexes?

Yes

Do eukaryotes have nucleosomes?

Yes

Do eukaryotes have promoters?

Yes

Do eukaryotes have silencers?

Yes

Do prokaryotes have operons?

Yes

How can you get different mRNA products from the same gene?

alternative splicing

Is the N-terminus of a protein the amino or carboxyl end?

amino

Amino acids are attached to tRNA by enzymes called

aminoacyl-tRNA synthetase.

Loss of Function

amorphic and hypomorphic; no (null) gene product or decreased gene product; often recessive

UV light can penetrate living cells and cause what?

can cause mutations in skin cell DNA (thymine dimer) and also cause the breakdown of folate in the bloodstream

I- O+ Z+ Y+ Expression of Z and Y and conclusion

+ + + + lacI- is constitutive

Both melanin and surfactant genes are present in all cells. Explain why melanin is not expressed in a lung cell.

. In the skin cell, trans factors interact with the melanin gene, but they do not interact with the surfactant gene, and in the lungs, the trans factors only recognize the cis factors in the promoter of the surfactant gene, not the melanin gene

How many Barr bodies are seen in an individual with 45X

0

How many Barr bodies are seen in an individual with 46 XY

0

5 differences between prokaryotic and eukaryotic chromosomes:

1) Prokaryotic chromosomes are circular, and eukaryotic chromosomes are linear 2) Prokaryotic chromosomes have no telomeres because they are circular, while eukaryotic chromosomes have telomeres to protect the ends 3) Eukaryotes have introns, while prokaryotes do not 4) Eukaryotes have histones 5) Eukaryotes have more noncoding DNA

Ratio of microbe genes: human genes?

100:1

Ratio of microbes: to human cells?

10:1

A protein is 300 amino acids long. What is the number of nucleotides in the section of DNA that codes for this protein?

1800

Place in chronological order: RNAP polymerase is recruited to the promoter Pre-initiation complex recognizes and binds promoter RNA is synthesized DNA is unwound

1: Pre-initiation complex recognizes and binds promoter 2: RNAP polymerase is recruited to the promoter 3: DNA is unwound 4: RNA is synthesized

How many alleles does an individual have for one locus?

2

How many aneuploid daughter cells will be created if nondisjunction occurs in meiosis II?

2

How many possible open reading frames extend through the following sequence? 5' ... CCAATCGTGTATTAGGGCATGTTTATTGATACGGAGCATTAATT ... 3' 3' ... GGTTAGCACATAATCCCGTACAAATAACTATGCCTCGTAATTAA ... 5'

2

If you could build a protein with 10 amino acids, and any amino acid could be at each position, how many variations are possible?

20^10

How many consensus core promoter sequences do prokaryotes have?

2; -10, -35

How many alleles does each person have for a given gene and why?

2; one from Mom and one from Dad; since diploid organisms have two copies of each chromosome, they have two of each gene.

Guanine complementarily binds with cytosine and forms how many and what type of bonds?

3 hydrogen bonds

When an amino acid is chemically linked to the _____' end of a tRNA, this process is known as ________. Enzymes perform this chemical linking and they are known as ___________. It is believed there are 20 different ones, one to link each different amino acid to a tRNA.

3; charging; aminoacyl tRNA syntheses

Deoxyribonucleotides bind together to form polynucleotides. This bond occurs between the phosphate group of one nucleotide and the C- ____' position of a ______ of another nucleotide. The type of bond formed in this interaction is called a ________ bond.

3; sugar; phosphodiester

If you had an oligonucleotide that had 17 nucleotides, how many variations would be possible? Show your math

4^17

What is the minimal number of tRNAs needed to recognize: 5' AUG CAA GGG AAG GGA CAU UAG 3'

5

Draw a CpG site

5' ...CG...3' 3' ...GC...5' (Cs are methylated)

How does the percent of human genome containing transposons compare to the amount coding for genes?

50% of human genomes are derived from transposable elements, while only 2% of the human genome codes for genes

A daughter cell formed by meiosis has three chromosomes. If the first two are maternal chromosomes, what is the probability that the third is also maternal?

50%; independent assortment means that each homologous pair is randomly separated and the fate of the homologs does not depend on the fate of any other homologous pair.

The promoter that the polymerase recognizes is in the _____' region of the coding strand and in the _____' region of the template strand

5; 3

Another name for the 5' cap in eukaryotes

7-methylguanosine cap (7-mG)

An organism has a diploid number of 16 in a primary oocyte. How many tetrads are present in prophase I? How many monads migrate to each pole during anaphase II? How many dyads are present in prophase II?

8; 8; 8

How is an mRNA transcript altered in eukaryotes before it leaves the nucleus?

A 5' cap and a poly-A tail are added and the introns are spliced out and pushed the exons out.

How many alleles are there in the population for a single locus?

A BUNCH

What is a promoter?

A DNA sequence that specifies the start site for transcription. The promoter is a DNA sequence that is recognized and bound by RNA polymerase at the initiation of transcription.

Describe the relationship between genes and chromosomes.

A chromosome is composed of DNA complexed with proteins, and many genes are found along the length of a single chromosome.

What is the phenotype of the Oc cell?

A constitutive mutation in which enzymes are constantly produced even in the absence of lactose because the operator region is mutated and so the repressor protein cannot bind to it

What is the phenotype of bacteria in which the repressor is altered in its binding to the operator (I-)?

A constitutive mutation in which enzymes are constantly produced even in the absence of lactose.

What is a diffusible product and give an example.

A diffusible product is for example a trans-acting element that doesn't have to be adjacent to the gene and is capable of flowing. An example of this is the repressor protein in the lac operon

What is the difference between a SNP and a mutation?

A mutation is found in less than 1% of the population, whereas a SNP is found in more than 1% of the population. Most mutations are found in genes, which is why they are in less than 1% of the population, and most SNPs are not, but that doesn't mean that a SNP can't be found in a gene or vice versa.

frameshift mutation

A mutational event leading to the insertion or deletion of one or more base pairs in a gene, shifting the codon reading frame in all codons that follow the mutational site

Prophase II

A new spidle forms around the chromosomes.

Bacteria are haploid, but they used a method that allowed them to make merozygotes, which means what?

A partially diploid bacterial cell containing, in addition to its own chromosome, a chromosome fragment introduced into the cell by transformation, transduction, or conjugation; it is diploid for certain genes. For example, the F plasmid may contain chromosomal genes, designated F'. When an F- cell acquires such a plasmid, it contains its own chromosome, plus one or more additional genes present in the plasmid, creating a merzygote host cell that is diploid for certain genes.

Which of the following outcomes would be most likely if the Hershey-Chase experiments were repeated without the step involving the blender? A) Both preparations of infected bacteria would exhibit radioactivity. B) Both preparations of infected bacteria would contain both P32 and S35. C) The phage would fail to infect bacteria. D) Neither preparation of infected bacteria would exhibit radioactivity.

A) Both preparations of infected bacteria would exhibit radioactivity. (Instead of being removed from the preparation, the "ghosts" would be retained. Because both bacterial preparations would include ghosts as well as viral DNA, both would be radioactive, one with P32, one with S35)

Which of the following clusters of terms applies when addressing enhancers as elements associated with eukaryotic genetic regulation? A) cis-acting, variable orientation, variable position B) trans-acting, fixed position, fixed orientation C) cis-acting, variable position, fixed orientation D) cis-acting, fixed position, fixed orientation E) trans- and cis-acting, variable position

A) cis-acting, variable orientation, variable position

When DNA is denatured, what bonds break first?

A-T

Draw a DNA molecule with the sequence: ACGT on one strand (you can figure out what will be on the other strand).

A===T C===G G===C T===A

Acetylation

Acetyl groups added to histones that alters association between DNA and histones and remodels chromatin so DNA isn't as tightly associated with histones. More acetylation=more transcription

What is a positive control in the Ames test? (name 2)

Adding the mutated strain to a plate containing histidine or adding a known mutagen to the plate with the mutated bacteria

What does the cell theory state?

All organisms are composed of basic units called cells, which are derived from smaller preexisting living structures.

Explain how alleles are related to proteins.

Alleles are different forms of the gene, and produce different proteins for the same gene, so the function of the protein and expression of the gene may be different depending on the allele.

The name of the test that identifies if a chemical is a mutagen.

Ames test

20 units of a gene's product, the protein fibrinogen, are needed for normal expression (i.e. enough for normal blood clotting). Each wildtype allele (R1) produces 25 units and a mutant allele (R2) produces 0 units. Is the mutant hypermorphic, amorphic, hypomorphic, or neomorphic?

Amorphic: no gene product produced

How does telomerase work?

An enzyme in eukaryotes, the telomerase. The telomerase uses 5' to 3' synthesis to add more TTGGGG to the 3' end. The enzyme contains a short piece of RNA to serve as a guide to tell where the telomerase should bind, but also to serve as a template for reverse transcription. After the telomeric DNA is synthesized into the G-rich tail, the telomerase is translocated and repeated

What is an autosome?

Any chromosome that is not a sex chromosome

Where does the ribosome begin translation?

At the AUG (the first one that it encounters) on the mRNA (AUG is a start codon and it also codes for Met, so the first AUG that is encountered is where it starts )

All EXCEPT which of the following mutagenic events occur spontaneously? A) deamination B) alkylation C) depurination D) tautomerization

B) alkylation (A chemical mutagen called an alkylating agent is required to alkylate a base.)

Many forms of DNA exist, but what form is physiologically relevant and the form that Watson and Crick described?

B-DNA

What type of promoter do we need to express a human gene in bacteria?

Bacterial promoter

What is the definition of dosage compensation?

Balancing the dose of X chromosome gene expression in males and females; in humans this is done by turning one female X chromosome into a Barr body in humans

A heterochromatic structure in female mammalian genomes.

Barr body

If dark skin protects against UV damage to folate, why wouldn't all humans have dark skin?

Because there are some UV rays that are advantageous, such as UVB rays that provide Vitamin D that is important for bone density and bone development. As you go up north, you have lighter skin because you don't need as much protection from UV, but you also need to let in the UVB rays to make vitamin D

Why is the phenotype (the LEP-R aka leptin receptor) obesity when someone has two copies of the B allele?

Because there is an early stop codon in sequence B, the protein will be a lot smaller, so maybe the dimer will not form because the 2 proteins are shorter, and if the dimer doesn't form, then it might not interact with Jak2 because it probably won't be able to bind leptin. You won't have the downstream signaling.

A recessive mutation in an enzyme (a) alters the structure of its active site such that the protein has no functional activity. In a heterozygote (Aa), gene expression occurs from which allele and why?

Both alleles because both alleles are expressed, but the phenotype comes from the wild type allele in this case. The dominant allele led to the functional protein product that produced a phenotype, but if you look in the actual cell, you will see both protein products from expression of both alleles

In meiosis, does crossing over contribute to hereditary, genetic variation, or both and why?

Both because crossing over leads to genetic variation by creating chromosomes that mix segments of material and paternal origin, but crossing over is also important for synapsis to occur properly, and synapsis helps ensure that each daughter cell receives one complete set of chromosomes

In meiosis, does DNA replication contribute to hereditary, genetic variation, or both and why?

Both because of mutations that occur during DNA replication can contribute to variation

Synthesizing DNA takes energy. Where does that energy used to add new nucleotides come from?

Breaking the high-energy phosphate bonds of the dNTPs used to build a new strand of DNA provides the energy needed to build the new stand.

Consensus sequences in the promoter regions of eukaryotic genes

CAAT box (in proximal), TATA box (in core), GC-rich box (in proximal)

Common consensus sequences in proximal promoter regions in eukaryotes

CAAT box and GC-rich box

What activates transcription of the lac structural genes?

CAP-cAMP complex

If the DNA is wrapped really tightly around proteins and the proteins are all bunched up together, the transcriptional machinery and the proteins that are needed to start transcription (can/cannot) access the DNA to express the genes

Cannot

If Hershey and Chase instead chose radioactive Carbon to label their protein, why would this pose a problem to making a conclusion on the genetic material?

Carbon is in both DNA and protein, so they would not have been able to differentiate.

Anaphase II

Centromeres divides. chromatids move to the opposite poles of the cells.

What is the leading hypothesis as to why someone with XXY genotype has a phenotype, if dosage compensation occurs in these individuals?

Chromosomal inactivation doesn't occur normally occur in the early stages of gonadal tissue formation. Also, not all genes on the Barr body get inactivated, up to 15% escape inactivation, and incomplete activation of one of the X chromosomes will lead to getting a double dosage of certain genes

Telophase I and Cytokinesis

Chromosomes gather at the poles of the cells. the cytoplasm divides.

Metaphase II

Chromosomes line up at the equator.

What is the first order of chromatin packing?

Coiling around nucleosomes (The first order of chromatin packing occurs when DNA coils around nucleosomes, whereby DNA is reduced to about one‑third its original length)

I+ O+Z- Y+/I+ OcZ+ Y+ With and without lactose and the effect on both Y and Z.

Constitutive

Which of the following can account for multiple types of proteins from a primary transcript? A) Polyribosomes B) Reverse transcription C) 5' methylation D) Alternative splicing E) All

D) Alternative splicing (5' cap will come before start codon so it will not be translated)

Which of the following molecules is not required for a PCR reaction and why? A) DNA B) DNTPs C) Primer D) Ligase

D) Ligase (Ligase is not needed, because it is single stranded DNA, and there are no Okazaki fragments that need to be joined)

A protein fragment has the following sequence: NH3+ -Met-Cys-Asp-Met-COO-. The DNA template strand sequence (5 ́-3 ́) would be: A) AUG UGC GAC AUG UAA B) ATG TGC GAC ATG TAA C) AAT GTA CAG CGT GTA D) TTA CAT GTC GCA CAT E) TAC ACG CTG TAC ATT

D) TTA CAT GTC GCA CAT (REMEMBER THE STOP CODON)

All mutagens work at the level of ________

DNA

Are primers in PCR DNA or RNA?

DNA

Methyl groups act on

DNA

The repressor protein has two binding sites:

DNA binding domains and inducer binding domains

Which term most appropriately refers to a regulatory protein in prokaryotes?

DNA binding protein (in the lac operon example, RNAP still binds to the promoter, but its action is just blocked by the repressor protein)

Nucleosome

DNA complexed with histone proteins

What was the central conclusion of the Hershey-Chase experiment?

DNA is the identity of the hereditary material in phage T2. Because phage DNA and not protein was associated with bacteria at the end of the experiment, it could be concluded that DNA - not protein - must be the genetic material.

How is DNA packaged into a chromosome?

DNA is wrapped around proteins and are packed tightly together until they form a chromosome .

Cloned DNA

DNA molecules with the same sequence

When do mutations arise?

DNA replication

What are three ways that DNA can be made more accessible for transcription...aka how can the chromatin (genome) be remodeled?

De-methylate, acetylate, reorganize nucleosomes

What are the differences between ribose and deoxyribose?

Deoxyribose has a hydrogen atom rather than a hydroxyl group at C-2', and this is what distinguishes the two.

What is the danger of depurination of not corrected before DNA replication begins?

Depurination is the loss of one of the nitrogenous bases in the intact double helical DNA molecule. If they are not corrected, there will be no base to act as a template, so DNA polymerase will introduce a random nucleotide at that site.

How many chromosomes are in a cell?

Each human cell has 46 chromosomes and all the DNA is organized into 2 sets of 23 chromosomes

What is different about each restriction enzyme?

Each restriction enzyme recognizes a different restriction site

How does a bacteria RNA polymerase holoenzyme differ if it has one form of the sigma subunit verses another?

Each type of sigma subunit recognizes different promoter sequences

You are examining the cells of a woman and discover that some of her cells have no Barr bodies, some have one Barr body, and some have two! Explain how this is possible.

Early in development, there was a mitotic nondisjunction of a pair of X chromosomes. This resulted in one daughter cell with three X's and one daughter cell with one X. These cells then gave rise to more aneuploid daughter cells. The woman is a mosaic containing XX cells (one Barr body), XO cells (no Barr bodies), and XXX cells (two Barr bodies).

How are cis-elements and trans-acting factors different in prokaryotes and eukaryotes?

Eukaryotes have more DNA, so they have more trans and more cis-factors. They have enhancers, silencers, proximal promoters

T/F: A missense mutation causes premature chain (protein) termination.

False

T/F: DNA polymerase adds dNTP monomers in the 3′-5′ direction.

False (5'-3')

T/F: Mutations are always bad

False, not always

Make a forward primer to amplify this gene that is 9 BP long and a reverse primer that is 7 BP long 5'GCTGCCGGGACGGGTCCAAGATTGTACATCCAAATTAAAGGAAAAAAATGGAAACCATCA 3' 3'CGACGGCCCTGCCCAGGTTCTAACATGTAGGTTTAATTTCCTTTTTTTACCTTTGGTAGT 5'

Forward: 5' GCTGCCGGG 3' Reverse: 3' TGGTAGT 5'

Intron #21 in the CFTR gene is 25 nucleotides long and does not contain any stop codons. Suppose that this intron fails to get removed from the mRNA. Predict the kind of mutation that this would introduce to the CFTR protein. Explain your reasoning and describe how this will alter the final protein.

Frameshift mutation This will add 25 nucleotides to the mRNA that will be translated. 25 nucleotides is 8 1/3 codons. So this will insert 8 additional amino acids and after that everything will be out-of-frame. The protein will likely be nonfunctional and very different from the wild type version.

A group of scientists are studying how alcohol consumption affects epigenetics. In their study, they compare expression levels of gene F in heavy drinkers to that of their identical twins who rarely drink alcohol. The scientists discover that in nearly all of the twin pairs, gene F is more highly expressed in the twins that rarely drink. Compare the levels of methylation and acetylation of these individuals to their alcoholic twins.

Gene F is either more acetylated in the twin that does not drink, or more methylated in the twin that does drink more, or a combination of both

Is the evolution of Sticklebacks due to epigenetic or genetic modifications?

Genetic (the deletion of an enhancer, sequence of DNA, is genetic change)

How is genetic information encoded in a DNA molecule?

Genetic information is encoded in DNA by the sequence of bases.

In an environment where both lactose and glucose are present, what is the preferred energy source?

Glucose

Which of the following statements is true regarding bacterial chromosomes? H1 and HU are two types of DNA-binding proteins found in bacterial chromosomes. Bacterial chromosomes contain no proteins. Bacterial chromosomes contain DNA-binding proteins known as H1 and H4. Bacterial chromosomes sometimes consist of single-stranded DNA.

H1 and HU are two types of DNA-binding proteins found in bacterial chromosomes. (bacterial chromosomes are much more simple and H1 and H4 are found in eukaryotic chromosomes)

Enhancers do what?

Help achieve maximum levels of transcription; responsible for time and tissue specific gene expression Help regulate gene expression at the level of transcription

The kidneys need chlorine channels in order to maintain blood volume level. In the small intestine, having too chlorine channels can lead to diarrhea and dehydration. If you took a cell from your gut and made a karyotype, would you expect the gene that codes for the chlorine channel to be in heterochromatin or euchromatin? How would this be visualized on your karyotype?

Heterochromatin and it would be darkly stained and tightly packed and the genes would not be accessible

What types of epigenetic tags would you expect to see on heterochromatin?

High methylation, low acetylation

The human genome project (which determined the sequence of the 3 billion base pairs of the human genome) was successfully completed in 2003. What were some of the surprising results from its completion?

Human genome has less genes than plants, and humans have the same number of genes as fish and mice, and it made them wonder if something else was going on, since humans are more complex than plants. • Genes are not enough to describe human complexity • Chimpanzees share 98.9% of human genome • The same key genes that make up a fruit fly or a mouse also make up a human

Give an example of loss of function mutations that might occur in the lac operon:

I-, Z-, Y-

Cancer cells often have abnormal patterns of chromatin modifications. In some cancers, the DNA repair genes MLH1 and BRCA1 are hypermethylated on their promoter regions. How can abnormal methylation patterns contribute to cancer?

If hypermethylation occurs in a DNA repair gene, the frequency of mutations will increase since the repair system is compromised, resulting in an increase in mutations that may occur in oncogenes or tumor suppressor genes

During meiosis, if the non-disjunction event happens in meiosis I, what is the outcome?

If it occurs in meiosis I, you will have 2 trisomatic gametes and 2 monosomatic gametes

Why is monosomy so lethal?

If one of the genes is represented by a lethal allele, monosomy unmasks the recessive, lethal allele that is tolerate din heterozygotes carrying the corresponding wild-type allele

Where are promoters located relative to a gene?

Immediately adjacent to the gene that they regulate

Coding Region

In prokaryotic and eukaryotic DNA; contains the information for the structure of the expressed protein.

List several examples of how genetic modification technology is being used today.

Increase crop yields, add nutritional quality to food, improve agricultural practices, they are looking into adding vaccines to food

As human populations evolved to be more hairless, what happened to skin color?

Increased melanin production in skin and darker skin

Native people living near the arctic circle would be predicted to have light skin, but they have dark skin. Why might this be so based on the second hypothesis?

Indigenous people with lots of vitamin D in their diets have dark pigmentation

What is the relationship between degree of methylation of DNA and degree of gene expression?

Inverse, for example, the inactive female X chromosome is highly methylated. Methylation inhibits the binding of TFs to DNA and methylated DNA may also recruit repressive chromatin remodeling complexes to gene regulatory regions)

Uninducible mutation on the lac operon

Is

Example of trans-acting mutations in the lac operon

Is and I-

How do you make cDNA library?

Isolate mRNA from cells that express an abundance of mRNA for the genes to be cloned, mix the mRNA with oligo-dT primers, which are short, single-stranded sequences of Ts that anneal to the poly-A tail. The enzyme reverse-transcriptase extends the oligo-dT primer and synthesizes the cDNA, and then you have an mRNA-DNA double-stranded hybrid. The RNA in the hybrid can be enzymatically digested and the opposing strand of DNA is synthesized by DNA polymerase. Then the cDNA molecules are inserted into vectors (usually plasmids) and these recombinant plasmids are inserted into host cells for cloning

What does acetylation do to histones?

It makes them less positively charged so that they do not interact with DNA as well

Why would chromatin need to be remodeled?

Its structure must be changed so that it can accommodate the protein-DNA interactions; the dynamic forms in which chromatin exists are vitally important to the way that all genetic processes involving DNA are executed.

What is the consequence of a promoter mostly un-methylated becoming highly methylated?

Less gene expression. A highly methylated promoter cannot be accessed by trans-acting factors

the reason for a 9:3:3 ratio

Lethal when two genes are homozygous recessive.

Why are liver extracts used in the Ames test?

Liver enzymes may metabolically activate some innocuous compounds, making them mutagenic.

What type of mutation is the lacI-?

Loss of function

What type of mutation is Y-?

Loss of function because permease will not allow lactose into the cell

What makes in vivo replication and PCR similar?

Making more, identical, DNA Need nucleotides Use DNA as a template for synthesis Synthesize 5' to 3' (adds new nucleotides to the 3' end)

Down Syndrome most frequently happens as a result of non-disjunction in meiosis I or II?

Meiosis I, but sometimes meiosis II

Law of Equal Segregation

Members of a gene pair (alleles) separate equally into each gamete.

Methylation

Methyl groups added to cytosine in the DNA Less methylation=more transcription

The CAAT box, TATA box, and GC-rich regions are common sequences in many promoters that regulate gene expression. Why are these regions so often conserved?

Mutations in these regions change the level of transcription dramatically. Since most genes have evolved to be transcribed at an appropriate level, changing the rate of transcription will usually have a negative effect of the organism's evolutionary fitness.

What is the lacZ- mutation?

NO PROTEIN FUNCTION; loss of function; mutant cells fail to produce active beta-galactosidase

Is this a Trans or Cis dihybrid? Mouse with A/a ; B/b

Neither. They are not linked genes and independently assort

Can I+ override Is?

No

Can I- override I+?

No

Can Is override Oc?

No

Can CAP bind to the lac operon in the absence of cAMP?

No! When they interact, the structure of CAP is altered so it can bind to the promoter.

Bacteria with a deletion in the histidine gene is exposed to UV light that causes base pair substitutions. What type of growth would you expect when this bacteria is plated without histidine?

None, it is the wrong type of starting bacteria for this mutagen therefore no revertents.

Are RNA primers used in protein synt=hesis?

Nope, only used to initiate a new strand of DNA during replication

Example of cis-acting mutations in the lac operon

Oc and P- or a mutation in the CAP binding site

are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.

Okazaki fragments

Why can't DNA replicate all the way to the end?

On the lagging strand, once the final RNA primer is removed, there is no Okazaki fragment present to provide the needed 3'-OH that DNA polymerase needs, thus a gap remains on the lagging strand

What is an allele?

One of the possible alternative forms of a gene is called an allele.

What is the consequence of a tautomeric shift causing cytosine in in its imino form to pair with adenine?

Originally C pairs with G, but there is a mutation during replication and now it pairs with A, which during another round of replication, the A will pair with T. which is a transition mutation

Once initiation is set, the reading frame is in place because the initial AUG start codon and the initial tRNA are in the ___ site of the ribosome.

P

How can we obtain the gene of interest in recombinant DNA technology?

PCR

What is the sigma subunit of RNA polymerase?

Plays a regulatory function in the initiation of RNA transcription in PROKARYOTES; it binds to DNA

All polymerases have an exonuclease activity meaning they can do what?

Polymerize in one direction and then pause, reverse their direction and excise nucleotides just added

In the expression vector which promoter should be present to make the human GH protein in bacteria? Prokaryotic or eukaryotic promoter?

Prokaryotic promoter because we need prokaryotic transcription factors to recognize the sites Although it is a gene from the human genome, you need the cis-regulatory elements that are recognized by the transcription factors that bacteria have

What did 35S label in the Hershey-Chase experiments?

Protein, because proteins contain sulfur, but DNA does not

tRNA contains a modified nucleotide, inosinic acid or inosine that will sometimes be part of the anticodon. Is the nitrogenous base of inosine a purine or pyrimidine?

Purine, it is a 9-membered ring

The immediate product of transcription in eukaryotes is _____

RNA (mRNA is after the caps have been added to help the ribosomes recognize it as mRNA and the introns have been spliced out)

The immediate product of transcription is ________.

RNA (mRNA is after the caps have been added to help the ribosomes recognize it as mRNA and the introns have been spliced out)

Initiation phase in DNA directed synthesis of RNA

RNA Polymerase (RNAP) finds gene, accesses the DNA template, makes a short RNA, binds to the regulatory region of the promoter

What are nucleic acids?

RNA and DNA

3 things that all genes (prokaryotic and eukaryotic) have

Regulatory region, coding region, termination region

Your baby ate cake for the first time and developed minor food allergy hives. Design an experiment to figure out what in the cake she is allergic to. The design of your experiment has to match the design of the Avery, MacLeod, and McCarty experiment.

Remove an ingredient from the cake separately and feed the cake to the baby and see which cake she reacts to or doesn't react to

LINES and SINES are longer sequences and they do not repeat in tandem. Why are they called repetitive?

SINES are found up to 500,000 times and LINEs are found up to 850,000 times

The size order, from smallest to largest: plasmid, SNP, chromosome, restriction site sequence, genome

SNP, restriction site sequence, plasmid, chromosome, genome

"its fun without commitment. I just want to be single forever. Text me if you feel the same way"

SSBPs

If the sequence was much shorter, such as GA and repeated 50 times in tandem, this would be known as a

STR, short tandem repeats or microsatellite.

Name the three components of the cloning vector (circular piece of DNA that we put the GH gene into before we insert it into bacteria):

Selectable marker gene Multiple cloning sites: needed to introduce the GH gene into the plasmid Origin of replication: sequence that initiates replication of this piece of DNA

What is an ORF?

Sequences of codons in the same reading frame starting with a 5' start codon AUG and a 3' stop codon

List in order of mutation severity from least to most: Frameshift Missense Nonsense Silent

Silent < missense < nonsense = frameshift

Many female carriers of the Xcb recessive, x-linked colorblind allele are partially colorblind. How would you test a hypothesis of this?

Since some of their cells would not make the green opsin protein if the WT x chromosome was inactivated, you could look at the different cells of the eye and see which ones are making opsin protein

Many female carriers of this allele XCB/Xcb are phenotypically normal, but it is not uncommon for carriers to have partial color vision. Why are some carriers partially colorblind?

Since the Xs are randomly inactivated in different cells, if you were an eye cell that inactivated the XCB allele, you would only have the Xcb and that is the one that doesn't have green opsin protein in some of the cells of the eye

How is it possible for a male human to have a single Barr body in each of his cells?

Since the number of Barr bodies in a human cell is equal to the number of X chromosomes minus one, he must have 2 X chromosomes. He also must have at least one Y chromosome since it is the Y chromosome that determines maleness.

Which ribosomal subunit binds first to mRNA in translation?

Small

Describe the difference between somatic vs. germline mutations

Somatic mutations often lead to altered cellular function, but are not passed down to offspring. When a recessive mutation occurs in somatic cells, it is likely that we will see the phenotype because it will be masked by the wildtype, whereas germline mutations (occur in gametes) are heritable and the basis for genetic diversity and evolution. Germline mutations have the potential to be expressed in all cells of an offspring

What are the consequences on the protein if there is a nucleotide substitution in the DNA?

Some do not have any consequences because the genetic code is redundant, and even if they do change the amino acid, they do not have much effect on the shape or function of the protein, but others can cause the protein from performing normally

In the Ames Test, the appearance of his+ revertants in the presence of a non-mutagenic control compound indicates that _______.

Some of the reversion mutations are not caused by the mutagen being tested. His+ revertants on the control plate are the result of spontaneous mutation.

What makes RNA different from DNA?

Sugar: ribose instead of deoxyribose Single stranded instead of double stranded

HOX genes pattern the body of lobsters much like they do flies. If expression of HOX Tail is driven by the promoter of HOX Head. What will the transgenic lobster look like?

Tail is on the head of the lobster. The tail does not replace the head, you are just adding a trans-gene

What enzyme elongates the new strand of DNA in PCR?

Taq polymerase

What is wobble pairing?

The 3rd base of the anti-codon can recognize different bases in the codon

When glucose is NOT present and lactose is where does CAP bind?

The CAP binding site in the promoter before the RNAP binding site, which facilitates RNAP binding at the lac operon promoter and thus transcription, and for maximal transcription of structural genes, the repressor must be bound by lactose and CAP must be bound to the CAP-binding site

An XY individual who is phenotypically female is probably lacking what gene?

The SRY gene, which is a gene that becomes active in XY embryos that encodes a protein (the testis determining factor or TDF) that causes the undifferentiated gonadal tissue of the embryos to form testes.

In eukaryotes an important consensus sequence in the core promoter is called ______________. It is a cis or trans element and why?

The TATA box; cis element because it is adjacent to the gene on the same strand of DNA

In eukaryotes there is a -30 consensus sequence (TATA) in the core promoter, but what makes the eukaryotic process more complicated for initiation?

The TATA core promoter sequence might not always be present, and there are many other cis elements that may or may not be present, more core promoter elements ,proximal promoter elements, silencers, enhancers Different trans-acting factors and more

A mutation in the -10 (Pribnow) consensus sequence would have what affect?

The TATAAT sequence is located 10 nucleotides upstream from the site of initial transcription and it will cause transcription to not happen because this is where RNA polymerase binds in prokaryotes

If all the other alleles are normal, what is the affect on the operon with these two alleles: O-/O- And what is the type of transcription?

The cell can still digest and use lactose since ZYA are always made. Constitutive

If all the other alleles are normal, what is the affect on the operon with these two alleles: O-/O+ And what is the type of transcription?

The cell can still digest and use lactose since one of the chromosome is inducible, the other is constitutive Constitutive

. If one double-stranded DNA has a higher melting temperature than another, what does this tell us about the structure of this DNA?

The higher the melting temperature, the greater number of G-C base pairs than A-T because G-C share three hydrogen bonds, where A-T share two.

Why is Tm related to base composition?

The more hydrogen bonds between bases, the higher the temperature needed to separate the pair. G-C base pairs have three hydrogen bonds while A-T base pairs have two hydrogen bonds.

What observation did Griffith make in his experiments with Streptococcus pneumoniae?

The mouse did not survive when injected with a mixture of live, avirulent (rough) Streptococcus pneumoniae and heat-killed, virulent Streptococcus pneumoniae. Something in the heat-killed preparation was able to transform the avirulent strain to a virulent form.

What is the 2nd order of chromatin packing?

The second order of chromatin packing occurs when nucleosomes coil together to form a solenoid fiber that is 30 nm in diameter.

Gene X is made at a high level in one cell type and a low level in another cell type. Why?

The two cell types have different sets of transcription factors such as activators or repressors! REMEMBER THAT GENES ARE NOT JUST ON OR OFF

How do we define personalized medicine?

The use of a patient's personal genetic and environmental information that is used to predict risks of disease and drug responses.

What happens when one nucleotide is lost from the middle of a gene?

There is a long string of incorrect amino acids in the polypeptides because the reading frame is shifted.

What is significant about the bond between the 2nd and 3rd phosphate in ATP or GTP?

There is a lot of energy involved in the removal or addition of this terminal phosphate

Which of the following statements regarding telomeres is FALSE? They are highly conserved in evolution. They are organized as euchromatin. They are composed of short tandem repeats. They are organized into heterochromatin.

They are organized as euchromatin.

Prokaryotes don't have telomerase. Why don't their chromosomes shorten?

They have circular chromosomes, so their DNA polymerase always has a 3'-OH it can synthesize off of

Could Dr. Szyf and Dr. Meany reverse the personality traits associated with low-licked rats?

They injected anxious rate with a drug known to remove epigenetic markers that silencing the stress causing hormones, and this reversed the personality

Why is it important that a Taq polymerase specifically is used in a PCR reaction?

This enzyme is capable of tolerating extreme temperature changes that will happen during the PCR

In a multicellular organism, what are reasons for regulating gene expression?

Throughout our lifetimes we have different needs in different stages of growth and development (Temporal specific expression) We have different types of tissues and different cell types (Different genes on/off)

Cloned genes are first inserted within the _____ to generate a transgenic plant.

Ti plasmid

Function of mitosis

To create somatic cells; division for growth, maintenance, and repair

Is the binding of a transcription factor to its DNA recognition sequence necessary and sufficient for an initiation of transcription at a regulated gene?

Transcription factors are proteins that are necessary for the initiation of transcription. However, they are not sufficient for the initiation of transcription. Transcription factors contain at least two functional domains: one binds to the DNA sequences of promoters and/or enhancers, while the other interacts with RNA polymerase or other transcription factors.

What would happen if an enhancer is moved to a different gene?

Transcription of the new gene is enhanced

T/F: A common term for a plasmid or other DNA element that serves as a cloning vehicle is vector.

True

True or false. VNTR and STR do not code for genes.

True

What are the 3 stop codons?

UAA, UGA, UAG

What are the stop codons?

UAG, UAA, UGA

What can we do to overcome deficiency of GH in people with pituitary dwarfism?

Use recombinant DNA technology to synthesize the biosynthetic HGH. Get bacteria to produce this protein and give that protein to people that do not produce enough of it

A sequence such as TATAGCGTAGCTAGCT repeated in tandem (next to each other) 75 times is an example of a

VNTR, variable number tandem repeat aka minisatellites.

Difference between VNTRs and SINES

VNTRs are tandem and right next to each other, whereas SINEs are not.

What are 2 specific things that promoter swapping can tell us?

Where in the organism a certain protein is expressed and when the gene functions in development

What pattern does she find globally in human skin color and UV?

Wherever UV is strong, skin is dark, like near the equator or at high altitudes. At the poles, the skin color of indigenous people is always lighter

A female with has no Barr bodies in any of her somatic cells, what is her genotype?

X

What is the genotype of a cell with one Barr body?

XX or XXY

Skin cells were examined from several men. In one, a Barr body was found. What is unusual about this? What is his genotype?

XXY

Do eukaryotes have chromatin remodeling?

Yes

Can we get different mature mRNA transcripts from the same pre-mRNA transcript?

Yes! Alternative splicing

Can a mutation become a SNP?

Yes. If through successful reproduction the mutation reaches >1% frequency in the gene pool, it can be classified as a SNP.

I+ O+Z+ Y- With and without lactose and the effect on both Y and Z.

Z is inducible

Agrobacteria

a bacteria that is usually pathogenic to plants because it infects plants by inserting its own gene(s) into the plants genome via its Ti plasmid and reprograms plant cell to make things for it. The gene doesn't stay into the plasmid, because the agrobacteria integrates the gene into the genome of the plant

Mitosis

a form of cell division producing 2 progeny cells identical genetically to the parental cells—the production of 2 cells from 1, each having the same chromosome complement as the parent (diploid or haploid)

What is a polynucleotide?

a long chain of deoxyribonucleotides or ribonucleotides (made of a phosphate, sugar, and a nitrogenous base) paired together in a 5' to 3' orientation

nonsense mutation

a mutation that changes a codon specifying an animo acid into a termination codon, leading to premature termination during translation of mRNA

What component of DNA would I be talking about it I was referring to a 5' carbon? What is bound to this 5' carbon?

a pentose sugar; a phosphate group

What allele combinations for skin color would be most common in North Europe and why?

aabbcc because the UV intensity is low, but they still need vitamin D, so they will have less melanin in their skin cells to let in some UV rays

In the nucleus, ______________ bind ____________ to promote transcription, while ___________ bind ___________ and transcription is decreased

activators; enhancers; repressors; silencers

Polymorphic

alleles that are equally as common in the population

...AGTAGTAGTAGTAGTAGTAGT...is best known as ?

an STR

What is the RNA polymerase?

an enzyme that links together the RNA nucleotides

What is an operator?

an operator is a segment of DNA to which a transcription factor binds to regulate gene expression by repressing it. The protein that does this is called a repressor. Repressors bind to operators to prevent transcription.

Bivalents

are those structures formed by the synapsis of homologous chromosomes; the number of bicalewnts is equal to n

In a prokaryote, such as E. coli, where does replication begin?

at a single location called the OriC

Color of eumelanin

brown-black

In prokaryotes there is not mRNA processing. In eukaryotes, the pre-RNA (immature transcript) is processed

by splicing out introns and adding a 5'-cap and poly A tail

How does cAMP affect CAP?

cAMP is an allosteric effector of CAP, • just like lactose is an allosteric effector of the repressor protein. cAMP binds to the CAP protein and when they interact, the structure of CAP is altered such that it can then bind to the promoter

How is cDNA different from genomic DNA?

cDNA is DNA that is made from mRNA via reverse transcriptase cDNA just has the coding sequence only exons), but genomic DNA has introns and exons; cDNA also represents the genes being expressed at the time of the mRNA collection, genomic DNA is it all

When the chromatin is less tightly packed and the DNA is more exposed and wrapped less tightly around the protein, the transcriptional machinery (can/cannot) access genes to express them

can

What is transfer RNA?

carries amino acids to the ribosome during translation and since more than one tRNA interacts simultaneously with the ribosome, these molecules are very small

lacY gene

codes for ß-galactoside permease, which assists the transport of lactose into the bacterial cell

The reason two individuals sick with an autosomal recessive trait can have all wildtype children.

complementation or epistasis

Bond between tRNA and an amino acid

covalent

restriction enzymes

cut DNA at specific sites and often yield "sticky " ends for additional interaction with DNA molecules cut with the same class of enzyme.

Where does the attachment of an amino acid to tRNA take place?

cytoplasm

The RNA transcribed from a gene will be complementary and antiparallel to which of the following? a) the nontemplate strand of the DNA b) the coding strand of the DNA c) both strands of the DNA d) the template strand of the DNA

d) the template strand of the DNA

cis-dominant mutation

dominant mutation that will only affect the alleles to which it is cis-to

Which of the following forms of DNA has NOT been observed as a chromosome of viruses? double-stranded branched DNA single-stranded linear DNA double-stranded circular DNA double-stranded linear DNA

double-stranded branched DNA

HOX genes

encode transcription factors that specify the formation of different parts of the body. Play a major role in development, because they are transcribed early in development in different parts of the fly and get transcribed into proteins and because they are transcription factors, they go regulate an entire suite of genes (i.e. the formation of the head, or the leg of a fly).

Is an individual with Turner (X) syndrome phenotypically male or female

female

I+ Oc Z+/F' O+ with lactose. Is a functional, nonfunctional, or no enzyme made?

functional enzyme

What type of mutation is Is and why?

gain of function because it has a new function that is that it can bind to operator even with lactose; neomorphic

What is absolutely necessary for transcription to occur?

general transcription factors

What is absolutely necessary for basal transcription to occur?

general transcription factors at the promoter to recruit RNAPII

The chromosome theory of inheritance explains how

genetic continuity is maintained through generations. They said that inherited traits are controlled by genes which reside on chromosomes faithfully transmitted through gametes.

The totality of all of the genetic material in a given organism

genome (the genome includes copies of all genes as well as a large amount of noncoding DNA)

The ______ of an organism is defined as its specific allelic or genetic constitution.

genotype

We have seen that the lac genes are expressed upon the condition that lactose is present in the media. However, because bacteria preferentially metabolize glucose over lactose, in order for the lac genes to be expressed, __________ CANNOT be present in the cells environment.

glucose

Some types of carbon sources bacteria might use:

glucose, galactose, lactose, tryptophan

Epigenetic

heritable changes that do not occur in the DNA sequence

Genes that are NOT being expressed (transcriptionally INACTIVE) are found in __________ regions of chromosomes

heterochromatic

Collectively a pool of pre-RNAs in the nucleus is called:

heterogeneous nuclear RNA (hnRNA)

Acetylating acts on

histones

The bacteria used in the Ames test to evaluate mutagenicity are ____________. If the Ames test is positive, these bacteria have reverted back to wild type and are __________

his− auxotrophs; his + prototrophs

tRNAs and mRNA interact through what type of bond?

hydrogen bonds hold them together while the peptide bond is formed

The amount of enzyme activity in a cell homozygous for the WT allele is 250 units. The amount of enzyme activity in a heterozygote is 450 units. The type of mutation.

hypermorphic

The amount of enzyme activity in a cell that is homozygous for a mutant allele is 400 units. The amount of enzyme activity in a cell homozygous for the WT allele is 200 units. The amount of enzyme activity in a heterozygote is 300 units. What type of allele is the mutant allele?

hypermorphic

Many oncogenes result from mutations that cause a protein to be expressed in cells where it is normally not expressed or at inappropriate times during development. This type of mutation can be described as

hypermorphic (gain of function)

Relationship of the new strands created by PCR

identical

X-Gal (similar to lactose in structure) is included in the growth medium on which cells transformed with bacterial plasmids are grown. The reason X-Gal is included is to _______.

identify bacteria that contain a recombinant plasmid because colonies produced from cells containing a recombinant plasmid are white, whereas colonies from cells containing a nonrecombinant plasmid are blue. (X-gal is similar to lactose in structure and can be cleaved by beta-galactosidase and when it is cleaved, it turns blue, so if beta-galactosidase is functional, it turns blue)

transition mutation

if a purine replaces another purine

transversion mutation

if a pyrimidine replaces a purine or vice versa

A cis-acting regulatory mutation that would render the lac operon uninducible would be

in the CAP binding site in the promoter

To be certain that the extract prepared from virulent cells still contained the transforming principle that was present prior to lysis, Avery _______. \

incubated nonvirulent cells with complete extract (The complete extract possessed the same ability to induce transformation in IIR bacteria as whole heat-killed IIS bacteria.)

Does lactose directly or indirectly stimulate transcription of genes involved in its metabolism>

indirectly

to turn up the expression of genes encoding enzymes that are needed.

induce transcription

I+ O+ Z+ is constitutive, repressed, or inducible?

inducible

In the presence of lactose, are the structural genes constitutive, permanently repressed or inducible with I+ O+ Z+?

inducible

When xylose is present in the environment, bacteria synthesize enzymes to metabolize xylose. When xylose is absent, the enzymes are not manufactured. This illustrates the concept of __________ enzymes.

inducible

Which term is used to describe enzymes that are produced only when specific substrates are present in the environment?

inducible (their production is induced)

We can artificially break the dynamic process of translation into three phases:

initiation, elongation, termination

leaky mutation

is a mutation resulting in the partial loss of gene function

Why does the mRNA have the 5'-cap and Poly-A tail?

it has to travel outside of the nucleus into the cytoplasm to the ribosomes to translate, and it is subject to a lot of degradation and enzymes, so you really want to protect it because it is single-stranded RNA and it is not very stable and so it is recognized. Also, the 5'-cap is important for subsequent processing because it is added first, it helps transport the mature mRNA into the cytoplasm, and it is important for initiation of translation

What did they predict would happen if they put an O+ gene into a cell that was Oc?

it would have no effect on the constitutive enzyme production, since regulation depends on the presence of an O+ region immediately adjacent to the structural genes...an O+ cis regulator...Oc is cis-dominant

"Help wanted. My phosphodiester bonds are broken and I need them repaired. Looking for someone with the right tools"

ligase

What shape are the chromosomes of eukaryotes?

linear

What shape are the chromosomes of viruses?

linear and circular

A nonsense mutation early in the protein coding region of a gene is most likely to be loss function or gain of function and why?

loss of function mutation because a nonsense mutation truncates the protein early on and it would be loss of function and it is also likely to be recessive (Think about LEP-R)

A triglyceride level of 45 is considered

low

During translation, what molecule bears the codon?

mRNA

Make a list of translated RNA

mRNA

The relationship between a gene and a messenger RNA is that ________.

mRNA is made from genes

Is an individual with Kleinfelter (XXY) syndrome phenotypically male or female?

male

A short segment of an mRNA molecule is shown below. The polypeptide it codes for is also shown: 5'-AUGGUGCUGAAG : methionine-valine-leucine-lysine Assume that a mutation in the DNA occurs so that the fourth base (counting from the 5' end) of the messenger RNA now reads A rather than G. What sequence of amino acids will the mRNA now code for?

methionine-methionine-leucine-lysine

The chemical difference between a promoter of an active gene vs. a silenced gene.

methylation

Vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. Which term describes this advantageous arrangement of restriction sites?

multiple cloning site

What charge does the phosphate group have?

negative

Because transcription occurs only when the repressor FAILS to bind the operator, this is considered negative/positive control?

negative control

Which type of regulatory control condition that occurs when protein is associated with a particular section of DNA and greatly reduces transcription?

negative control

A repressor protein ____________ regulates

negatively

Do eukaryotes have operators?

no

High levels of glucose means:

no cAMP and CAP cannot bind to the promoter

I- O+ Z-/F' I+ O+ Z+ with no lactose. Is a functional, nonfunctional, or no enzyme made?

no enzyme is made, since there is no lactose, the normal repressor will bind to both operators. I+ overrides I- because it is a trans acting diffusible product

I+ O+ Z+ with no lactose. Is a functional, nonfunctional, or no enzyme made?

no enzyme made because normal genes and no lactose, so the repressor binds to the operator

What would happen if an enhancer is moved from one side of the gene to another?

nothing

What would happen if an enhancer's orientation is inverted?

nothing

Where does the formation of ribosomal subunits take place?

nucleolus

When 20 nucleotides are bound together we call this a

oligonucleotide (primer)(

What is the Poly-Adenylation signal?

on the 3' end of the initial transcript, about 10-25 ribonucleotides from the AAUAAA sequence and where the cleavage happens

Which term refers to a contiguous (next or together in sequence) genetic complex that is under coordinated control?

operon

Where do we get haplotypes from?

our parents

Imagine a cell in which one X is maternal and one X is paternal. The paternal X is inactivated. This cell divides into two cells. Which X is inactivated in these two cells?

paternal

What enzyme helps bring lactose into the cell?

permease (Y)

DNA ligase then forms _________ bonds between DNA Okazaki fragments

phosphodiester

The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of which of the following labeled component(s)?

phosphorus and sulfur

What type of mutation will a tautomeric shift result in?

point mutation

mRNA made from a lac operon is said to be _________. What does this mean?

polycistronic, meaning that it is translated simultaneously by several ribosomes into 3 enzymes encoded by the operon

DNA is a ________ of repeating monomers. In this case, the __________ is the monomeric unit. And each monomer is made up of 3 components: _________

polymer; nucleotide; sugar, phosphate, base

When we have long chains of nucleotides we call this a

polynucleotide

If Avery had observed transformation using only the extracts containing degraded DNA, degraded RNA, and degraded protein, but NOT the extract containing degraded polysaccharides, he would have concluded that _______.

polysaccharides are the genetic material because failure to transform suggests that the chemical degraded in that preparation is the one responsible for transformation

Which type of control best characterizes catabolite repression associated with the lac operon in E. coli?

positive control

An activator ___________ regulates

positively

DNA polymerases can extended a DNA polymer ONLY if a ________ already exists to build upon.

primer (it needs a 3'-OH)

Recessive

produce characteristic PHENOTYPE when present in 2 copies

sequences in DNA to which transcription factors and RNA polymerase bind to initiate transcription.

promoters

Translation is the synthesis of __________ with one ______ Determining each amino acid in the sequence

protein; codon

A person has one allele with a loss-of function mutation and the other allele is wildtype. There is no phenotype. Yet if both alleles are loss-of-function, then there is a severe phenotype. Is this loss-of-function mutation dominant or recessive in this case?

recessive

Are loss-of function mutations more likely to be dominant or recessive?

recessive

Regulation of sucrose utilization in yeast is similar to lactose utilization in E. coli. They use the enzyme invertase break down sucrose, and invertase is not produced when glucose is available. Suc1 is a gene that encodes invertase and in an assay for Suc1 mRNA, it was found that the gene is not transcribed when glucose is present. A haploid mutant fails to transcript invertase under any condition. You mate this mutant with a wild type haploid resulting in diploid progeny having normal invertase activity. What type of allele is the mutant allele?

recessive

What does a restriction enzyme do to DNA structure?

recognizes and binds to DNA at a specific nucleotide sequence called a restriction site and cuts both strands of DNA within that sequence, cleaving phosphodiester backbone of the DNA aka digestion To clone the gene into a plasmid, a restriction enzyme must do all of the following: cut the human DNA on both sides of the target gene, but not inside the gene cut the plasmid without cutting inside the ampicillin resistance gene (ampR), or another selectable marker gene produce sticky ends when it cuts both the human DNA and the plasmid, so that the human DNA fragments can combine with the plasmid

The use of the GFP protein and promoter swapping for detecting things can be applied using

recombinant DNA technology

Color of pheomelanin

reddish/yellow

Loss of function mutation and gives examples of what it would be like

reduces or eliminates the function of protein; maybe less abundant, maybe cannot bind to something it needs; protein may be altered

SINEs

repetitive DNA sequences found in the genomes of higher organisms; they are interspersed throughout the whole genome, and not bumped up against each other and sprinkled around the chromosome

During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a

replication fork

What are the four characteristics that genetic material must exhibit?

replication, storage of information, expression, and variation by mutation

Recombinant DNA technology began with two key tools:

restriction enzymes (DNA cutting enzymes) and DNA cloning vectors.

Which organelle coordinates translation?

ribosomes

Dosage compensation only occurs in what types of chromosomes?

sex

What is the physical state of DNA after being denatured by heat?

single stranded

What prevents H-bonds between bases and binds after the replication fork?

single stranded binding proteins

Make a list of functional RNA:

telomerase RNA tRNA rRNA snRNA f

All EXCEPT which of the following are examples of repetitive DNA? telomere DNA SINE DNA variable number tandem repeat (VNTR) DNA telomerase gene DNA

telomerase gene DNA (The DNA sequence constituting the gene for telomerase is euchromatin and is relatively unique.)

The purpose of the Ames Test is to _______.

test the mutagenic effects of chemicals. The Ames test detects whether a given chemical can cause a reversion mutation in his- bacteria.

What is the one gene-one enzyme hypothesis, and what has it been changed to?

that the function of an individual gene is to dictate the production of a specific enzyme, but it has been changed to be the function of a gene is to dictate the production of a polypeptide because each protein may have more than one polypeptide chain.

What is L in the lac operon?

the 5' UTR

What end of the lagging strand gets shorter with each round of synthesis?

the 5' end

Where does the phosphate group attach?

the 5'-carbon of the pentose sugar and also the 3'

Dominant

the allele that expresses its PHENOTYPIC trait in a heterozygote; only need one copy to see the phenotype

What type of coding region do we need to express the human GH gene in bacteria?

the human GH cDNA

Wildtype

the most common allele in the population

Synapsis

the point-by-point pairing of homologous chromosomes during prophase of meiosis I.

What is mutation?

the random variation of genetic material that provides the basis for evolution

What is the +1 position?

the start of transcription

Reverse transcriptase is an enzyme found in association with retroviral activity, and the activity of telomerase. It has the property of ________.

the synthesis of DNA from an RNA template

Immediately after the primers have annealed to the target sequence in a PCR, _______.

the temperature is raised so that taq polymerase can extend the primers (The temperature is raised to 70-75∘C, the temperature over which taq polymerase is optimally active.)

What does it mean when we say the genetic code is degenerate?

there are many instances in which different codons specify the same amino acid. A genetic code in which some amino acids may each be encoded by more than one codon

Explain the structure of the lac operon

there are three genes and an adjacent regulatory region that constitute the lac operon. The entire cluster functions in an integrated fashion to provide a rapid response to the presence or absence of lactose. There are 3 structural genes, the lacZ gene encodes for ß-galactosidase, which converts lactose to glucose and galactose, lacY encodes the amino acid sequence of permease, and lacA encodes the enzyme transacetylase

Function of meiosis

to create gametes

In methylation, where are methyl groups added?

to the cytosine located adjacent to a guanine in a CpG group

Where does RNAP bind in eukaryotes?

to the transcription factors (trans-acting proteins) that are on the TATA box

Is the lacI gene trans or cis?

trans because it produces a diffusible repressor that can travel to a sequence a great deal away

bind DNA and regulate transcription.

transcription factors

Transformation

uptake of DNA by bacteria

When are chromosomes packed the tightest?

when the cells divide

In Figure 17-3 you see that the fragment will be cloned into the multiple cloning site and disrupt the LacZ. Bacteria that have a plasmid with your cloned fragment of interest will be________ when plated with X-gal.

white

Z+

wild-type structural gene activity

The most common type of allele in a population

wildtype

I+:

wildtype repressor gene; will produce a repressor protein that can bind to lactose in the presence of lactose and can bind to the DNA in the absence of lactose; can over-ride I-

Predict the level of gene expression of the lac operon, as well as the status of the lac repressor and the CAP protein when bacterial growth media contain glucose and lactose

with lactose present, the lac repressor is inactivated, but since glucose is also present, CAP will not interact with its binding site, and under this condition transcription is severely diminished and the operon is considered off.

________________ pairing allows for a single anticodon to interact with several codons

wobble

Do prokaryotes have cis-acting regulatory elements?

yes

For the genotype, Is Oc Z+/ F'I + O+ Z+ what would happen to ß-galactosidase?

ß-galactosidase would always be made; Is only makes it so that lactose cannot bind, but the Oc will override the Is on the left chromosome

For the genotype, I - O+ Z+/ F' I - O+ Z+ what would happen to ß-galactosidase?

ß-galactosidase would always be made; constitutive mutation

For the genotype, I- Oc Z+/ F' I - O+ Z+ what would happen to ß-galactosidase?

ß-galactosidase would always be made; constitutive mutation

When does a telomere shorten? What is the consequence of a shortening telomere?

A telomere shortens every time the cell divides and its DNA replicates. As RNA primers are removed in replication, leading strand gaps can be filled in, but the gap at the end of the 5' on the lagging strand cannot be filled in When they get too short, they can no longer divide and they become inactive and die, and the shortening of telomeres has been associated with aging, cancer, and death.

What is a transposon and how could it cause a mutation?

A transposon is a "jumping gene" and there are DNA sequences that can move between chromosomes. They can cause mutations by disrupting genes, creating chromosomal damage, inducing premature termination of translation of mRNA, etc.

How many Barr bodies would you expect to find in an XX cell in which the gene Xist had been inactivated (from both X chromosomes)?

None

What type of enzyme is made with no lactose and I+ O+ Z+?

None

What type of enzyme is made with no lactose and I- O+ Z-/F' I+ O+ Z+?

None

What type of enzyme is made with no lactose and Is O+ Z+/F' O+?

None

What type of enzyme is made with no lactose and I- O+ Z+/F' I+?

None becasue I+ is a diffusible product and can override I-

Drinking contaminated water from Flint, Michigan introduced a mutation to gene CKL-54c that normally adds histones to DNA. This mutation shortens the protein product to 15 amino acids instead of 60. What could have caused this and what type of effect would you expect this to have on the protein?

Nonsense mutation introduced premature stop. Loss of function- can't add histones, less gene regulation, may be lethal to cell.

T/F: An individual with Klinefelter syndrome generally has one Barr body.

True

T/F: Under a system of negative control, genetic expression occurs unless some form of regulator shuts off such expression.

True

What is the purpose of raising the temperature to 90-95°C at the beginning of each cycle of PCR?

to separate the double stranded DNA

How many subunits make up a ribosome?

2

I-O+Z+Y-/ I+Z-Y+ Expression of Z?

Inducible

In prokaryotes, the critical step in regulation is:

at the level of transcription. Specifically, the binding of RNA polymerase to the promoter

I+ Oc Z+/F' O+ is constitutive, repressed, or inducible?

constitutive

I- O+ Z+ is constitutive, repressed, or inducible?

constitutive

In the presence of lactose, are the structural genes constitutive, permanently repressed or inducible with I- O+ Z+?

constitutive

I-

mutant repressor gene; operator-binding region of the repressor protein is altered and cannot bind to the operator and cannot stop transcription from happening

Oc

mutated operator gene; the nucleotide sequence of the operator gene is altered, so no binding of the repressor protein occurs and transcription proceeds; can over-ride O+ because it is cis-dominant

An error that occurs during DNA replication

mutation

Is Oc Z+ Y+ Status of the lac operon

Constitutive

Does a tRNA enter the A site when a stop codon is reached?

No, a signal release factor

monad

a sister chromatid

Where does transcription and RNA processing take place in eukaryotes

nucleus

Contrast the end results of meiosis with those of mitosis.

In mitosis, there is no change in chromosome number or kind in the two daughter cells and the daughter cells are identicai, whereas in meiosis, numerous potentially different haploid cells are produced and the daughter cells are not identical

Explain the molecular mechanism of X-silencing.

In one of each of the X chromosomes, there is an active Xist gene, which codes for a large RNA transcript and when the RNA transcript is made, it coats the chromosome from which it came from and this recruits proteins that modify the histones and you get the histones coming very close together and the chromatin packs really tightly and inactivates the chromosome.

Termination Region

In prokaryotic and eukaryotic DNA; - is the "stop" signal for where transcription should end; downstream of coding region

In females, the euchromatin X chromosome has what type of Xist gene?

Inactive

Which is bigger a gene or a chromosome?

A chromosome. Genes are on chromosomes.

Default state for the lac operon

off

I+ O+ Z+ Y+/F'I- O+ Z+ Y+ Expression of Z and Y and conclusion

- + - + lacI+ is dominant to lacI- and the operon is inducible

haploinsufficient

"half is not enough" where one copy of the allele is not enough for normal function and not enough to produce the wild type phenotype

When we say "upstream" of a gene, what are we talking about?

"upstream" correlates to the 5' end of the non-template (coding) strand.

I+ O+ Z- Y+/F' OC Z+ Y- Expression of Z and Y and conclusion

+ + - + Operator is cis-acting, because if it was trans acting, Y would always be expressed because it would act on the other chromosome

IS OC Z+ Y+ Expression of Z and Y and conclusion

+ + + + lacIS cannot repress lacOc

IS O+ Z+ Y+ Expression of Z and Y and conclusion

- - - - lacIS is uninducible (super repressor)

Consensus regions that we find in the promoter of prokaryotes

-10 and -35

Where does RNAP bind in prokaryotes?

-10 and -35 site of the promoter

What would you predict would happen if Xist gene was inactivated from both chromosomes:

0 Barr bodies; double dosage of certain genes

For an individual with the XXY chromosomal composition, the expected number of Barr bodies in interphase cells is ________.

1

How many Barr bodies are seen in an individual with 46XX?

1

How many Barr bodies are seen in an individual with 47, XXY?

1

Why must we use reverse transcriptase on mRNA to obtain the template for a transgene of interest? Why can't we just copy genomic DNA if we know the sequence?

1) cDNA does not contain introns, it only contains exons, the coding sequences of the DNA, and if genomic DNA was used, the correct protein product would not be produced since bacteria lack the enzymes needed to splice out the introns

3 things to keep in mind when designing primers:

1. Need a primer that is complementary to the gene 2. DNA is double stranded, so you need 2 primers 3. Polymerase always adds to the growing 3' end

Suppose a baby is born with Klinefelter Syndrome (XXY). List three different ways that nondisjunction could have resulted in this particular chromosome combination.

1. Nondisjunction in meiosis I in the mother: XX gamete produced, fertilized by Y from father 2. Nondisjunction in meiosis II in the mother: XX gamete produced, fertilized by Y from father 3. Nondisjunction in meiosis I in the father: XY gamete produced, fertilized by X from mother (Can't be meiosis II in the father, because X and Y have already separated at this point, so only an XX or YY gamete could be produced by nondisjunction, resulting in an XXX or XYY offspring after fertilization.)

Steps for hypothesis testing:

1. State null hypothesis (what we would expect) 2. State the threshold of significance (How unlikely do our results have to be before we doubt the null hypothesis? α=0.05) 3. Collect data 4. Summarize the data into test statistic 5. Compute the probability of the test statistic under the null hypothesis (This is the p value) 6. Compare p-value to threshold of significance a. If the p-value is less than the threshold, we say the finding is statistically significant b.If our null hypothesis is true, what we found is very unlikely 7. Make conclusion about null hypothesis a. If finding is statistically significant, we have enough evidence to doubt the null hypothesis and we reject the null hypothesis

Things our vector needs to have to create transgenic plants:

1. a cloning vector to be replicated in bacteria 2. serve as an expression vector once in plants 3. carry information for "selection" of transformed plants.

The following is a list of elements that are commonly found in eukaryotic protein- coding genes. Arrange these elements in the order they would appear in a gene and in the direction traveled by RNA polymerase along the gene. 1. 5' splice site 2. 3' UTR 3. promoter 4. stop codon 5. nucleotide to which the methylated cap is added 6. initiation codon 7. transcription termination site 8. 3' splice site 9. 5' UTR 10. poly(A) addition site

1. promoter 2. nucleotide to which the methylated cap is added 3. 5' UTR 4. Initiation codon 5. 5' splice site 6. 3' splice site 7. stop codon 8. 3' UTR 9. Poly-A addition site 10. Transcription termination site (Poly-A addition site cannot come after transcription termination site)

Describe PCR

1.) PCR is a rapid method of DNA cloning that eliminates the need to use host cells for cloning. It can amplify target DNA sequences that are initially present in very small quantities in a population of other DNA molecules. a. The double stranded DNA that you want to clone is placed in a tube with DNA polymerase, Mg2+, which is a cofactor for polymerase, and 4 deoxyribonucleoside triphosphates. b. You also need 2 oligonucleotide primers that are single stranded DNA sequences, one is complementary to the 5' end and one complementary to the 3' end of the opposing strand of DNA. c. When you add the primers to a sample of double stranded DNA that has been denatured into single strands, the primers bind to complementary nucleotides and the DNA polymerase can extend the 3' end of each primer to synthesize 2nd strands of target DNA and one complete reaction doubles the number of DNA molecules.

Let's conclude with an interesting fun fact... the human genome has about 20,000 functional genes. This DNA sequence only accounts for what percent of the entire human genome?

2

The human genome has about 20,000 functional genes. This DNA sequence only accounts for what percent of the entire human genome?

2

Two different alleles of the CO1 gene are shown below. By how many amino acids do the protein products encoded by these alleles differ in length? Allele 1: Coding strand 5'CCCAAACGCATGATAGGCCGGTGCACAACAGGAGCGTGACCCTAAGTC 3' Template strand 3'GGGTTTGCGTACTATCCGGCCACGTGTTGTCCTCGCACTGGGATTCAG 5' Allele 2: Coding strand 5'CCCAAACGCATGATAGGCCGGTGCACAACATGAGCGTGACCCTAAGTC 3' Template strand 3'GGGTTTGCGTACTATCCGGCCACGTGTTGTACTCGCACTGGGATTCAG 5'

2

How many possible open reading frames extend through the following sequence? 5' ... CCAATCGTGTATTAGGGCATGTTTATTGATACGGAGCATTAATT ... 3' 3' ... GGTTAGCACATAATCCCGTACAAATAACTATGCCTCGTAATTAA ... 5'

2 (remember polymerase can only lay down nucleotides 3'-5')

Adenine complementarily binds with thymine and forms how many and what type of bonds?

2 hydrogen bonds

How many nucleotides are necessary to code for a polypeptide that is 100 amino acids long?

300

Marker gene

A gene, such as one that encodes antibiotic resistance, that allows genetically modified cells to be readily selected.

The first-born child in a family is sick with leukemia and needs a bone marrow transplant. Neither parent matches at the 6 loci. What is the chance that another child will be an exact match (6 alleles) for the first child with cancer? Mom: A1 B1 DR3 and A2 B4 DR6 Dad: A1 B7 DR9 and A3 B5 DR5 Child with cancer: A1 B1 DR3 and A1 B7 DR9

25% chance because there is a 50% chance that dad will give the right allele and a 50% chance that mom will give the right allele

Number of chromosomes if the person is diploidic

2n

Number of chromosomes if the person is trisomic

2n + 1

Number of chromosomes if the person is aneuploid

2n +/- X

Number of chromosomes if the person is monosomic

2n-1

In a diploid organism, there are ___ number of copies of most genes. In a population, there may be many different gene sequences, or versions of this gene called ________. How do these new variations of gene sequences arise in a population? _____

2n; alleles; mutation

Diploid

2n; both members of a homologous pair are present

If a circular piece of DNA has three sites for a particular restriction enzyme, into how many fragments will that restriction enzyme cut the DNA?

3

What is the minimum number of tRNAs required to recognize the six codons specifying the amino acid leucine?

3

What would be the minimal number of tRNAs needed to recognize these six codons? (Ignore inosine) UCC UCU UCA UCG AGC AGU

3 (3' AGG 5' 3' AGU 5' 3' UCG 5')

How many amino acids long is this mRNA? 5' ...GGGAUCGAUGCGCCCUUAAAGAGUUUACAUAUUCGUGGAGGCGUUAACCCCGGA...3'

3 (Met-Arg-Pro)

In a dihybrid (TIC+ Vex-/TIC-Vex+) The percent of gametes that would be TIC+ and Vex+ TIC/-------------------/Vex 6 m.u.

3%

A loss-of-function mutation located near the C terminus of a protein would be found at the __ end of the mRNA.

3'

Nucleotides are added to which side of the growing RNA strand

3'

Which region of a tRNA molecule binds to amino acids?

3' end

The strand of DNA that is read by the RNA polymerase is always read in what direction?

3' to 5'

The template strand is always read in what direction?

3'-5'

The nucleotide is always added to the ______ group of the growing polynucleotide chain.

3'-OH

What end of the growing RNA polynucleotide does RNAP add nucleotides to?

3'-OH

Approximately what percent of genes in the human genome undergo alternative splicing?

30-60

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.

300, 700, 1000, 1200

If a typical somatic cell has 64 chromosomes, how many chromosomes are expected in each gamete of that organism?

32

If an organism has a diploid number of 16, how many chromatids are visible at the end of mitotic prophase? How many chromosomes are moving to each pole during mitotic anaphase?

32; 16

Together LINES and SINES make up what percent of the DNA of the human genome?

34

If 15% of the nitrogenous bases in a sample of DNA from a particular organism is thymine, what percentage should be cytosine?

35%

For Hershey and Chase to have concluded that protein and not DNA was the genetic material, they would have found:

35S inside the host cells

Number of chromosomes if the person is triploidic

3n

How many aneuploid daughter cells will be created if nondisjunction occurs in meiosis I?

4

If a linear piece of DNA has three sites for a particular restriction enzyme, into how many fragments will that restriction enzyme cut the DNA?

4

How many ORFs? Indicate most likely ORF, indicate polarity, indicate template strand, indicate direction of RNAP. What is the polypeptide sequence and indicate N and C terminus and what is the anticodon for the 5th amino acid and include polarity TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT

4 5'TAC ATGATCATTTCACGGAATTTCTAG CATGTA3' 5'ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT3' (template --> N-Met-Ile-Ser-Arg-Asn-Phe-C 3' GCC 5'

If there are five molecules of DNA containing the target region at the beginning of a PCR reaction, how many copies of the target will be present after three rounds of amplification?

40 (The number of target sequences is doubled with each replication cycle.)

What does it mean if someone has Turner Syndrome?

45,X, is a condition in which a female is partly or completely missing an X chromosome

What does it mean if someone has Kleinfelter syndrome?

47,XXY; a boy is born with an extra X

Life as we know it depends on the genetic code: a set of codons, each made up of three bases in a DNA sequence and corresponding mRNA sequence, that specifies which of the 20 amino acids will be added to the protein during translation. Imagine that a prokaryote-like organism has been discovered in the polar ice on Mars. Interestingly, these Martian organisms use the same DNA → RNA → protein system as life on Earth, except that there are only 2 bases (A and T) in the Martian DNA, and there are only 17 amino acids found in Martian proteins. Based on this information, what is the minimum size of a codon for these hypothetical Martian life-forms?

5 bases

The wild type sequence of Gene X is shown below. What would the sequence of an 8 pair reverse primer that could amplify Gene X? 5' GTACGCGCGATTGTATGCTATGCGATGAAAAACGCTGCTATTCTATCGTATGTGTGTAACCAGGT 3' 3' CATGCGCGCTAACATACGATACGCTACTTTTTGCGACGATAAGATAGCATACACACATTGGTCCA 5'

5' ACCTGGTT 3'

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA Locate an open reading frame that encodes a 5 amino acid polypeptide, and identify the template and coding strands of DNA. What is the 3rd amino acid?

5' ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT 3' template 3' TGCCGTTCTAGGGTGG GAT TAG TCT GGC ATG GTA AGTGGAGGA 5' coding Argenine

Two (coding strand) sequences in DNA that mark an open reading frame.

5' ATG and a 3' stop codon (TGA, TAA, TAG)

On the DNA strand below, the isolated cytosines are methylated. Identify which other nucleotide(s) would also be methylated if DNA methyltransferase were added. 5' CTAGG C TAGCTCAGCTAGCATCGTCTAAAG C T 3' 3' GATCCGATCGAGTCGATCGTAGCAGATTTCGA 5'

5' CTAGG C TAGCTCAGCTAGCATCGTCTAAAG C T 3' 3' GATC C GATCGAGTCGATCGTAGCAGATTT C GA 5'

Example of a palindromic sequence of DNA

5' G A A T T C 3' 3' C T T A A G 5'

Replicate this DNA sequence. How would methylation patterns be replicated along with DNA? How are methylation patterns inherited? Which nucleotides will be methylated? (isolated cytosines are methylated) 3' ACGTAT C GT 5' 5' TGCATAG C A 3'

5' TGCATAG C A 3' Daughter Strand 3' ACGTAT C GT 5' Parent Strand 3' ACGTAT C GT 5' Daughter Strand 5' TGCATAG C A 3' Parent Strand DNA methyltransferase: recognizes the CG islands, specifically the cytosines in the dinucleotides, and when it sees that methylated cytosine, it adds a methyl (-CH3) group to the daughter strand, specifically the cytosine adjacent to a guanine (a combination called a CpG dinucleotide)

When does the addition of the Poly A tail and 5' cap happen?

5' cap is before the synthesis of the initial transcript is complete, and addition of the Poly A tail happens after the 5' cap is added and after the initial transcript is complete and part of the transcript is cleaved at the 3' end to add the Poly-A tail

Both DNA and RNA have their polynucleotide strand arranged in what way?

5' to 3'

RNA is always transcribed in what direction?

5'-3'

The ribosomal small unit is recruited to the pre-initiation complex when the complex is bound to which part of the eukaryotic mRNA?

5'-G cap

The restriction enzyme BclI recognizes a 6 base pair, "palindromic" sequence in double stranded DNA. Given the first three bases of one strand, complete the restriction site for BclI, and indicate cut site on the other strand. 5´ T -G A __ __ __ 3´ 3´ __ __ __ __ __ __ 5´ Why is the position of the two cuts particularly useful for manipulating DNA?

5´ T -G A T C A 3´ 3´ A C T A G - T 5´ These cuts will generate sticky ends, allowing the cut to anneal to any other DNA fragment cut with the same restriction enzyme.

What is the complementary DNA sequence to 5′ ATGCTTGACTG 3′?

5′ CAGTCAAGCAT 3′

The genetic code consists of a total of how many different codons?

64 (There is a total of 64 codons, 61 of which specify amino acids and 3 of which are stop codons that specify the site for termination of translation...degenerate )

There are 3 exons in a gene. How many different proteins are possible?

7 (123, 1, 2, 3, 12, 13, 23 are the different combinations of exons that can come together)

A cell has 16 chromosomes. How many chromosomes would its daughter cells have after meiosis?

8

Some plants have somatic cells that have 8 copies of each chromosome, 4 from each parent. How many possible alleles?

8

The crab-eating rat (Ichthyomys pittieri) has 92 chromosomes per diploid cell (2n=92). How many chromatids and how many chromosomes are there in a crab-eating rat cell that is in prophase of meiosis II?

92 chromatids and 46 chromosomes

A DNA sequence encoding a five-amino acid polypeptide is shown below. ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA A) Locate an open reading frame that encodes a 5 amino acid polypeptide, and identify the template and coding strands of DNA. B) Label 5' and 3' ends C) Rewrite the sequence for the non-template strand in the 5' to 3' direction from left to right D) Write mRNA E) Give the sequence and polarity of the polypeptide

A and B) 5' ACGGCAAGATCCCACCCTAATCAGACCGTACCATGGTTCACCTCCT 3' template 3' TGCCGTTCTAGGGTGG GAT TAG TCT GGC ATG GTA CCAAGTGGAGGA 5' coding C) 5' ATG GTA CGG TCT GAT TAG 3' D) 5' AUG GUA CGG UCU GAU UAG 3' E) N-Met-Val-Arg-Ser-Asp-C

What is the difference between cis and trans acting elements?

A cis-acting element are adjacent parts on the same DNA molecule. Cis element is a DNA sequence that regulates expression of a gene located on the same chromosome and a trans-acting element is a gene product (usually protein or RNA) that acts to regulate the expression of the target gene. Trans-acting elements are proteins that bind to the cis-elements and recruit RNA polymerase

How is a haplotype different from a SNP?

A combination of SNPs across a longer stretch of DNA is a haplotype. Haplotypes come in pairs, and we get one from our mother and one from our father and each haplotype pair that we receive represents an SNP profile.

DNA polymerase III is a holoenzyme. in a few words, what does this mean?

A complex enzyme made up of several subunits. It consists of ten kinds of polypeptide subunits

What if the operator sequence is altered such that the repressor can't bind it (Oc)?

A constitutive mutation cis-dominant is a mutation that continuously produces a protein (that may be in excess), which in the wildtype is inducible

What is the difference between an allele and a gene?

A gene is a stretch of DNA that determines a certain trait Genes mutate and can take on different alleles. Alleles are different forms of a gene

What does MC1R gene do?

A gene that provides instructions to make the receptor protein involved in skin color; if the signaling molecules can bind to MC1R, eumelanin is produced, and if they cannot, pheomelanin is produced

The consequence of heterozygous recessive mutation of a transcription factor that binds to the core promoter.

A heterozygote will have a copy of the WT transcription factor gene on the other chromosome that can produce a WT transcription factor that can bind to the core promoter and initiate transcription. You need 2 copies of the recessive allele to affect gene expression

How are bases paired together in DNA? Is this a stable interaction that holds the two polynucleotides together?

A is always paired with T and C is always paired with G. It is a hydrogen bond that holds the two together, and each hydrogen bond is relatively weak, but because there are 2000-3000 bonds tandem in a polynucleotide chain, all of the bonds together are stable.

Telophase II and Cytokinesis

A nuclear envelope forms around each set of chromosomes. the cytoplasm divides.

Translation release factors

A release factor is a protein that allows for the termination of translation by recognizing the termination codon or stop codon in an mRNA sequence and enters the A site instead of a tRNA. Stop codons signal the termination of this process by binding release factors, which cause the ribosomal subunits to disassociate, releasing the amino acid chain.

Restriction map

A restriction map provides the location of sites cleaved by restriction enzymes.

We know that not all the DNA in the genome and not even all the genes in the genome code for protein. When we have sequence data, we can find protein coding genes by looking for ORFs. What's an ORF?

A sequence of triplet nucleotides in the same reading frame that after transcription and mRNA splicing, are translated into the amino acid sequence of a protein; they typically begin with the 5' start codon and end with the stop codon 3'

What happens when a TATA, CAAT, or GC-rich box are mutated?

A severe decrease in the level of transcription because these elements play a huge role in regulation initiation of trasncription

haploinsufficiency

A single copy of a recessive gene due to monosomy that may be insufficient to provide life-sustaining function; in a diploid organism, a condition in which an individual possesses only one functional copy of a gene with the other inactivated by mutation. The amount of protein produced by the single copy is insufficient to produce a normal phenotype, thus leading to an abnormal phenotype

What is a thymine (pyrimidine) dimer and what is its effect on your DNA?

A thymine dimer is two identical thymines next to each other on DNA and this can distort DNA conformation and inhibit normal replication, and as a result, errors can be introduced in the base sequence of DNA during replication and when the dimerization is extensive, it can kill cells!

Which list of steps in the eukaryotic cell cycle is given in the correct order? (step order listed left to right) A) . . . G1 - S - G2 - M - G1 . . . B) . . . G1 - G2 - S - M - G1 . . . C) G1 - S - G2 - M1 - M2 - G1 . . . D) . . . G1 - M - G2 - S - G1 . . .

A) . . . G1 - S - G2 - M - G1 . . . (The S phase is both preceded and followed by a period of growth (G1 and G2, respectively). After the M phase, the cell re-enters the G1 phase.)

In an analysis of the nucleotide composition of double-stranded DNA to see which bases are equivalent in concentration, which of the following would be true? A) A + C = G + T B) A = C C) A = G and C = T D) A + T = G + C E) A = G and C = T and A + C = G + T are both true.

A) A + C = G + T

Which statement best explains the distinction between the roles that DNA ligase and restriction enzymes perform in a DNA cloning experiment? A) DNA ligase generates the covalent bonds of the phosphodiester backbone, while restriction enzymes break those bonds. B) DNA ligase generates recombinant DNA by joining two different DNA molecules, while restriction enzymes convert long stretches of double-stranded DNA into two single-stranded DNA molecules. C) DNA ligase has a specific DNA recognition sequence, while restriction enzymes do not. D) DNA ligase generates hydrogen bonds between complementary base pairs, while restriction enzymes break those bonds.

A) DNA ligase generates the covalent bonds of the phosphodiester backbone, while restriction enzymes break those bonds.

Which of the following statements about DNA replication is true? A) DNA synthesis is continuous on the leading strand and discontinuous on the lagging strand. B) DNA synthesis is discontinuous on the leading strand. C) The two replication forks move in the same direction. D) DNA synthesis is conservative on the leading strand and semiconservative on the lagging strand.

A) DNA synthesis is continuous on the leading strand and discontinuous on the lagging strand.

You are doing a genetics experiment with fruit flies. In the P generation, you cross 2 true breeding flies. The female parent is brown and wingless and the male parent is black with normal wings. All of the F1 flies are brown with normal wings. A) What are the parental genotypes? B) What are the F1 genotypes? C) You now take a F1 female and cross her with a true-breeding, black wingless male. The male's genotype is: D) You count 1600 offspring in the F2 generation. If the wing and the color traits are linked and no recombination occurred, how many: Brown, winged flies of genotype _______ Black, winged flies of genotype _______ Brown, wingless flies of genotype _______ Black, wingless flies of genotype ______ E) When you count the F2 generation, you really get 85 brown winged flies, 728 black winged flies, 712 brown wingless flies, and 75 black wingless flies. What is the genetic distance between the color and the wing genes and what is the recombination frequency? F) A series of fruit fly matings show that the recombination frequency between the gene for wing size and the gene for antenna length is 5%. Draw the fly chromosome with all of the gene and the distances

A) Female: BBnn, Male: bbNN B) BbNn C) bbnn D) 0 Brown, winged flies of genotype BbNn 800 Black, winged flies of genotype Bbnn 800 Brown, wingless flies of genotype bbNn 0 Black, wingless flies of genotype bbnn (for the recombination, go back to the parents in part A) E) 10 m.u. and 10% RF F) /(c)-----/(a)-----/(w) 5 5

The incidence of Down syndrome, also known as trisomy 21, increases with increasing maternal age. Which of the following errors most likely produces this condition? A) Nondisjunction during either meiosis I or II in the female gamete B) Nondisjunction during either meiosis I or II in the male gamete C) Nondisjunction during meiosis II in either the male and female gamete D) Nondisjunction during meiosis I in either the male and female gamete

A) Nondisjunction during either meiosis I or II in the female gamete (Nondisjunction during either meiosis I or II can produce a gamete that will result in a trisomic zygote. Since the incidence of Down syndrome increases with maternal age, it is likely that this error occurs in the female gamete.)

Which of these will lead to constitutive transcription of Z, Y, and A? A) Repressor cannot bind operator B) repressor cannot bind lactose C) operator cannot bind repressor D) promoter cannot bind RNAP

A) Repressor cannot bind operator C) operator cannot bind repressor

What allele combinations for skin color would be most common in the middle of Africa and why?

AABBCC because there is a lot of UV intensity and they need to protect themselves from the UV rays

Which of these characteristics describe viral chromosomes? (Circle any that apply.) Circular, linear, made of DNA (single or double-stranded), made of RNA (single or double-stranded)

ALL

In the language of DNA, what is the start codon?

ATG

What allele combinations for skin color would be most common in native populations near the Arctic circle who eat a lot of fish and why?

AaBbCc because there is less sunlight, so they would probably be heterozygous because they do not need Vitamin D, but they are very far north, but they do still need some UV protection, but they don't need as light of skin because they have a lot of Vitamin D in their diet

What does the word epigenome literally mean?

Above the genome; what distinguishes cells is not their genes, but how they are switched on or off through epigenetics

X-linked adrenoleukodystrophy is an X-linked disorder that affects the nervous system and adrenal glands. Mike and his two sisters, Sophie and Cara, all inherit one copy of the mutant allele from their mother.Sophie's symptoms, although not as bad as Mike's, are more severe than Cara's. In terms of x-inactivation, explain why this variability in the heterozygous phenotype exists.

According to the Lyon hypothesis, X-inactivation occurs randomly early in development. The ratio of X silencing is not always 50/50; one of the X's might get silenced in a higher percentage of cells than the other. It is likely that silencing ratio of paternal X's to maternal X's is higher in Sophie, thus resulting in her having a higher percentage of cells expressing the mutant allele.

Chromatin exists in two forms: heterochromatin and euchromatin. Explain how it a possible that a gene can be found in a heterochromatic region of DNA in a skin cell but a euchromatic region in a neuron.

All cells have all the same DNA, but some genes are only transcriptionally active in certain types of cells. It is likely that this the product of the gene may be used by neurons by not skin cells Therefore, it makes sense that it would be in a more accessible euchromatic region when in a neuron where it is needed, but more tightly packed in a skin cell where it is not needed.

Explain in multicellular eukaryotes, how a protein can be expressed in one cell and not another by explaining cis elements and trans acting factors.

All eukaryotic cells contain the exact same genes, and thus the same genes will contain the same promoters and cis-sequences, but different cells express different protein products because of trans-acting factors that recruit and help RNAP bind to the promoter and initiate transcription of the gene into mRNA to be translated to make the protein product. If a cell doesn't have trans-acting factors, then no mRNA product can get made and there will be no expression of the gene. From the very beginning, different TFs are set aside in different cells, leading to their different functions. Trans-acting factors confer specificity

Why do cloning vectors have multiple restriction sites?

Allows scientists to clone a range of different fragments generated by commonly used restriction enzymes

There are many more unique proteins in the human body than there are unique genes coding for them. How is this possible?

Alternative splicing, so you can have different combinations of exons

Consider a diploid cell that contains three pairs of chromosomes designated AA , BB, and CC. Each pair contains a maternal and a paternal member (e.g., Am and Ap, etc.). What chromosomes will be present at each pole at the completion of anaphase in mitosis? Check all that apply. Am,Ap, Bm,Bm, Cm,Cp Am,Ap, Bm,Bp, Cm,Cp Am,Am, Bp,Bp, Cm,Cp Am,Ap, Bm,Bm, Cm,Cp Ap,Ap, Bm,Bm, Cp,Cp Ap,Ap, Bm,Bp, Cm,Cp

Am, Ap, Bm, Bp, Cm, Cp

How to promoter swap and apply use of GFP or HOX:

Amplify promoter of the gene with PCR Amplify GFP/HOX gene of interest with PCR Cut GFP with restriction enzyme(s) Cut promoter with restriction enzyme(s) Cut the vector and ligate them into a vector Transform bacteria to make a whole bunch of copies of the plasmid Then kill the bacteria, lyse the cells, take all the plasmids, then put the plasmids into the organism

How does a gene provide information for a protein, i.e. how does information flow through a cell? Be sure to define of transcription and translation.

An organism's genetic makeup is contained in the sequence of nucleotide bases in DNA. DNA specifies the synthesis of proteins by dispatching information to RNA, which in turn builds proteins. Transcription is the transfer of genetic information from DNA to RNA Translation is the transfer of information from RNA to proteins

Consider a population of rats in which the environment changes from one of stability (lots of food and protection and calm rats have the advantage) to one of instability where anxious rats have the advantage. What kinds of rats will be selected for? Will these rats be good mothers?

Anxious rats because they are constantly searching for things in their environment and are more used to stressful environments No, they will not nurture their pups as much

If you want to produce mouse insulin in mice tongues to see how it effects their taste, which method would you use? A) Transform mice with Ti plasmid + Agrobacterium with insulin gene attached to a tongue promoter. B) Add an artificial construct of tongue promoter attached to the insulin gene into early mouse embryos.

B) Add an artificial construct of tongue promoter attached to the insulin gene into early mouse embryos. (Ti only used to transform plants)

Which statement correctly describes how cellular DNA content and ploidy levels change during meiosis I and meiosis II? A) DNA content is halved only in meiosis I. Ploidy level changes from diploid to haploid only in meiosis II. B) DNA content is halved in both meiosis I and meiosis II. Ploidy level changes from diploid to haploid in meiosis I, and remains haploid in meiosis II. C) DNA content is halved in both meiosis I and meiosis II. Ploidy level changes from diploid to haploid only in meiosis II. D) DNA content is halved only in meiosis II. Ploidy level changes from diploid to haploid in meiosis I, and remains haploid in meiosis II. E) DNA content is halved only in meiosis I. Ploidy level changes from diploid to haploid in meiosis I, and remains haploid in meiosis II.

B) DNA content is halved in both meiosis I and meiosis II. Ploidy level changes from diploid to haploid in meiosis I, and remains haploid in meiosis II. (During anaphase of both meiosis I and meiosis II, the DNA content (number of copies of chromosomes) in a cell is halved. However, the ploidy level changes only when the number of unique chromosome sets in the cell changes. This occurs only in meiosis I (where separation of homologous chromosomes decreases the ploidy level from 2n to n and produces daughter cells with a single chromosome set))

Which of the following best describes the biological role of the lac operon? A) It prevents other sugars from being metabolized until all available lactose has been used. B) It ensures that a cell dedicates resources to the production of enzymes involved in lactose metabolism only when lactose is available in the environment. C).It ensures that bacterial cells produce lactose only when no other food sources are available. D) It ensures that a cell produces enzymes involved in lactose metabolism in a constitutive manner.

B) It ensures that a cell dedicates resources to the production of enzymes involved in lactose metabolism only when lactose is available in the environment.

With normal replication: (Can choose more than 1) A) The 3' strand of a telomere will get shorter with each round of replication. B) The 5' strand of a telomere will get shorter with each round of replication. C) The leading strand will get shorter with each round of replication. D) The lagging strand will get shorter with each round of replication.

B) The 5' strand of a telomere will get shorter with each round of replication. D) The lagging strand will get shorter with each round of replication.

Which bacteria grow on the agar plate if the Ames test is positive? A) his− prototrophs B) his + prototrophs C) his + auxotrophs D) his − auxotrophs

B) his + prototrophs

During transcription in eukaryotes, a type of RNA polymerase called RNA polymerase II moves along the template strand of the DNA in the 3'→5' direction. However, for any given gene, either strand of the double-stranded DNA may function as the template strand. Which of the following initially determines which DNA strand is the template strand, and therefore in which direction RNA polymerase II moves along the DNA? A) the location of specific proteins (transcription factors) that bind to the DNA B) the specific sequence of bases along the DNA strands C) the position of the gene's promoter on the chromosome D) the location along the chromosome where the double-stranded DNA unwinds E) which of the two strands of DNA carries the RNA primer

B) the specific sequence of bases along the DNA strands (In eukaryotes, binding of RNA polymerase II to DNA involves several other proteins known as transcription factors. Many of these transcription factors bind to the DNA in the promoter region, located at the 3' end of the sequence on the template strand. Although some transcription factors bind to both strands of the DNA, others bind specifically to only one of the strands. Transcription factors do not bind randomly to the DNA. Information about where each transcription factor binds originates in the base sequence to which each transcription factor binds. The positioning of the transcription factors in the promoter region determines how the RNA polymerase II binds to the DNA and in which direction transcription will occur.)

All of the following events occur during normal meiosis except _______. A) sister chromatids separate from one another during meiosis II B) two haploid gametes fuse to form a diploid cell C) homologous chromosomes separate from one another during meiosis I D) one diploid cell produces four haploid cells

B) two haploid gametes fuse to form a diploid cell (This happens after meiosis)

Total RNA was isolated from human cells growing in culture. The RNA was mixed with non-template strands (single strands) of the human gene encoding an enzyme and the RNA-DNA mixture was incubated for several hours under renaturation conditions. Would you expect any DNA-RNA duplexes to form during the incubation. A. Yes, the non-template strands are complementary to the RNA in this experiment. B. Yes, but only if this experiment was INSTEAD performed with template strands, DNA-RNA duplexes would form. C. Yes, as long as this gene has very few, or small introns. D. No, DNA cannot hybridize with RNA.

B. Yes, but only if this experiment was INSTEAD performed with template strands, DNA-RNA duplexes would form.

Eukaryotic cells contain DNA in the chloroplasts (in addition to the nucleus). Is the organization of DNA in this organelles more similar to bacteria or eukaryotic chromosomes. Why? What characterizes it?

Bacteria; cpDNA is double stranded, circular DNA with no histones, but it does have introns, and there are repeats.

Eukaryotic cells contain DNA in the mitochondria (in addition to the nucleus). Is the organization of DNA in this organelles more similar to bacteria or eukaryotic chromosomes. Why? What characterizes it?

Bacteria; mtDNA is double stranded circular DNA with no histones, it doesn't have any introns, or any repeats

What is an anticodon?

Base triplet of a tRNA molecule that couples the tRNA to a complementary codon in the mRNA. The base pairing of an anticodon to a codon is a key step in translating mRNA to a polypeptide

German measles results from an infection of the rubella virus, which can cause many health problems. What conclusions can you reach from a nucleic acid analysis of the virus that reveals A+G/U+C ratio of 1.13?

Because 1.13 is not 1.00, we can assume that rubella is a single stranded DNA virus

What has the universality of the genetic code allowed scientists to do?

Because diverse organisms share a common genetic code, it is possible to program one species to produce a protein from another species by transplanting DNA.

Why is it advantageous for bacteria to have the lac operon turned off in the presence of glucose?

Because glucose is their preferred source of carbon, energy, and when they have carbon in the cell, do they not want to waste resources breaking down lactose into glucose. It is more energy efficient to break down glucose than to break down lactose. Furthermore, it takes extra energy and raw materials to synthesize the proteins needed for lactose metabolism.

Why did Mendel get lucky?

Because he used traits whose phenotypic characteristics were determined exclusively by inheritance of alleles for single genes, and he didn't have to contend with phenotypic variation introduced by other genes or environmental factors. Each trait was decided by a single pair of alleles, one fully dominant, and one fully recessive

A student added ligase and restriction enzymes at the same time to his experiment. Repeatedly, he did not get any transformants. Why?

Because immediately after the restriction enzymes cut the sequence, ligase sealed the phosphodiester bonds, so there was no fragment to anneal into the plasmid

Differences between eukaryotic and prokaryotic DNA replication

Because in eukaryotes there is much more DNA, they have multiple replication origins, thousands of DNA polymerase IIIs, and because they have chromatin and telomeres, they have chromatin assembly factors, and some cells have telomerase. Euakryotic replication is significantly slower than prokaryotic

A cancer cell line is found to have a mutation in the gene coding for methyltransferase. Explain what the effect on cells' DNA would be. Why is cancer a likely result of this mutation?

Because methyltransferase adds methyl groups the the cytosines of DNA and represses transcription by causing the chromatin to bind tighter, which will not allow transcription factors to bind, if methyltransferase is mutated and cannot properly methylate cancers cells, they cytosines will not be methylated and more DNA will be exposed to transcription factors and the cancer genes will be expressed (more euchromatin, less heterochromatin)

X-linked adrenoleukodystrophy is an X-linked disorder that affects the nervous system and adrenal glands. Mike and his two sisters, Sophie and Cara, all inherit one copy of the mutant allele from their mother. Why does Mike show more severe symptoms than his sister?

Because of X-inactivation, the sisters only express the mutant allele in some of their cells. Mike only has the mutant allele, so it is expressed in all of his cells.

Why are sex aneuploidies more common than autosomal aneuploidies?

Because of dosage compensation, this allows they to be viable

Why are there "leading strands" and "lagging strands" during replication?

Because the DNA polymerase III can only synthesize in a 5' to 3' direction, synthesis along an advancing replication fork occurs in one direction on one strand and in the opposite direction on the other strand, and because of this, onle one strand can be continuous. This continuous strand is the leading strand. As the fork progresses, many points of initiation are necessary on the opposite DNA template, the lagging strand.

A spined stickleback is found that has minimal hormones originating in the pituitary gland, but the rest of the fish is normal. Hypothesize the genetic structure related to this fish's PitX gene.

Because the PitX gene is also expressed in the pituitary gland, as well as the jaw and pelvis, because the rest of the fish is normal, the coding region is not mutated, and it is that the specific enhancer that the transcription factors in the pituitary cells recognize has been mutated or deleted. A nonfunctional pituitary gland enhancer with a functional PitX coding region. Recall PitX is also made in the pituitary gland of these fishies. If the fish is spined, that also tells us that PitX is functional. The difference is that different areas of the body are stimulated to make PitX based on having the specific enhancer. If PitX is not made in the pituitary gland, it likely is missing / has a mutated pituitary gland enhancer sequence for the PitX gene.

The reason mouse genomic DNA with a bacterial promoter won't result in a functional protein.

Because the bacterial promoter can only be bound by bacterial RNAP, and bacteria do not have splicing mechanisms to splice out the introns that are in eukaryotic genomic DNA

When we plate our bacteria on two Amp containing plates, what does a plate without colonies mean?

Because the recombinant DNA molecule contains antibiotic resistance gene those bacteria cells have NOT been transformed. Those bacteria did not take up the plasmid and we know this because they do not have resistance to this antibiotic, and when we plated them on the media with the antibiotic, it killed them

How does agrobacteria and the use of the Ti plasmid work?

Before we can introduce a new gene into a plant, we have to use agrobacteria and insert the gene into the agrobacteria via the Ti plasmid. We alter the natural Ti plasmid to remove the pathogenic component and in its place we insert our gene of interest to make a recombinant Ti plasmid. When the agrobacteria transfer part of the plasmid (which will contain the gene of interest and the marker that will allow you to select for recombinant plants) into the plant genome. The gene will not stay in the plasmid, because agrobacteria integrates the gene into the genome of the plant

Describe the steps in translation that require complementary base pairing.

Between the codon in the mRNA and the anticodon in the tRNA is responsible for aligning the tRNA that carries the appropriate amino acid to be added to the polypeptide chain

The bacteria may contain the plasmid, but they may not have the GH gene because the plasmid's sticky ends may come back together (empty vector), and they may not have the recombinant DNA molecule. How can we be sure that the bacteria growing on the plate have the vector that has the GH gene in it?

Blue/white screening or we can verify through PCR

In meiosis, does fertilization contribute to hereditary, genetic variation, or both and why?

Both because of the random fusion of male and female gametes leads to variation

½ of the population has attached earlobes and the other half has detached. What is the wildtype phenotype and how do you know?

Both because they are both so common. We would call this a polymorphic trait because more than one morph, "form" is wildtype

In meiosis, does metaphase II to anaphase II contribute to hereditary, genetic variation, or both and why?

Both because this process ensures that each of the 4 daughter cells receives one complete set of chromosomes, but it also ensures that the chromosome set is mixture of maternal and paternal chromosomes

In meiosis, does metaphase I to anaphase I contribute to hereditary, genetic variation, or both and why?

Both because this process ensures that each of the 4 daughter cells receives one complete set of chromosomes, but it also ensures that the chromosome set is mixture of maternal and paternal chromosomes and the fact that the random organization of homologs at the metaphase plate determines which chromosome goes to which pole

Snail is a transcriptional regulator protein. When it interacts with cis-regulatory regions of the E-cadherin gene, it reduces transcription. When it interacts with cis-regulatory regions of the Inscuteable gene, it increases transcription. Is Snail an activator or is it a repressor? Explain.

Both. It's a repressor in relation to E-cadherin and an activator in relation to Inscuteable.

Which of the following DNA sequences is one strand of a restriction enzyme recognition sequence? A) 5' GGGGGG 3' B) 5' AAACCC 3' C) 5' GGATCC 3' D) 5' GGGTTT 3'

C) 5' GGATCC 3' (MUST BE PALINDROMIC SO THE RESTRICTION ENZYME CUTS BOTH STRANDS OF DNA!!!! The 5' → 3' sequence of the complementary strand would be the same as the 5' → 3' sequence of this strand; i.e., this sequence is symmetrical about the midpoint. )

Which of the following mutations could lead to constitutive expression of the genes of the lac operon? A) A mutation in the lac-Z gene B) A super repressor mutation C) A mutation in the operator sequence D) A mutation in the lac-Y gene

C) A mutation in the operator sequence (Such a mutation could prevent binding of the repressor, allowing expression under all conditions.)

Which of the following statements about translation in eukaryotes is true? A) All proteins start with the modified amino acid formyl methionine (fMet). B) Eukaryotes have coupled transcription and translation, so the ribosome may bind the nascent mRNA as soon as the 5' end is made. C) In eukaryotes, mRNAs are much longer lived than in prokaryotes. D) The 16S rRNA binds to the Shine-Dalgarno sequence near the 5' end of the mRNA.

C) In eukaryotes, mRNAs are much longer lived than in prokaryotes. (prokaryotes use fMet, not eukaryotes)

Which of the following statements about nondisjunction is false? A) It may fail to separate maternal chromatids from one another or paternal chromatids from one another. B) It occurs more frequently in human females over age 35. C) It separates maternal from paternal chromosomes. D) It may fail to separate maternal from paternal chromosomes.

C) It separates maternal from paternal chromosomes.

Cystic fibrosis in humans is caused by a loss of function mutation in the CFTR gene. How can you determine this? A) Clone the mutant form, introduce into mouse genome, and examine the phenotype of the mice B) Use a cell type specific promoter to drive expression of CFTR and examine the phenotype C) Make cDNA from the different cell types found in the lungs, perform PCR with CFTR primer, and analyze the PCR products with gel electrophoresis. D) All

C) Make cDNA from the different cell types found in the lungs, perform PCR with CFTR primer, and analyze the PCR products with gel electrophoresis.

Which of the following statements about the basic structural features of DNA are true? A) The major and minor grooves form in the DNA helix because the DNA strands are antiparallel. B) The major and minor grooves prevent DNA binding proteins from making contact with nucleotides. C) The twisting of the DNA double helix is attributed to the tight packing of DNA bases and base-stacking. D) In a DNA macromolecule, the two strands are complementary and antiparallel.

C) The twisting of the DNA double helix is attributed to the tight packing of DNA bases and base-stacking. D) In a DNA macromolecule, the two strands are complementary and antiparallel. (In a DNA macromolecule, the two strands are complementary and antiparallel. There is an axis of helical symmetry and the double helix twists around this axis. The tight packing of DNA bases causes this twist and causes base-stacking. This base-stacking results in the formation of major and minor grooves in the DNA helix, which expose the underlying nucleotides and allow DNA binding proteins to contact them)

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene? A) a base substitution at the beginning of the gene B) a base substitution at the end of the gene C) a frameshift deletion at the beginning of the gene D) a frameshift deletion at the end of the gene

C) a frameshift deletion at the beginning of the gene (A frameshift mutation at the beginning of a gene would affect every codon after the point where the mutation occurred. During protein synthesis, incorrect amino acids would be inserted from the point where the frameshift mutation occurred on; the resulting protein would most probably be nonfunctional. For this reason, a frameshift mutation at the beginning of a gene is generally the most severe type of mutation.)

Human DNA cut with restriction enzyme A can be joined to A) human DNA cut with restriction enzyme B. B) human DNA that is uncut. C) bacterial DNA cut with restriction enzyme A D) bacterial DNA that is uncut. E) none of the above

C) bacterial DNA cut with restriction enzyme A

Which of the following has chromosomes that consist of double stranded DNA? A) prokaryotes B) eukaryotes C) both

C) both

Each of the following events occurs during mitosis except _______. A) chromosomes condense B) microtubules assemble between centrioles C) polar microtubules contract, pulling attached chromosomes toward the poles D) nuclear membrane breaks down

C) polar microtubules contract, pulling attached chromosomes toward the poles (This describes the role of kinetochore microtubules during anaphase. Polar microtubules lengthen during anaphase, causing the cell to become elliptical.)

RNA differs from DNA in all EXCEPT which of the following ways? A) the number of different functions performed B) the sugar molecule C) the 5'-3' orientation of the polynucleotide strand D) the presence of uracil

C) the 5'-3' orientation of the polynucleotide strand (Both RNA and DNA have the same 5' phosphate group and 3' hydroxyl group chemical orientation.)

A geneticist isolates a gene for a specific trait under study. She also isolates the corresponding mRNA. Upon comparison, the mRNA is found to contain 1,000 fewer bases than the DNA sequence. Did the geneticist isolate the wrong DNA? A. yes, mRNA is made from a DNA template and should be the same length as the gene sequence B. yes, the mRNA should contain more bases than the DNA sequence because bases flanking the gene are also transcribed C. no, the final mRNA contains only exons, the introns were removed D. no, the mRNA was partially degraded after it was transcribed

C. no, the final mRNA contains only exons, the introns were removed

positive vs. negative regulation with the lac operon

CAP/cAMP must be bound to promoter to activate transcription vs. the repressor must be removed to have transcription occur.

How does Dr. Jean-Pierre Issa use our knowledge of the epigenome to try to cure cancer?

Can misplaced tags be rearranged? There is a drug out now that removes tags silencing tumor suppressor genes Dr. Issa is trying to stay away from killing the cell, but instead trying to change the instruction of the cancer cell and reactivating genes

Is the C-terminus of a protein the amino or carboxyl end?

Carboxyl

In 2005, Laura applied for private health insurance and was asked to provide a DNA sample. Two weeks later, she learned that she has been denied coverage because she was at a high risk for heart disease. Laura was shocked, considering how none of her family members have heart disease. Suppose Laura eventually develops heart disease. How might her doctors use the same data about her SNPs to determine the optimal type and dose of medicine to give her?

Certain haplotypes are associated with different responses to drugs. If Laura has a haplotype known to respond negatively or neutrally to a drug, it would be better to give a different type that will work. This saves money and can prevent adverse reactions to treatment. A single SNP doesn't tell much about someone, so in order to find an association between SNPs and other things, scientists have to look at many SNPs, a haplotype

What affect do less nurturing mothers have on rat DNA and pup phenotype?

Chromatin becoming slightly less tightly compact. Little expression of the GR gene because the chromatin did not open up that much. Gene less exposed, and less transcription and less protein around; more anxious

What affect do nurturing mothers have on rat DNA and pup phenotype?

Chromatin even less compact. Removal of methyl groups and allows for lots of expression; more GR protein around and lots of that receptor to bind to cortisol; less anxious

In prokaryotes and eukaryotes, how is chromatin different relative to transcription?

Chromatin needs to be remodeled in eukaryotes before the gene is trancribed

List the levels at which eukaryotic gene expression can be regulated:

Chromatin remodeling regulation of transcription splicing and processing regulation of transport out of the nucleus degradation of mRNA translation regulation protein modification

Is Oc a dominant or recessive allele to O+ and why?

Cis-dominant: partial diploid with a genotype O+/Oc will have the constitutive phenotype. Only one allele needed to exert phenotype, because with just one Oc allele, you will get 1 copy of Z no matter what, and 1 copy is enough for a normal phenotype. Oc will only affect 1 Z allele and 1 Y allele and only affect the alleles to which it is cis to (THINK ABOUT HOW MANY ALLELES YOU NEED TO SEE THE PHENOTYPE)

DNA polymerase I was the first polymerase discovered (by Kornberg), but cells without it could still replicate their DNA in vivo. We now know that _________ is the enzyme responsible for DNA replication in vivo.

DNA polymerase III

Nucleotide

Constist of a nitrogenous base (A, G, T, C), a 5-carbon sugar, and a phosphate group. They serve as the building blocks for the extremely long molecules that make up the chromosomes in every cell of our bodies, and that carry the genetic blueprint.

I+ OcZ+ Y+/I+ O+Z+ Y+ With and without lactose and the effect on both Y and Z.

Constitutive

In the presence of lactose, are the structural genes constitutive, permanently repressed or inducible with I- Oc Z+?

Constitutive

IS OcZ+ Y+/I+ OcZ+ Y+ With and without lactose and the effect on both Y and Z.

Constitutive (super repressor cannot bind to the operator)

I- O+Z+ Y-/I- O+Z+ Y+ With and without lactose and the effect on both Y and Z.

Constitutive no operator mutation and no repressor around in the system

What is the difference in function between a core promoter elements (such as TATA and BRE) and a proximal promoter elements (such as a CAAT box)?

Core Promoter: determines accurate initiation of RNAPII Proximal Promoter: modulate efficiency and stimulates basal (low levels) of transcription. The CAAT box for example is critical to the promoter's ability to initiate transcription Help regulate gene expression at the level of transcription

Consider a diploid cell that contains three pairs of chromosomes designated AA , BB, and CC. Each pair contains a maternal and a paternal member (e.g., Am and Ap, etc.). Which of the following are chromatid pairs that will be present during metaphase in mitosis? Check all that apply. CpCp CmCp BmBm AmAp CmCm ApAp BmBp BpBp AmAm

CpCp BmBm CmCm ApAp BpBp AmAm

Given the following mRNA sequence, which of the following mutations would affect the protein sequence? 5'-AUG CAG UUA GCG UGC UAG-3' A) 5'-AUG CAA UUA GCG UGC UAG-3' B) 5'-AUG CAG UUA GCA UGC UAG-3' C) 5'-AUG CAG UUG GCG UGC UAG-3' D) 5'-AUG CAC UUA GCA UGC UAG-3'

D) 5'-AUG CAC UUA GCA UGC UAG-3' Amino acid change

All EXCEPT which of the following are characteristics of the genetic material? A) It must be capable of change. B) It contains all the information needed for growth, development, and reproduction of the organism. C) It must be replicated accurately. D) It is composed of protein.

D) It is composed of protein. (Although early observations favored protein as the genetic material, subsequent experiments demonstrated that the genetic material was nucleic acid.)

Which of the following statements is NOT true regarding translation of eukaryotic mRNA: A) The small subunit binds to mRNA before the large subunit. B) mRNA is translated in the 5' to 3' direction. C) Start codons pair with a special charged tRNA that has an anticodon loop sequence complementary to the sequence of the initiator codon. D) Stop codons pair with a special charged tRNA that has an anticodon loop sequence complementary to the sequence of the stop codon. E) The genetic code is non-overlapping.

D) Stop codons pair with a special charged tRNA that has an anticodon loop sequence complementary to the sequence of the stop codon. (a signal release protein comes instead of a tRNA)

Digestion of a 1.1‑kb fragment of DNA with BamHI produces two fragments of 700 bp and 400 bp. Digestion of the same 1.1‑kb fragment with XhoI produces two fragments of 300 bp and 800 bp. Digestion with both enzymes produces three fragments of 100 bp, 300 bp, and 700 bp. Which of the following statements is true about the DNA fragment? A) The BamHI site is located within the XhoI 100‑bp fragment. B) The BamHI site is located within the XhoI 300‑bp fragment. C) The XhoI site is located within the BamHI 700‑bp fragment. D) The XhoI site is located within the BamHI 400‑bp fragment

D) The XhoI site is located within the BamHI 400‑bp fragment (Since double digestion produces a 100‑bp fragment and a 300‑bp fragment, the XhoI site must be located within the BamHI 400‑bp fragment.)

Which of the following statements about meiosis is true? A) The products of meiosis contain a diploid complement of chromosomes. B) During meiosis, homologous chromosomes behave autonomously of one another. C) A tetrad is composed of four sister chromatids. D) The second meiotic division is similar to mitosis in that the sister chromatids separate.

D) The second meiotic division is similar to mitosis in that the sister chromatids separate. (The second meiotic division is also called an equational division and involves the separation of sister chromatids, similar to what occurs in mitosis.)

Why would you ligate a fragment of DNA into a cloning vector?

DNA fragments produced by the restriction enzyme could be copied and cloned

Assume that an organism exists in which crossing over does not occur, but that all other processes associated with meiosis occur normally. Consider how the absence of crossing over would affect the outcome of a single meiotic event. Which of the following statements would be true if crossing over did not occur? Select all that apply. A) Independent assortment of chromosomes would not occur. B) The two sister chromatids of each replicated chromosome would no longer be identical. C) The two daughter cells produced in meiosis I would be identical. D) There would be less genetic variation among gametes. E) The daughter cells of meiosis I would be diploid, but the daughter cells of meiosis II would be haploid. F) The four daughter cells produced in meiosis II would all be different.

D) There would be less genetic variation among gametes (Crossing over contributes significantly to the genetic variation seen in gametes. This is because the exchange of maternal and paternal genes between the nonsister chromatids of a homologous chromosome pair creates recombinant chromosomes with unique combinations of alleles. However, crossing over is not the only process that introduces genetic variation in meiosis I. The independent assortment of homologous chromosomes (which are never identical) in meiosis I produces daughter cells that differ from each other. The effect of crossing over on genetic variation is shown below. Without crossing over, sister chromatids remain identical and thus, pairs of daughter cells would be identical. With crossing over, however, all four daughter cells are genetically unique)

Which of the following statements about the products produced when nondisjunction occurs during meiosis I is true? A) Both products of the first meiotic division contain dyads representing one chromosome of each homologous pair. B) Three products of the second meiotic division have too many chromosomes, while one is missing a chromosome for a particular set. C) Both products of the first meiotic division have too many chromosomes. D) Two products of the second meiotic division have both the maternal and paternal chromosomes of a set and the other two products have none for that set.

D) Two products of the second meiotic division have both the maternal and paternal chromosomes of a set and the other two products have none for that set. (Nondisjunction during meiosis I yields two gametes that are missing a particular chromosome after meiosis II.)

The haploid number of a species is __________. A) 2n B) produced during mitosis C) the karyotype D) n

D) n (The haploid number is the number of unique chromosomes in gametes after meiosis.) One member of each homologous pair...either paternal or maternal

What is cDNA?

DNA copies that are made from the mRNA molecules of a cell population and represent the genes being expressed in the cells; complementary to the nucleotide sequence of mRNA and so it only contains the coding sequences and expressed genes

What did Manel Esteller from the Spanish National Cancer Center learn from studying 40 pairs of identical twins?

DNA is 100% the same, so any difference should be from the outside world As sets of identical twins get older, their epigenome differs more Identical genes active in one twin may be shut down in another, which explains why one twin can get a disease that the other does not As years pass, epigenetic differences accumulate in identical twins. For example, twins in childhood have more genes that are functioning identically than older twins Genes are only part of the story

Recombinant DNA

DNA molecules created by artificially joining together pieces of DNA from different sources (organisms)

Viral chromosomes exist in a variety of conformations and can be made up of ________. protein- or lipid-coding sequences DNA only RNA only DNA, RNA, or protein DNA or RNA

DNA or RNA

"looking for someone with big machinery that can replicate my DNA quickly, without too many mistakes. Text me if you have what it takes"

DNA polymerase

The enzyme that can replicate DNA is called

DNA polymerase

What enzyme elongates the new strand of DNA in vivo?

DNA polymerase

Which enzyme catalyzes the addition of nucleotides to a growing DNA chain?

DNA polymerase

_________ removes the RNA primers and fills I the gaps with DNA nucleotides

DNA polymerase I

In 1944, Avery, MacLeod, and McCarty published a famous paper concluding what?

DNA was the genetic material and the transforming principle in the Griffith experiment

If you performed electrophoresis of two DNA molecules (one of 200 base-pairs and one of 250 base-pairs) on an agarose gel, would they move towards or away from the positively charged pole? Why? Which one would migrate farther (closer) to the positively charged pole? Why?

DNA would migrate towards the positively charged pole because they are negatively chared based on the phosphate groups of the nucleotides. The shorter chain would migrate faster toward the positively charged pole because it has less mass.

What is the central dogma of genetics? RNA → DNA → protein Protein → RNA → DNA DNA → protein → RNA DNA → RNA → protein

DNA → RNA → protein (The central dogma states that information flows from DNA to RNA to protein, meaning that DNA makes RNA, and RNA most often makes protein.)

What did 32P label in the Hershey-Chase experiments?

DNA, because DNA contains phosphorus, but protein does not.

Many promoter regions contain CAAT boxes. How might one determine the influence of CAAT boxes on transcription rate of a given gene?

Delete CAAT, insert more CAAT, or mutate CAAT

If you wanted to shut down expression of PitX in only the pituitary, how would you do that?

Delete the enhancer for the pituitary gland (this is just one of the ways)

Your friends George and Diane are doing an experiment in which they fuse a "wing" HOX gene to the HOX promoter that regulates genes in 3rd thoracic segment. Wings are normally found on the 2nd thoracic segment. They will insert the gene into a fly embryo early in development. George thinks that this will cause the fly to grow wings only on the 3rd thoracic segment. Diane thinks that the fly will grow wings on the 2nd AND 3rd. Which hypothesis do you agree with and why?

Diane's hypothesis is correct. The normal hox promotor/gene in the 2nd thoracic segment is still there, so a wing will develop. The transgene (transgene = extra gene added by scientists) will cause the wings to also develop in the 3rd thoracic segment.

Why is PitX normally expressed in a pituitary cell and not an eye cell?

Different cells have the same DNA, but there are different activator transcription factors. Both cell types have the same enhancers Activator transcription factors are present in the pituitary cells that interact with specific pituitary enhancer of the PitX gene. Factors that interact with enhancers of PitX gene are not present in the eye cell There are multiple different types of enhancers that regulate expression of PitX, but there is a specific enhancer that promotes expression in the pituitary cell

Explain alternative splicing

Different combinations of exons combine in the mature mRNA depending on the different cell type, and then when these mRNAs are translated, we get different protein products in the cell types because different sequences are put together through alternative splicing. They selectively choose which exons they want to keep in their mature mRNA product (alternative splicing gives different isoforms)

What controls the differential expression of PitX?

Different enhancer regions that different cell types have specific trans-acting factors to recognize

Telomeres are believed to protect the linear chromosomes of eukaryotes from what two outcomes?

Double strand breaks occur when a chromosome becomes fragmented internally, and the loose ends can either fuse to other such ends or if they do not fuse, they are subject to degradation by nucleases, and telomeres create inert chromosome ends, protecting the eukaryotic chromosome

What is the DSCR?

Down Syndrome Critical Region, part of chromosome 21 that contains genes that are dosage sensitive in this trisomy and responsible for many phenotypes associated with this syndrome

consequences of meiosis going awry

Down syndrome, Kleinfelter syndrome, Turner syndrome; chromosomal abnormalities

Given the end results of the two types of division, why is it necessary for homologs to pair during meiosis and not desirable for them to pair during mitosis?

During meiosis I, chromosome number is reduced to haploid complements. This is achieved by synapsis of homologs and then their subsequent separation. It would be more difficult for genetically identical daughters to form from mitosis of homologs paired. By having chromosomes unpaired at metaphase of mitosis, only centromere division is required for daughter cells to eventually receive identical chromosomal complements

During replication, because the RNA primers are removed, a gap is found on the lagging strand. With each round of replication, this means what happens to chromosome length?

Each replication, the double stranded end of the chromosome is shortened by a length of the primer, eventually extending beyond the telomere to potentially delete gene coding regions

Elongation phase in DNA directed synthesis of RNA

Elongation of RNA in the 5' 3' direction (nucleotides are added to the 3' end of the growing RNA). a. Growing mRNA is synthesized

What is the basis of epigenetics?

Epigenetic changes are reversible modifications to gene expression without altering the DNA sequence. They an result from environmental factors. During its lifespan, and organism has only one genome, but this genome an be modified in diverse cell types at different times in response to different environments to produce many epigenomes, and like the genome, the epigenome can be transmitted to daughter cells by mitosis and to future generations by meiosis

Which kind of change (genetic or epigenetic) will result in a population adapting to a new environment faster?

Epigenetic; DNA takes a long time to be selected for...evolution takes a long time; epigenetics is a way that an organism can adapt to their environment during their lifetime

Which of the following statements concerning euchromatin is true? Euchromatin condenses earlier than heterochromatin prior to cell division. Euchromatin is replicated earlier than heterochromatin. The Barr body consists entirely of euchromatin. Euchromatin contains few genes.

Euchromatin is replicated earlier than heterochromatin. (euchromatin is the gene containing portion of the chromosome)

What are some of the ways prokaryotes and eukaryotes differ in gene regulation?

Eukaryotes do not grow solely in response to nutrient availability, instead they regulate their growth and division to occur at appropriate places in the body and at appropriate times during development. In contrast to prokaryotes, where gene regulation occurs at the level of transcription initiation, gene regulation in eukaryotes occurs at initiation of transcription, mRNA modifications and stability, and the synthesis, modification, and stability of the protein product. Eukaryotes also have chromatin, eukaryotes can control expression by choosing which mRNAs get transported. Genetic information in eukaryotes is carried on many chromosomes, instead of just one, and these are found in the nucleus of the cell, which in order to be translated and expressed, they have to be transported out of the nucleus in the cytoplasm, which can be regulated. Prokaryotic mRNA is very short lived, allowing them to rapidly respond to environmental changes, while eukaryotic mRNA can be manipulated to alter decay rates

Compare and contrast transcriptional regulation in prokaryotes and eukaryotes.

Eukaryotes have much more transcription regulation factors than prokaryotes. Transcription regulation in prokaryotes is controlled mainly by initiation of transcription, specifically the interaction of the RNAP with the promoter. In eukaryotes, it is way more complicated, because just the interaction of RNAPII with the promoter isn't enough. Multi-cellular eukaryotes do not grow solely in response to the availability of nutrients, like many prokaryotes do, instead they regulate their growth and division to occur in appropriate places in appropriate times, and many cells express different protein products

In prokaryotes we have the promoter and the RNA holoenzyme. In eukaryotes things will get more complicated because

Eukaryotes have silencers, enhancers, more core promoter elements, proximal promoter elements, and the TATA core promoter might not always be present, and there are different and more trans-acting elements

In prokaryotes, DNA is not packaged compactly around histones. How is this a challenge in eukaryotes?

Eukaryotic DNA is packaged tightly around histones, so initiation of transcription of eukaryotic genes requires the chromatin fiber be remodeled so it can be accessed by regulatory proteins

Chromatin assembly factors are specific to eukaryotic cells, why?

Eukaryotic cells contain chromatin, which is DNA complex with histones. Before polymerases can begin synthesis, nucleosomes and hostones must be stripped away or modified to allow the passage of replication proteins. As DNA synthesis proceeds, histones and nonhistone proteins must rapidly reassociate with the newly formed duplexes, reestablishing the charcteristic nucleosome pattern.

In prokaryotes, a search for genes in a DNA sequence involves scanning the DNA for long open reading frames. What problem do you see with this approach in eukaryotes?

Eukaryotic genes have introns. Because they are spliced out of the primary transcript and thus are not included in the mature mRNA, introns do not have to contain ORFs and in fact, introns are almost always stop codons that would halt all possible reading frames. Thus, the reading frame of almost all eukaryotic genes are interrupted by introns that contain stop codons in that frame

Predict what would happen if you swapped the location of the promoter and the operator.

Even in the absence of lactose and binding of the repressor protein to the operator, it would still not block RNAP, since RNAP binds to the promoter. The operon therefore will be expressed constitutively.

Dr. Szyf and Dr. Meaney's experiments with low-licked rats and highly licked rats demonstrated what about a gene involved in stress?

Experience can change the epigenome. Those rats born to nurturing mothers who licked them after birth, would not have as high of a rate of stress hormone production and had higher blood pressure. This is not a genetic cause, but epigenetic cause, because when babies born to low-licking mothers were given to a high-licking mother and vice versa, they responded to stress better. Less nurtured rats had multiple epigenetic markers silencing the gene that lowers the levels of stress hormones in the blood, active in the hippocampus, and with the genes inactive, stress levels in neglected rats soared, and nurtured rats could better handle the stress because they had nothing dimming the gene's activity. This proves that it is not only the genes that the mother gives the offspring, but also the behavior of the mother that has a huge impact on the offspring even after the mother is dead

T/F: A dyad is composed of two homologous chromosomes joined at a common centromere.

False (A dyad is composed of two sister chromatids joined at a common centromere and homologous chromosomes do not share a common centromere.)

Why would you use an expression vector?

Expression vectors are plasmids or phages carrying promoter regions designed to cause expression of inserted DNA sequences and these vectors ensure mRNA expression of a cloned gene with the purpose of producing many copies of the gene's encoded protein in a host cell, and these would be used in research that involve studies of protein structure and function

Why is it necessary to use cDNA when inserting a eukaryotic gene into an expression vector for bacterial transformation, but not when inserting a prokaryotic gene?

Expression vectors must have DNA without introns because the mRNA will actually be translated at high levels to create proteins. Bacteria cannot splice out introns so you must use cDNA of eukaryotic genes such that they only contain exons. Prokaryotic genes never have introns to begin with so this isn't an issue.

T/F: A dsDNA strand 5' ATGCGCGACC 3' would denature at a lower temperature than 5' ATGTATTTTC 3'

False

T/F: All mutations involve the loss of a small amount of DNA

False

T/F: Assume that a species has a diploid chromosome number of 24. The term applied to an individual with 25 chromosomes would be triploid.

False

T/F: Dosage compensation is accomplished in humans by inactivation of the Y chromosome.

False

T/F: Eukaryotes and prokaryotes have operons

False

T/F: In a typical PCR, primers are used to cleave specific regions of the DNA template.

False

T/F: In general, the main goal of cloning is to include as many different genes as possible in a single cloning vector.

False

T/F: In order to create the possibility of generating a trisomy, nondisjunction must occur during meiosis II.

False

T/F: Mitochondrial DNA is similar in all eukaryotes

False

T/F: Partial diploid I+ P+ Oc Z- Y-/Is P- O+ Z+ Y+ will grow if lactose is the only carbon source available

False

T/F: Telomerase is present and active in all eukaryotic cells

False

T/F: The AUG start codon encodes the C terminus of a protein

False

T/F: The PolyA tail on eukaryotic mRNA is encoded by a long string of Ts

False

T/F: The eukaryotic genome is composed primarily of functional genes with little excess DNA.

False

T/F: Trisomy 21 can result from non-disjunction in M1, but not M2.

False

T/F: Viral genomes are always linear, double-stranded DNA.

False

T/F: Haploid cells do not undergo mitosis.

False (Both haploid and diploid cells can undergo mitosis.)

T/F: Females with only one X chromosome do not develop; this condition is lethal.

False (Females with only one X chromosome are viable but have Turner syndrome, which is characterized by underdeveloped ovaries. Males that lack an X chromosome do not develop; this condition is lethal.)

T/F: During a PCR, heat is provided to inactivate the polymerase enzyme.

False (Heat is provided to denature the DNA into single strands)

True or false: The noncoding sequences in between two genes are called introns.

False (Introns are located between exons within a single gene. The noncoding sequences in between two genes are spacer DNA.)

T/F: Okazaki fragments are DNA fragments synthesized on the leading strand.

False (Lagging)

T/F: The thermostability of Taq polymerase is required during the annealing phase of PCR.

False (The annealing phase takes place at the lowest temperature of PCR. Taq polymerase is derived from bacteria that live in hot springs, so the enzyme is thermostable, meaning that its enzymatic properties can withstand the high temperatures needed for denaturation)

T/F: rRNA genes are found within satellite DNA.

False (Satellite DNA is highly repetitive, while rRNA genes are found in middle repetitive DNA)

T/F: All compounds that have been found to be mutagenic in the Ames test are also carcinogenic.

False (The Ames test is used as a preliminary screening tool. Not all compounds that give a positive Ames test are carcinogenic.)

T/F: The second order of chromatin packing occurs when nucleosomes coil together to form a fiber that is 300 nm in diameter.

False (The second order of chromatin packing occurs when nucleosomes coil together to form a solenoid fiber that is 30 nm in diameter.)

T/F: DNA gyrase unwinds the DNA double helix.

False (helicase)

T/F: Anxious mice are likely to lick their young quickly, which will further perpetuate the low expression of the Glucocortisol Receptor.

False (Anxious mice lick slower / less, which means they will have more methylation around their GR gene)

T/F: Skin, neuron, and gut cells all have similar trans acting factors.

False (These cells are not similar and don't make similar proteins, so there should not be similar trans acting factors in their cells)

T/F: Each human contains an identical set of VNTRs.

False (VNTRs are a huge set of genetic variation)

T/F: All genetically modified organisms have DNA from other species

False (arctic apple)

True or False? A partial diploid of genotype Is P+ Oc Z- Y+ / I- P+ O+ Z+ Y- will grow if lactose is the only carbon source available.

False (need to breakdown lactose to grow and need Z and Y to break it down, and Is wil lbind to the other operator since it is not mutated and repress that, so only Y will be made)

T/F: Some, but not all, of the codons code for more than one amino acid.

False (one codon codes for one amino acid, but one amino acid can have multiple codons)

T/F: Transcription in eukaryotes is generally influenced by enhancers, just as in prokaryotes.

False (prokaryotes have no enhancers)

T/F: Only 2 phenotypes exist for any one biological trait

False (skin color)

T/F: A particular enhancer that promotes expression in an eye cell will promote expression in all cells in which that gene is expressed

False (that enhancer will only promote expression in the cells that contain the cis-acting elements that bind to it and recognize it)

T/F: Spineless and Spined Sticklebacks have different pelvis trans acting factors because Pitx is not made in the pelvis region of Spineless sticklebacks

False (the trans acting factors still need to stimulate other pelvis genes, just in the spineless stickleback they do not have an enhancer that the pelvis trans factors can recognize)

T/F: Genes are either on or off.

False (there are different levels of information flow, they can be expressed at high or low levels)

T/F: A 3' poly-A tail and a 5'-cap are common components of prokaryotic RNAs.

False (there is no RNA processing in prokaryotes)

T/F and why: Introns are found only in nuclear genes.

False because some eukaryotic organelles, such as chloroplasts have introns

T/F: Each gene in a given population has only 2 alleles (explain)

False! Each mutation creates a new allele! For one person, they each have 2 alleles for a given gene, but in a population there are a bunch of alleles (blood type has alleles O, AB, B, A)

True/False? Three different mRNAs are made, one for each structural gene in the lac operon

False, a single mRNA is made and simultaneously translated into all 3 gene products

T/F: The data obtained from the Meselson-Stahl experiment after one generation of replication eliminated the dispersive model of DNA replication.

False, because after one generation of replication, all of the DNA was 15/14 in the test tube (The data obtained from the Meselson-Stahl experiment after one generation was consistent with both the semiconservative and the dispersive model of DNA replication. The conservative model of DNA replication was eliminated because it predicted that there would be two bands representing the original DNA at one density and the newly replicated DNA at a different density.)

T/F: TATA box is a cis-acting sequence in prokaryotes.

False, only in eukaryotes

T/F: The promoter is outside of the gene

False, the promoter is in the gene

T/F: The ribosome moves down the mRNA in the 3' to 5' direction.

False, the start codon is at the 5' end (The ribosome moves down the mRNA in the 5' to 3' direction and synthesizes protein in the direction of carboxyl terminus to amino terminus.)

True or False? The length of a species telomeres predicts the lifespan of that species.

False, while telomere shortening has been linked to aging, it is not yet known whether shorter telomeres are just a sign of aging or contribute to it

T/F and WHY: Mitochondrial genes closely resemble eukaryotic nuclear genes

False. Mitochondrial genes do not generally have introns, and there are few if any gene repetitions. They also do not have proteins

True or false (explain): Skin color is a single gene trait

False. The MC1R gene is one of the genes, which codes for a protein involved in the switch from pheomelanin to eumelanin. In higher latitudes with less UV, the selective pressure on MC1R that produced MC1R in our ancient ancestors began to abate and when we look at the early movement out of Africa when that constraint was relaxed, we see lots of variation and in European and Asian populations, geneticists have found lots of variation in MC1R, but less variation in other genes, such as ones associated with lighter skin tones because different environments lead to other genes being selected for.

T/F: Genes are either off or on

False...some can be expressed at high and low levels...enhancers, silencers

A child is born that has the genotype XYY. In which parent did the non-disjunction occur and at which stage?

Father because they got an extra Y in meiosis II because that is when the sister chromatids are supposed to separate, but in this case they ended up together Mom contributed the X, but the father contributed 2 Y chromosomes

How to screen for a gene of interest without using blue/white screening?

First pick colonies, grow each colony in an individual culture, isolate the plasmid DNA, run PCR with primers specific to the GH gene and if the gene of interest isn't present, the primers will not recognize it and PCR will not amplify it, so when a gel is run using the PCR products, we will not see a band

Describe translation

First, an mRNA molecule binds to the small ribosomal subunit. An initiator tRNA carries the amino methionine and its anticodon is UAC, which binds to the start codon AUG. Then, the large ribosomal subunit binds to the small one. One initiation is complete, amino acids are added one by one to the first amino acid. Then, the anticodon of the incoming TRNA with its amino acid, and it pairs with the MRNA codon in the A site of the ribosome. The polypeptide then leaves the TRNA at the P site and attaches to the amino acid on the TRNA A site. The ribosome catalyzes bond formation. The P site TRNA now leaves the ribosome and the ribosome moves the remaining TRNA containing the peptide to the P site, and the process starts over and continues until a stop codon reaches the ribosome's A site and the completed polypeptide is freed and the ribosome splits into its subunits.

List the basic steps to clone GH cDNA into a plasmid and transfer the recombinant plasmid into bacteria and test to see if the bacteria has the plasmid with the gene of interest:

First, take the total mRNA from the human pituitary gland cells and put that with reverse transcriptase and a dT primer, then partially digest with RNase. Then add DNAPI to continue to synthesize the ds-DNA and then add ligase to seal the gaps. Then isolate and amplify the gene using GH gene specific primers and then run a PCR to amplify it (we may need to introduce restriction sites through PCR). Restriction enzymes, which recognize a specific base pair sequence of DNA called a restriction site and cut the DNA within that sequence • Bacterial plasmids (circular, double stranded DNA molecules) are cleaved with the same restriction enzyme that was used to cut the DNA, and the DNA fragments are mixed with the vectors in the presence of DNA ligase. The vector will need to have a selectable marker gene, multiple cloning site, and an origin of replication • The cloning vector is inserted into a host, such as a bacterium, often E. coli by transformation. Transformation can be done by a few ways including: treating bacterial cells with calcium ions and using a brief heat shock to pulse DNA into the bacterial cells, or electroporation, which is using a brief, high-intensity pulse of electricity to move DNA into the bacterial cells, then add DNA ligase to ligate them together to get the recombinant DNA molecule. If we want the protein product expressed, we will need to use an expression vector with a bacterial promoter region. • The bacteria is grown on a plate often containing the antibiotic that the vector will be resistant to, so only the ones that have taken up the plasmid will grow. To make sure that the plasmid didn't re-close without taking up the DNA fragment, we can run a PCR with primers specific to the gene of interest and run a gel or do a blue/white screening

Explain how proteins are made AKA the central dogma of molecular genetics

First, transcription happens, which is when the nucleotide sequence in one strand of DNA is used to construct a complementary RNA sequence, and once this RNA molecule is produced, it moves to the cytoplasm, wheregl mRNA binds to a ribosome. Proteins are synthesized under the direction of mRNA and this is called translation. The genetic code is in the mRNA and is a series of nucleotide triplets called codons and each codon is complementary to the information stored in DNA and specifies the insertion of a specific amino acid into a protein. Protein assembly is accomplished with the aid of adapted molecules called transfer RNA, which recognize the information encoded in the MRNA codons and carry the proper amino acids for construction of the protein during translation

Why are frameshift mutations more detrimental than point mutations?

Frameshift mutations cause more than 1 amino acid to be changed and there are many opportunities for a nonsense triplet to be introduced now that the reading frame has been shifted

What type of enzyme is made with lactose and I+ Oc Z+/F' O+ Z+?

Functional

What type of enzyme is made with lactose and I+ Oc Z+/F' O+?

Functional

What type of enzyme is made with lactose and I+ Oc Z+?

Functional

A tautomeric shift causes G to pair with A. Upon replication, what type of mutation does this lead to - Transition or Transversion? Where the G should have been, what mucleotide has taken its place?

G/C > T/A Transversion. T replaced G

At one point during elongation, the A site has the mRNA sequence CCG. What will the anticodon of the tRNA that binds to this sequence look like? What amino acid will this tRNA carry?

GGC; proline

Why do bacteria need a source of carbon?

GROWTH! LIFE! Energy; ATP Cellular respiration To make building blocks of the cell and to synthesize other molecules (metabolism) Bacterial cell walls are made of carbon.

Is Oc gain or loss of function mutation?

Gain of function because it is always active; These alleles produce more gene activity per allele than the wild-type form and are usually dominant.

Archives from Overkalix, Sweden provided a data set to examine if diet from one generation could affect another decades later. What was found?

Genes are not the only thing that is passed from generation to generation A famine can affect people a century later, even if they had never experienced the famine themselves, and epigenetics is the reason A strong association between the food supply of the father's father and the chance of diabetes being mentioned on the death certificate of the grandson Grandson likely to die of diabetes if the grandfather had plenty of food to eat in late childhood Environmental information imprinted on egg and sperm at the time of their formation Women who experienced famine in the womb had maternal granddaughters that died much earlier

Reflect on how epigenetic changes allow populations to adapt to sudden environmental changes.

Genetic changes take a very long time for natural selection to happen and for populations to be fully adapted to their new environment, but epigenetic changes can happen very fast, for instance just injecting a rat with a chemical that removes methyl tags changes its gene expression. Example: in an unstable environment, anxious rats have the advantage because they are never calm and complacent, and because they are anxious rats, they will not lick their pups as much, and their offspring will also be anxious and well adapted to the environment because their mothers did not lick them to help reorganize chromatin by de-methylating, and this can happen in just a lifetime.

Compare genetic changes vs. epigenetic changes that affect expression of a gene.

Genetic changes: altering the base pair sequence of a gene, its promoter, or its enhancer or silencer, add or take away a gene, add or take away a regulatory region Epigenetic changes: methylate DNA, acetylate histones, remodel chromatin via reorganizing nucleosomes

Write a summary of Griffith's experiment

Griffith's work was a transformation experiment. Transformation is heritable change in a cell or organism brought about by extraneous DNA. If he treated mice with living virulent pneumonia, they died. If he treated mice with living avirulent pneumonia, they lived. If he treated mice with killed virulent pneumonia, the mice lived. If he treated mice with living avirulent and killed virulent pneumonia, the mice died, and after 5 days, he recovered living virulent pneumonia, indicating that a transformation happened (there was an interaction between IIIS and IIR), and that a transforming principle might be a part of the polysaccharide capsule (smooth), or a compound required for capsule synthesis, although the capsule alone didn't cause the mice to develop pneumonia. He said that the transforming principle from the dead IIIS cells served as nutrition for the IIR cells. The new cells and all of their descendants continued to be IIIS cells, so people took note that whatever went into the cells and changed them was probably genetic (which determines what they are like and is passed on from generation to generation), so they now wanted to know what chemical component was responsible for transformation

Phenylalanine hydroxylase (PAH) is an enzyme needed to break down the amino acid phenylalanine. People with loss-of-function mutations in both PAH alleles develop phenylketonuria (PKU), a disease caused by buildup of excess phenylalanine. If left untreated, PKU results in a variety of intellectual and developmental disabilities. People with only one amorphic allele of PAH do not suffer from PKU. Is the wild type PAH gene haplosufficient or haploinsufficient?

Haplosufficient

20 units of a gene's product, the protein fibrinogen, are needed for normal expression (i.e. enough for normal blood clotting). Each wildtype allele (R1) produces 25 units and a mutant allele (R2) produces 0 units. Is the wildtype allele haplosufficient or haploinsufficient and why?

Haplosufficient because just one copy of the wildtype allele will produce the wildtype phenotype because 1 wildtype allele gives you 25 units, and you only need 20 units to get a normal phenotype (25 + 0 > 20)

Which of the following statements concerning heterochromatin is FALSE? Heterochromatin contains relatively few genes. Heterochromatin is found at the telomere and the centromere. Heterochromatin replicates early in S phase. Heterochromatin remains relatively condensed throughout the cell cycle and condenses early in cell division.

Heterochromatin replicates early in S phase. (heterochromatin does contain few genes and heterochromatin replicates later in S phase)

What is the major difference between regions of DNA of a chromosome that are identified as either heterochromatin or euchromatin?

Heterochromatin: prematurely condensed during interphase; genetically inactive because either they lack genes or contain genes that are repressed; replicated later during the S phase than euchromatin does; shows that parts of the eukaryotic chromosome do not always encode proteins, and some parts of the chromosome are involved in the maintenance of the chromosome's structural integrity and chromosome movement during cell division. Sometimes the whole chromosome is heterochromatic Euchromatin: remains uncoiled during interphase

What is a Barr body?

Highly condensed, heterochromatic, inactivated X chromosome in females, providing a mechanism for dosage compensation of genetic information in males and females

A substantial amount of proteins are associated with DNA in eukaryotes. What are these proteins and what are their function?

Histones. They bond electrostatically to to the phosphate groups of nucleotides in DNA. They play an important role in chromatin structure

Anaphase I

Homologous chrmosomes move to the oppisite poles of the cell.

Compare and contrast sister chromatids from homologous chromosomes.

Homologous chromosomes: exist in pairs that are the same length and have the same centromere placement Sister chromatids: share the same centromere; identical copies formed by the replication of a single chromosome

Result of nondisjunction in meiosis I (what types of chromosomes are together in gametes?)

Homologs end up together in the gametes (heterozygous duplicate)

A group of scientists are studying how alcohol consumption affects epigenetics. In their study, they compare expression levels of gene F in heavy drinkers to that of their identical twins who rarely drink alcohol. Why might the scientists choose identical twins for their studies?

Identical twins have the same genome (except for a few mutations that they may have acquired throughout their lifetimes). This adds an additional layer of control. Major differences in gene expression cannot be attributed to variations in the genome, but maybe the differences are due to epigenetic differences, which can be influence by environmental factors, such as drinking

A pregnant woman and her husband are concerned about the possibility that their unborn child could have a genetic disorder. They decide to have amniocentesis and karyotyping performed to look for chromosomal abnormalities. It turns out that the child has 47 chromosomes: 22 normal autosomal pairs plus one X chromosome and two Y chromosomes. Did the nondisjunction event occur during meiosis I or meiosis II? Explain your reasoning.

If nondisjunction occurred during meiosis I, the father would give an XY gamete or a gamete with no sex chromosome at all, which is not what happened. Instead, the nondisjunction must have happened in meiosis II, where the two sister chromatids of the Y chromosome could fail to separate, giving a YY gamete.

If a person had a single nucleotide substitution in the DNA leading to a single amino acid change, where would it be most detrimental to function of LEP-R? Why?

If the point mutation comes earlier in the protein coding region of the gene (like sequence B), you will just have a few amino acids and shorten the protein. If the mutation made it so the protein doesn't dimerize o So the two proteins cannot interact, because if they cannot dimerize, they won't be able to bind leptin If there is a mutation so it cannot bind leptin, so you won't have appetite suppression If there was a mutation in the membrane If there is a mutation in the C-terminus so the receptor cannot interact with Jak2

What is the benefit of having the G next to a C? Why not have CpC islands?

If there was no C, the methylation will disappear in one of the daughter strands after replication

How can a karyotype be used to diagnose a genetic disorder?

If they have an extra or missing chromosome, this can be seen from a karyotype and we get one chromosome from mom and one chromosome from dad, so we are supposed to have 23 pairs of chromosomes.

Why are loss of function mutations typically recessive?

If you have just one copy of the wildtype allele, you can produce some protein, and if you can produce enough protein and you will not have a mutant phenotype

Why are DNA primers used for PCR rather than RNA primers?

If you used RNA primers, you would have to remove them after replication. This would lead to a shortening of the fragments (similar to what happens at the end of telomeres - but there's no telomerase equivalent in PCR to fix this!). Using DNA primers eliminates this problem since they don't have to be removed and instead stay as part of the duplicated fragments.

How is translation different in prokaryotes and eukaryotes?

In prokaryotes, translation is happening at the same time and same place as transcription In eukaryotes, transcription and translation are statically separated. There are larger ribosomes, the rRNA and proteins are more complex. The 5' cap is essential for initiation of translation. Eukaryotic mRNA lasts longer, and some proteins are made on ribosomes on the rough ER.

Regulatory Region

In prokaryotic and eukaryotic DNA; information on where and when a gene will be transcribed during development; usually upstream (before) of the coding region (gene)

Is the lacI-allele dominant or recessive to the I+ allele and how do you know?

In the partial diploids, when you have I+/I- the phenotype is wildtype because repressors, in this case I, are trans acting and can act on either of the operators and you need 2 copies of I- to see the constitutive phenotype; it is a loss of function allele, which are typically recessive

When histones are acetylated, does transcription increase or decrease? Why?

Increases, because when histones are acetylated, the attraction between the histone protein and the acidic DNA is lessened, making promoter regions available for binding of transcription factors that initiate the chain of events leading to gene transcription. Mechanism of the regulation of gene expression at the level of chromatin remodeling

I+ O+Z+ Y+/ I- O+Z+ Y+ With and without lactose and the effect on both Y and Z.

Inducible

What is the phenotype of the merozygote I-O+Z+Y+/I+O+Z+Y+?

Inducible (I is trans-acting and I+ can regulate the expression of both Zs and both Ys by binding to both operators. I+ is dominant to I-)

I+ O+ Z+ Y+/F' O+ Z- Y+ Phenotypes of Y and Z and the conclusion that can be drawn

Inducible Therefore, Z+ must be dominant to Z-, because only 1 copy of Z+ is needed to see the wild type (inducible) phenotype

I- O+Z+ Y+/ I+ O+Z- Y- With and without lactose and the effect on both Y and Z.

Inducible only the left chromosome because the repressor from the right chromosome is trans-acting...no Z and Y on the right chromosome

How will you achieve your goal of genetically modifying a bean plant? Outline a protocol

Isolate the DNA from the natural occurring resistant plant Amplify the gene that confers drought resistance (PCR) Digest the naturally occurring drought resistant gene (PCR product) and digest the Ti plasmid Create recombinant DNA molecule (ligate 2 parts together) Transform the Agrobacteria with the Ti plasmid Select for transformed Agrobacteria with ampicillin on the plate Isolate the DNA from bacterial colonies that were transformed Confirm the presence of the gene that confers drought tolerance in transformed bacterial colonies Transform bean plant Select for transformed bean plants with herbicide We can do PCR to amplify the drought tolerance gene from these plants to make sure they have the gene integrated into their genome

Why isn't RNAP a trans-acting factor?

It acts in trans, but it is not a trans acting factor because it is the same for all genes and doesn't regulate them differently

How may a tautomeric shift lead to a mutation?

It allows hydrogen bonding of normally noncomplementary bases.

What is the function of aminoacyl tRNA synthetase?

It attaches a specific amino acid to a tRNA molecule. Aminoacyl tRNA synthetase catalyzes the charging reaction that links a specific amino acid to a tRNA molecule.

What does the enzyme ß-galactosidase do?

It converts the disaccharide lactose into galactose and glucose

What is the role of glucose in catabolite repression?

It decreases the levels of cAMP in the cell, repressing transcription from the lac operon.

What happens to the sigma unit during the elongation phase?

It dissociates from the holoenzyme and elongation proceeds under the direction of the core enzyme

What does catabolite-activating protein (CAP) do?

It helps activate expression of the lac operon by recruiting RNA polymerase, but also inhibit expression when glucose is present by not recruiting polymerase

What does Xist RNA do to the chromosome it is expressed from?

It inactivates one of the X chromosomes because the RNA is large and doesn't encode a protein, and the RNA spreads over and coats the X chromosome bearing the gene that produced it (the XIST gene) and this Xist RNA is essentially a signal to recruit proteins that modify the histones and get the histones to come really close together and get the chromatin to wrap really tightly and inactivate this chromosome

What does the SWI/SNF complex do to DNA?

It is a mechanism of gene expression at the level of chromatin alteration which helps reposition or remove nucleosomes on DNA, because repositioned nucleosomes make regions of the chromosome accessible to transcription regulatory proteins, such as activators and RNAPII. The SWI/SNF remodeling complex may loosen the attachment between histones and DNA causing the nucleosome to slide along the DNA and expose regulatory regions, or it may loosen the DNA strand from the nucleosome core, or it may cause reorganization of the internal nucleosome components, and all of these leave DNA exposed; allows cis-acting elements to be accessed by transcription factors

Is the lacIs mutation dominant or recessive to the lacI+ mutation?

It is dominant. If the super-repressor is permanently bound, the presence of wild type repressors will not restore inducibility.

In eukaryotes, how is the 5' cap on the mRNA related to translation?

It is essential for efficient initiation in translation and it transports the mature mRNA from the nucleus into the cytoplasm so that it can get translated

What appears to be the function of the poly A tail for transcripts?

It prevents it from degradation

What was the Lyon hypothesis?

It says that inactivation of the X chromosome occurs randomly in somatic cells at a point early in embryonic development, and once inactivation occurs, all descendant cells have the same X chromosome inactivated

What would happen if an I+ gene was introduced into an I- cell via an F plasmid?

It should restore inducibility because the normal wildtype repressor protein, a trans-acting factor would be produced by the I+ gene because it is a diffusible product

The Hershey and Chase experiments involved the preparation of two different types of radioactively labeled phage. Why were two preparations were required?

It was necessary that each of the two phage components, DNA and protein, be identifiable upon recovery at the end of the experiment. Because it was concluded that the component associated with bacteria at the end of the experiment must be the genetic material, it was critical that the component be identifiable as either DNA or protein.

Consider a nematode mutant, in which capping and polyadenylation take place normally, but splicing is compromised. What might be the consequence of such a mutation on the protein?

It will be too long and because many introns contain stop codons, the protein would be nonfunctional because it was prematurely truncated and even if it wasn't prematurely truncated, it would be nonfunctional

Consider the non-template strand of a gene with the nucleotide sequence shown below. If a single base pair substitution occurs in this gene changing the G at position 14 to an A, what effect will this mutation have on the polypeptide produced from this gene? 5'-ATGATACATGTCCGCATGGGGA-3'.

It would change amino acid Arg to His

Julie and Jerry are discussing why Is Oc Z+ Y+ bacteria constitutively transcribe lacZ and lacY even though there is a super-repressor allele present. Julie thinks that it is because lacOc is dominant to lacIs. Do you agree with Julie? Why or why not?

Julie is incorrect in saying that lacOC is dominant to lacIS because they are alleles of two different genes. Dominance is used to describe the relationships that exist between alleles of the same gene, not of different genes. Rather, this is an example of multiple-gene interaction. The super-repressor can only repress transcription if it can bind to the operator. The lacOc mutation prevents this because the operator sequence is mutated

How do the different HOX genes get made in specific parts of the body?

Just like how all other genes are made; promoters of HOX genes specify expression in body regions because the transcription factors that bind to HOX enhancers and promoters are differentially available in different parts of the body. So the HOX gene that encodes TFs that promote the making of a head are made in the head region early in development

What types of epigenetic tags would you expect to see on euchromatin?

Low methylation, high acetylation

Does lactose positively or negatively regulate the operon?

Lactose plays an indirect role in the regulation of the Lac operon. Lactose itself does not encourage transcription. Instead, it prevents negative regulation by the repressor. The repressor is the key molecule that influences transcription, not lactose!

Scientists like to make analogies with what the epigenome is like. What were some used in the video?

Light switch that can switch the gene on or off and as the cell divide, the memory is brought about by these "switches" Epigenome determines how the book of life (sequence of bases) gets read

20 units of a gene's product, the protein fibrinogen, are needed for normal expression (i.e. enough for normal blood clotting). Each wildtype allele (R1) produces 25 units and a mutant allele (R2) produces 0 units. Is the R2 allele loss or gain of function and why?

Loss of function because it doesn't have any function...it doesn't produce and units of the protein

What differences would you expect between males and females in terms of the severity of x-linked disorders?

Males would be more likely to have or lack the disorder completely since they cannot inactivate an X, while females could only have it to a partial degree

What is the leading hypothesis as to why there is a correlation with maternal age and Down Syndrome?

Meiosis is initiated in all eggs of a human female when she is still a fetus, until the point where the homologs synapse and recombination begins. When ovulation begins, meiosis is reinitiated in one egg during each ovulatory cycle and continues into meiosis II. The process is once again arrested until the egg is fertilized, leading to each ovum being arrested for a month longer than the previous one, and older women produce older ova that have been arrested longer

Explain two ways that meiosis produces variation in gametes?

Meiosis produces many unique combinations of maternally and paternally derived chromosomes by the random orientation of homologous pairs at metaphase I, because each pair can orient with either its maternal or paternal homolog closer to a given pole and as a result ,each pair sorts into daughter cells independently (independent assortment) and by crossing over, which results in genetic exchange between members of each homologous pair of chromosomes prior to one or the other finding its way into a haploid gamete

Experiment: we swapped the entire promoter and cis regulatory elements between the surfactant and the melanin genes. Melanin normally expressed in skin and not lung cells; surfactant normally expressed in lung cells and not in skin cells. If these two hybrid genes are added to a lung cell, which gene will be transcribed? Why? (Any proteins normally present in a lung cell, such as transcription factors have not been affected.)

Melanin, because if we swap the cis-regulatory elements, the surfactant cis regulatory elements will now be on the melanin gene, and in the lung, the lung only has transcription factors that recognize and can bind to the surfactant cis-regulatory elements

Gene silencing can occur in at least two ways (as described in this video). What ways?

Methyl molecules attach to genes directly Other "tags" grab histones tightening or loosening them turning to turn genes on or off by altering chromatin They essentially hide the gene from the cell so it cannot be utilized Control gene expression through the epigenome

Explain how this student's reasoning is flawed: Similar to how methylation prevents transcription, it also inhibits DNA replication, so methylation must be removed before DNA can replicate. Therefore, methylation is not inherited. Additionally, since our offspring can be made from egg and sperm cells, their methylation pattern must also change, so this is more evidence of methylation being uninheritable.

Methylation is inheritable through cell lines of a specific tissue. Methylation allows a cell to restrict expression of specific genes, which gives the cell an identity as a skin, liver, or hair cell. Additionally, CpG islands are what allows methylation to be inherited, as the C on opposite strands will be methylated after DNA replication by methyltransferase. It is true that methylation gets (almost completely) 'reset' when reproducing, but some patterns can still be inherited - think GR gene in mice.

Romano-Ward syndrome is an autosomal dominant disease that disrupts normal heart rhythms. The gene responsible for this syndrome is on chromosome 21. Mom has this syndrome and Dad does not. They have a son who has Down Syndrome but does not have Romano-Ward syndrome. In what parent and where could this nondisjunction have occurred?

Mom in meiosis II, dad in meiosis I, dad during meiosis II

A phenotypically normal man and a phenotypically normal female have a son with Kleinfelter and muscular dystrophy (x-linked recessive). In which parent and which stage does the nondisjunction occur?

Mom; meiosis II

When a mismatch is detected, such as in the sequence below: 5' GCTG 3' 3' CAAC 5' A mismatch is seen (C-A) but which strand is the correct one? How does a cell know which strand needs to be fixed?

Mismatch repair; the incorrect nucleotide is removed and the correct nucleotide is put in its place. The strands need to be "discriminated" against so the incorrect one is known, and to do this, adenine methylase adds a methyl group to each of the adenine residues during DNA replication, but following replication, the newly synthesized DNA methylase lags behind the DNA polymerase, and so prior to methylation the repair enzyme recognizes the mismatch and binds to the unmethylated DNA strand. An endonuclease creates a nick in the backbone of the unmethylated DNA strand and the exonuclease unwinds and degrades the nicked DNA until the region of mismatch is reached. Then DNA polymerase fills in this gap using the correct strand of DNA as a template.

Describe the basic steps of translation and the molecules involved.

Molecules involved: mRNA, tRNA, ribosome, acetyl amino tRNA synthetase, amino acids Before translation can occur, aminoacetyl tRNA synthetase charges tRNA molecules with their respective amino acids at the 3' end through a covalent bond and this is highly specific to both the tRNA and the amino acid. Initiation: the first the mRNA and the ribosomal small unit come together to form a complex, and then the first TRNA carrying the amino acid, Methionine, which corresponds to the start codon and that goes into the P site. Then the large ribosomal subunit comes. Then elongation occurs, where the ribosome moves down the mRNA from the 5' end to the 3' end synthesizing the polypeptide chain. Then, the next charged tRNA comes, entering the A site and and once the next TRNA is in the A site, the large ribosomal subunit's rRNA catalyzes the formation of a peptide bond between the two amino acids. at the same time, the covalent bond between the tRNA and the amino acid is broken. The tRNA occupying the P site is now uncharged and it moves to the E site of the ribosome. And then the mRNA-tRNA-AA1-AA2 complex moves from the P site into the A site by a distance of 3 nucleotides. These events are repeated over and over. The last phase is termination where when a stop codon enters the A site, they do not specify for an amino acid or a tRNA, but they do signal for release factors, which cleave the polypeptide chain from the terminal tRNA, and the ribosome dissociates into its subunits.

What are the consequences on the protein if there is a nucleotide insertion or deletion in the DNA?

More disastrous than substitutions. The new polypeptide formed is likely nonfunctional.

Monocistronic mRNA

Most eukaryotic mRNA; it contains the genetic information to translate only a single protein chain (polypeptide). Once the mRNA is processed and spliced, the mRNA gives rise to a single protein upon translation

Why would an anti-telomerase drug be useful in treating cancer?

Most of the human cancer cells contain telomerase to maintain their telomeres and achieve immortality. Anti-telomerase might destroy cancer cells by allowing telomeres to shorten.

What is a palindrome?

Most restriction sites have this, and it is a form of symmetry, and the nucleotide sequence reads the same on both strands of DNA when it is read 5' to 3'

Mother: Aa Father: AA Child: Aaa

Mother, anaphase meiosis II

What is the "mutagenic" method and how does it differ from GM technology?

Mutagenic techniques result in large swaths of genes being swapped or altered, but the GM technique enables scientists to insert a single gene from one organism's gene into a completely different organism, and GM technology is much more precise, so there are not surprises and if in the highly unlikely case that an unexpected health threat emerged from a new GM plant, scientists would quickly identify and eliminate it. "We know where the gene goes and can measure the activity of every single gene around it,"

Give two examples that illustrate that DNA polymerase is a less than perfect enzyme

Mutations can occur where an incorrect nucleotide gets placed. For example, there is also a mutation when there are many repeats (specifically CAG), polymerase can slip off of the strand of DNA, causing the DNA to complementary base pair to itself, and when polymerase gets back on the DNA, it resynthesizes nucleotides that it has already laid down, increasing the number of CAG repeats, which cause Huntington's disease The shortening of the lagging strand because DNA polymerase needs a 3'-OH in order to synthesize off of (it cannot lay down new nucleotides de novo), and so when the last primer is removed on the lagging strand, because polymerase has to synthesize in the 5'-3' direction, there is nothing for it to synthesize off of, and so each time the cell replicates its DNA, the segment gets shorter by a length of a primer

What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

Mutations in trans-acting elements will affect the expression of all genes whose transcription is regulated by the trans-acting element. Mutations is cis-acting elements will affect only the protein encoded by the gene where the cis-acting element is located.

Do initiation of transcription and initiation of translation start from the same site? Explain

NO! Transcription initiation site (+1) is NOT the translation initiation site (AUG).

Explain one negative control be for a transformation experiment where you make bacteria synthesize human insulin. Now tell me a positive control.

Negative control: no expected response Positive control: expected response Ensure that no bacteria grow if not transformed. Plate untransformed bacteria on a plate that has the antibiotic. If any untransformed bacteria can grow on the plate, something is wrong, since only your transformed bacteria should have resistance through your plasmid and selectable marker. Test growth of bacteria on non-antibiotic media. If no bacterial cells grow under these conditions, we know that something was wrong with the bacterial strain we used. Since all bacterial cells are capable of growing under these conditions, a lawn is formed instead of individual colonies. This control is known as a positive control with respect to bacterial growth because it is a test in which the affected result can be predicted. We expect the bacteria to grow on a regular agar plate.

Do prokaryotes have chromatin remodeling?

No

Do prokaryotes have enhancers?

No

Do prokaryotes have epigenetic markers, such as methyl groups?

No

Do prokaryotes have higher order transcriptional complexes?

No

Do prokaryotes have silencers?

No

If all the other alleles are normal, what is the affect on the operon with these two alleles: I-/I+ And what is the type of transcription?

No affect because I+ is dominant. The cell can still digest and use lactose Inducible

Can O+ rescue an Oc in a partial diploid?

No because O+ is a regulatory cis element and is not diffusible

If all the other alleles are normal, what is the affect on the operon with these two alleles: Z-/Z- And what is the type of transcription?

No beta-galactosidase, so it cannot digest and use lactose for energy, because it cannot break it down Noninducible

If all the other alleles are normal, what is the affect on the operon with these two alleles: Y-/Y+ And what is the type of transcription?

No change because Y+ is dominant. It can still let lactose in so it can be digested and used for energy Inducible

If all the other alleles are normal, what is the affect on the operon with these two alleles: Z-/Z+ And what is the type of transcription?

No change because Z+ is dominant. It can still breakdown lactose and digest and use it Inducible

Predict what the scientists find when they compare PitX DNA coding sequences between marine (with spine) and freshwater (without spine) sticklebacks:

No difference in the coding region between the marine and freshwater fish because the structure and function of the gene is the same in every tissue between the fish, except the pelvic region

If all the other alleles are normal, what is the affect on the operon with these two alleles: Y-/Y- And what is the type of transcription?

No permease, so it cannot let lactose in to the bacterial cell, so it cannot digest and use lactose Noninducible

Johnny is studying the gene that codes for amylase, an enzyme that is found in saliva. He is curious about what happens if he moves certain cis elements of the gene. Predict the transcriptional outcome of the following manipulation: He moves the promoter from the 5' end of the gene to the 3' end

No transcription because the promoter signals the direction of RNAP and the start of the gene

Once we have the gene cloned from PCR, are we ready to put it into bacteria? Can we just introduce the gene all alone into the bacteria?

No! We have to put it into a plasmid. When the bacteria replicate linear DNA, it will just be lost, so we have to put it in a cloning vector. Also we want the cloning vector, becasue it contains a selection marker and we want a way to test to see if the bacteria took up the plasmid

A hypothetical bacterial strain has a mutated version of the sigma subunit. The mutated subunit can bind to the RNA polymerase core enzyme, but it cannot bind to the DNA. Would such a strain be able to transcribe RNA? Explain.

No, because if it cannot bind to DNA, it cannot bind to the promoter, which is essential. It also cannot unwind the double helix

Do we get tetrads in mitosis?

No, because tetrads are homologous chromosomes with their sister chromatids, and homologs do not synapse in mitosis

In prokaryotes, translation can occur while transcription is still completing. True in eukayotes? Explain

No, because transcription occurs in the nucleus, while translation occurs in the cytoplasm and the RNA transcript is not free to associate with ribosomes until transcription is over

Do eukaryotes have operons?

No, each gene is regulated by its own promoter

Do all core promoters contain the same elements? Explain.

No, no one element of the core promoter is universal. Any given core promoter may contain one or several of the elements and each element binds different, specific regulatory factors

Do all eukaryotic cells express/produce telomerase?

No, only cells that undergo extensive proliferation, such as embryonic cells, germ line cells, and stem cells

Is bacterial DNA compacted tightly around histones, like in eukaryotic cells?

No, they are associated with DNA-binding proteins such as HU and H1 proteins, but do not compact DNA to the extent that histones do because the bacterial chromosome is not inert and can be readily transcribed and replicated

Are ribosomes specific to codons or amino acids?

No, they are nonspecific workbenches for the translation process

Are homologous chromosomes identical to one another?

No, they are similar in that they contain the same genes in the same order, but the alleles for each trait may not be the same. One come from the egg and one comes from the sperm

Do all cells have the same set of transcription factors expressed?

No, transcription factors are tissue-specific Help regulate gene expression at the level of transcription

Do all promoters contain the same cis-elements? Explain.

No, we find certain elements such as the TATA box, CAAT box, etc. in a lot of gene promoters, but not all of them, but we don't have to have the same core elements in all promoters Different genes have different core promoter elements

Microbiologists describe the processes of transcription and translation as "coupled" in bacteria. This term indicates that a bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. Is coupling of transcription and translation possible in single-celled eukaryotes such as yeast? Why or why not?

No. Transcription and post-transcriptional modifications occur in the nucleus where there are no ribosomes. Only processed, mature mRNAs leave the nucleus to be translated because the 5' cap helps the mature mRNA leave the nucleus

Is Oc Z- Y-/I+ O+ Z+ Y+ What will happen?

Non-inducible because Is is a trans action mutation

What is nondisjunction?

Nondisjunction is when homologs fail to disjoin during segregation, leading to a gain or a loss of a chromosome.

A pregnant woman and her husband are concerned about the possibility that their unborn child could have a genetic disorder. They decide to have amniocentesis and karyotyping performed to look for chromosomal abnormalities. It turns out that the child has 47 chromosomes: 22 normal autosomal pairs plus one X chromosome and two Y chromosomes. This chromosomal abnormality resulted from a nondisjunction event during meiosis. Did the nondisjunction occur in the father or in the mother? Explain.

Nondisjunction occurred in the father. Mom had only X chromosomes to give, so no matter what, she could never have given a Y. Both Y chromosomes must have come from the father.

Johnny is studying the gene that codes for amylase, an enzyme that is found in saliva. He is curious about what happens if he moves certain cis elements of the gene. Predict the transcriptional outcome of the following manipulation: He moves the enhancer from the 5' end of the gene to the 3' end

Normal transcription

If being dark-skinned offers an advantage, why aren't all humans dark-skinned?

Not all UV light is bad, UVB is essential for getting Vitamin D. When all of our ancestors lived near the equator, there was no problem getting enough UVB through the sunlight through the dark skin, but when some populations started moving north where the UV is much weaker, and in northern latitudes, dark skin makes it hard to produce the vitamin D that humans need

What would be the phenotype if someone had two copies of an allele in which Jak2 could not bind to the C-terminus of the protein?

Obesity because if Jak2 cannot bind, the signal for appetite suppression will not go through. Even if you had a fully functioning leptin receptor, if Jak2 cannot bind, there will be no appetite suppression

What would be the phenotype if someone had two copies of an allele in which leptin could not bind? For example, if a mutation results in leptin not being able to bind

Obesity because if they cannot bind leptin, the binding of leptin is important for the interaction with Jak2 and Jak2 is important for appetite suppression.

A 1.5‑kb fragment of DNA is cloned into a plasmid vector that is 5.5 kb long at the EcoRI site, and the plasmid vector is then used to transform bacteria. If the plasmid DNA is then extracted from a single bacterial colony and digested with EcoRI, what digestion products will be produced if the plasmid contains the fragment?

One 1.5‑kb fragment and one 5.5‑kb fragment (EcoRI digestion will produce two fragments corresponding in size to the 1.5‑kb fragment cloned into the plasmid plus the 5.5‑kb plasmid itself.)

Where in the organism is a certain protein expressed? How can we figure this out?

One genetic approach is to remove the gene and see what happens. The phenotype will tell us something, but we will learn a lot more if we use promoter swapping o We can learn things like when the gene functions in development

Explain how female mammals can be mosaics and the consequence of this for X-linked disease alleles.

One problem with X-inactivation is that mammalian females that are heterozygous for X-linked alleles have some parts of the body that express only the maternally derived alleles and others express only the paternally derived alleles. An example of this is colorblindness, because in humans, hemizygous males are fully colorblind in all retinal cells, but females have mosaic retinas, with patches of defective color vision and surrounding areas with normal color perception. Random inactivation of one or the other X chromosome early in development led to these phenotypes

Avery, MacLead, and McCarty changed their experiment to be more ethical and increase the number of mice that survived in each experiment. How could they have done this and still came to the same conclusion? Recall they tested DNA, RNA, lipids & polysaccharides, and proteins. What would be the control in your experiment? Is this negative or positive? Make sure to define the response of your experiment.

Only add one function cellular component at a time (all degrading enzymes-1 each time). Response is death. Negative control - living mouse from injecting saline solution. Positive control - add all cellular components (expect death).

You are studying a gene called pax-6. Mice without pax-6 do not develop eyes or have severely underdeveloped eyes. You suspect that pax-6 is transcribed under the control of a tissue-specific promoter. To test this, you fuse the coding region of the gene for GFP (green fluorescent protein) to the pax-6 promoter. Then, you insert the gene into a wild-type mouse embryo early on in development. What result would you expect to get if your hypothesis is true?

Only the mouse's eyes will glow green because eye cells only have the correct transcription factors to transcribe genes that are under control of the pax-6 promoter.

What do we need to make synthetic GH gene?

PCR gene of interest (GH) Plasmid Bacteria Restriction Enzymes to cut gene / plasmid DNA ligase

Why is PCR the preferred method for obtaining the gene to make a recombinant DNA molecule?

PCR gives us a lot of copies of the gene, restriction enzymes just cut it out and give just one copy of the gene and working in the lab, you do not just want one copy because if the experiment doesn't go as planned, you will lose your one copy; it can also be used to add restriction sites if the gene doesn't have them

Explain the functional significance of packaging DNA into chromosomes.

Packing DNA into chromosomes allows there to be a 500:1 ratio of DNA to the mitotic chromosome and the structure of the genome influences the expression of genes without changing the actual DNA sequence

Metaphase I

Pairs of homologous chromosomes move to the equator of the cell.

How can individual SNPs or haplotypes help us identify how people will respond to drugs?

Physicians can see the response in people with different SNP profiles and see how they respond to the drug and predict whether the patient will respond to the drug and this is a much better alternative to the trial and error method that physicians use currently.

In a population of rats, 95% have pink tongues and 5% have black tongues. 20% are heterozygous for the tongue color allele. Which is wildtype and which is recessive and which is dominant?

Pink is WT and dominant Black is recessive

What is different about transcription in prokaryotes and eukaryotes?

Prokaryotes have a sigma subunit that binds directly to the -10 promoter region of the gene. Transcription occurs in the cytoplasm simultaneously with translation. Eukaryotes have 3 different types of polymerases, transcription initiation requires chromatin remodeling, transcription occurs in the nucleus, RNA processing is required, more trans-factors are required to recruit polymerase, many more cis-factors and more trans-factors in general because there are more cis-factors

5'UAAUCCCACAGCCGCCAGUUCCGCUGGCGGCCAUUUUUUUU 3' What is this?

Prokaryotic termination sequence used to create the hairpin loop

What 2 stages does variation occur in meiosis?

Prophase I and Metaphase I

What is the difference between a purine and a pyrimidine? Which bases are classified under each?

Purine: 9-sided double ring and it is adenine and guanine. Pyrimidine: 6-sided single ring and it is cytosine, thymine, and uracil

Dr. Hogan called Dr. Steinwand and said, "Do you have time for coffee?" Dr. Steinwand said, sure, I am just setting up a digest and then have to wait. What was Dr. Steinwand doing?

Put restriction enzymes in with her DNA, and now she just has to wait for the restriction enzymes to recognize specific sequences and cut them at that site

What are primers made out of in vivo?

RNA

Reverse transcriptase

RNA dependent DNA polymerase; An enzyme derived from a retrovirus, which uses single-stranded RNA as a template for the production of double-stranded DNA; important because genomic eukaryotic DNA cannot just be inserted into the bacteria to produce the desired protein because eukaryotic DNA contains intron sequences, and prokaryotes do not have the enzymes necessary to splice out the introns to get the desired protein product

List three main differences between DNA and RNA.

RNA often occurs as both single- and partially double-stranded forms, whereas DNA most often occurs in a double- stranded form. Ribose in RNA replaces deoxyribose in DNA. Uracil in RNA replaces thymine in DNA. RNA can sometimes fold back on itself to form double stranded regions of complementary base pairs

The promoter is bound by which enzyme?

RNA polymerase

Explain how the hairpin loop in mRNA terminates transcription

RNA polymerase codes for a sequence in RNA that induces production of a RNA hairpin loop and there is complementary base pair within one single strand When this occurs, at the end of a transcript there is a sequence that will form this hairpin loop and at the end of the hairpin there are As and Us and there are 2 hydrogen bonds between them and there are Gs and Cs in the hairpin loop which have 3 hydrogen bonds between them and these are stronger and the hairpin loop gets held together, whereas between the As and Ts it is much weaker and so RNA polymerase stalls when the structures are formed and when the stalling happens, the weak AU bonds don't hold mRNA and DNA together and mRNA is released and polymerase is dissociated

Describe template binding in transcription in prokaryotes

RNA polymerase's sigma subunit recognizes a specific sequence called the promoter that is upstream from the point of initial transcription ; the enzyme "explores" a length of the DNA until it reaches the promoter region and binds to the -10 site and once it binds, the helix is unwound, making the DNA template accessible to the action of the enzyme

RNA primers are formed by __________ and serve as an initiation point for DNA synthesis on the template

RNA primase

The addition of a 5' cap and poly-A tail, and removal of introns are all steps in

RNA processing and transport

20 units of a gene's product, the protein fibrinogen, are needed for normal expression (i.e. enough for normal blood clotting). Each wildtype allele (R1) produces 25 units and a mutant allele (R2) produces 0 units. Is the R2 allele dominant or recessive and why?

Recessive because you need two copies to produce a mutant phenotype and because a heterozygote will have a wildtype phenotype

If methyl groups are removed from genomes of anxious rats with a chemical, why are they becoming calm?

Removing methyl tags allows the DNA to be more exposed to transcription factors because the chromatin opens up, so there is more expression of the GR gene and thus more GR protein, and more cortisol can bind to the GR protein receptor because there are more receptors, and it is easier to respond to stress.

Silencers do what?

Repress transcription initiation; act in tissue or temporal-specific ways to control gene expression Help regulate gene expression at the level of transcription

What trans-acting element binds the operator in the lac operon?

Repressor protein encoded by lac I

What is rRNA, mRNA, and tRNA? Which are non-coding "functional" RNAs that do not have instructions to make proteins?

Ribosomal RNA are important structural components of ribosomes, messenger RNA carries genetic material from the DNA of the gene to the ribosome, and transfer RNA carries amino acids to the ribosome during translation. All of these are functional, except mRNA

What is recombinant DNA technology and how is it direct evidence that DNA is the genetic material?

Segments of eukaryotic DNA corresponding to specific genes are isolated and spliced into bacterial DNA, and this is inserted into a bacterial cell and its gene expression is monitored. If a eukaryotic gene is introduced, the presence of the corresponding eukaryotic protein demonstrates that DNA from eukaryotes is functional in bacterial cells.

Explain the difference between selective breeding and genetically modified organisms

Selective breeding doesn't create transgenic organisms, with characteristics that cannot be obtained using traditional breeding. GMOs contain genes from other species

Your friend wants to do research on how histones interact with DNA and is trying to decide which model organism to use for her studies. She wants something that is small, easy to take care of, and replicates quickly, so she has narrowed her choices down to Escherichia coli, a bacterium, and Saccharomyces cerevisiae, a yeast. Which would you recommend that she use and why?

She should use S. cerevisiae. Since she is studying histones, she needs to use a eukaryotic model organism. Bacteria are prokaryotes and do not have histones. Yeasts are eukaryotic and therefore they do have histones.

VNTRs

Short, repeated DNA sequences present as tandem repeats between 2 restriction enzyme sites.

The effect on a protein's size when a nonsense mutation is introduced in exon 1.

Shorter (a stop codon is made by a single nucleotide change).

Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell? What about a cis-acting element? Why?

Since trans-acting elements are gene products that diffuse freely through the area where regulation is taking place, recessive defects in trans-acting elements can be repaired by introducing another copy of the gene encoding the element into the cell. Since cis-acting elements are sequences of DNA, defects in cis-acting elements cannot be repaired by simply introducing another copy of the element into the cell (e.g. RNA polymerase binds the promoter and begins transcription only of physically connected DNA). Depending on the trait imparted by the defect, sometimes the defect in a cis-acting element can be repaired by introducing an entire copy of a gene into the cell (e.g. functional promoter in front of a functional copy of the coding sequence would restore the cell to wild-type trait, but a functional copy of a gene would not restore a cell where the defect was in the operator—the copy with the "broken" operator will keep being transcribed regardless of the presence of a wild-type copy.).

Estrogen converts the estrogen receptor protein from an inactive molecule to an active TF. The ER binds to cis-acting sites that act as enhancers, located near the promoters of genes. In some tissues, the presence of estrogen appears to activate transcription of ER-target genes, whereas in other tissues, it appears to repress transcription of those same genes. How?

Some trans-acting factors, when bound to enhancers, interact with coactivators to enhance transcription to form an enhanceosome that stimulates transcription initiation. Transcription can be repressed when certain proteins bind silencer DNA elements and generate repressive chromatin structures. The same molecule may bind to different chromosomal regulatory sites (silencer or enhance) depending on the molecular environment of a given tissue type

What is a trinucleotide repeat sequence and what consequence might it have if in the coding region of a gene, as is seen with Huntington's disease?

Specific short sequences that are repeated many times. When these repeats happen, it can cause proteins to aggregate abnormally. The repeated sequences in DNA may become methylated, leading to the silencing of gene transcription. When these repeats occur outside of the coding region, but still within the mRNA, it is thought that these mRNAs may bind to important regulatory proteins, sequestering them away from their normal cell functions.

What are spindle fibers made of and what is their function in the cell during mitosis and meiosis?

Spindle fibers are made of microtubules consisting of polymers of polypeptide subunits of the protein tubulin and they play an important role in the movement of the chromosomes during cell division; they help divide the genetic material in the cell

Describe the difference between a spontaneous vs. induced mutation.

Spontaneous mutations are changes in the nucleotide sequence that appear to have no known cause, and are assumed to be accidental. Induced mutations happen under the influence of extraneous factors (radiation, UV)

Scientists wanted to know if BPA was mutagenic. If so, they wanted to know if is caused base substitutions or frameshift mutations. Design an experiment to determine this:

Starting with two bacteria genes, one with a frameshift mutation in the His gene (insertion or deletion), and one with a point mutation in the His gene, then you expose them to the BPA, include rat liver extract, plate them on media that lacks histidine, and if you observe growth with the base pair substitution and no growth with the frameshift mutation, you would assume that the BPA induces substitution mutations because it reverted it back exactly

Explain the process of DNA synthesis on the lagging strand of DNA

Step 1: A new fragment begins with DNA polymerase III binding to the 3' end of the most recently produced RNA primer, which is closest to the replication fork. DNA pol III then adds DNA nucleotides in the 5' to 3' direction until it encounters the previous RNA primer. Step 2: DNA pol III falls off and is replaced by DNA pol I. Starting at the 5' end of primer A, DNA pol I removes each RNA nucleotide 3' to 5' and replaces it with the corresponding DNA nucleotide. (DNA pol I adds the nucleotides to the 3' end, 5' to 3') DNA pol I falls off, leaving a gap in the sugar-phosphate backbone between fragments. Step 3: DNA ligase closes the gap between fragments. These steps will be repeated as the replication fork opens up.

In the language of DNA, what are the three stop codons?

TAA, TAG, TGA

Common sequence in the core promoter of eukaryotes

TATA box

What determines where RNAP binds to the DNA and begins transcription in eukaryotes?

TATA; box in the core promoter

________of translation happens when the ribosome hits a stop codon on the mRNA.

Termination

The company Monsanto devotes millions of dollars to investigating farmers who are suspected of patent infringement each year and takes action against those that they suspect are growing transgenic corn that contains the BT gene (encodes a protein that kills insect) without purchasing seed from the company annually. Briefly outline how Monsanto could use molecular biology to determine whether or not a farmer is growing Bt corn?

Take corn kernel and extract DNA from it and Monsanto needs to look for the Bt gene Design primers specific to the Monsanto Bt gene and then you run a gel with the PCR product Bt gene present in corn: band Bt gene not present: no band

What tissue do we isolate mRNA from to make GH cDNA? Can it be any tissue?

Take the total mRNA from the pituitary gland because pituitary tissues express GH mRNA, but not all other cells do, and we need the mRNA to make cDNA

What is telomerase and what cells express this protein?

Telomerase is an enzyme that is responsible for adding more repeat sequences to the end of the DNA making them immortal. Adult germline (sex) cells, fetal, and tumor cells have this

Many problems with aging are associated with the shortening of telomeres. A scientist genetically engineers a mouse to over-express telomerase, the enzyme that lengthens telomeres, but the mouse develops tumors and dies. Why might this have occurred?

Telomerase is often expressed in cancer cells. It is a crucial component in many cancers because it confers a sort of cellular immortality by lengthening the telomeres.

Where are telomeres located on a chromosome? How many telomeres are there on each chromosome?

Telomeres are located at the ends of chromosomes. Each chromosome has 4 telomeres, 2 per chromatid.

What can an Ames test tell us?

The Ames test is a bacterial assay to detect mutagenic compounds. They use different strains of Salmonella to test this, and each strain contains a mutation in one of the genes of the histidine operon and the mutant strains are unable to synthesize histidine, and require histidine for growth. The assay measures the frequency of reverse mutations that occur within the mutant gene, yielding wildtype bacteria, so the test is seeing if the mutations can mutate the bacteria back to normal. The Ames test uses bacteria as "guinea pigs" to determine if a chemical can cause cancer

An alien was investigated and when DNA replication was studied, a unique feature was apparent: no Okazaki fragments. Create a model of DNA that is consistent with this observation.

The DNA might be single stranded or contain parallel strands in the double helix

List the components of a PCR reaction.

The DNA to be cloned, Taq DNA polymerase, Mg+2, 2 primers, and 4 deoxyribonucleoside triphosphates.

When Avery and his colleagues had obtained the transforming factor from the IIIS virulent cells, they treated the fraction with proteases, ribonuclease, and deoxyribonuclease, followed by the assay for retention or loss of transforming ability. What was the result? What conclusions were drawn?

The DNA was proven to be the "transforming principle". Treatment with deoxyribonuclease resulted in the loss of transforming ability.

Relate the polarity of a protein to the polarity of an mRNA and a DNA sequence.

The N-terminus (amino group) of a protein corresponds to the 5' end of the mRNA, the 5' end of the coding strand of DNA, and the 3' end of the template strand of DNA. The C-terminus (carboxyl group) of a protein corresponds to the 3' end of the mRNA, 3' end of the coding strand, and the 5' end of the template strand of DNA

Why do proponents of GM crops say they will be so important in the future?

The UN estimates that the world will have to grow 70% more food by 2050 just to keep up with population growth, and climate change will make much of the world's arable land more difficult to farm, and with GM crops, we could produce higher yields, grow them in dry, salty land, and the plants will be able to tolerate more.

What happened when scientists deleted the XIST gene from an X chromosome?

The X chromosome lost its ability to be inactivated

You take 2 newborn rat pups from an anxious mother and put them in the cage with a nurturing mother who raises them as her own. As adults, the biological offspring of the nurturing mother are calm, but the adopted rats are anxious. Explain

The adopted rats must have a loss of function mutation in their GR gene

To charge an amino acid, you need an amino acetyl tRNA synthetase. How does an alanine tRNA know that it needs to be charged with alanine?

The anti-codon is different from one tRNA to another and it recognizes the anti codon

You constructed an expression vector with the correct promoter, transformed bacteria, and selected for the transformed GH gene. Unfortunately, the mature mRNA was WAY longer than it is supposed to be. Why?

The bacteria do not have the machinery needed to splice out introns, so this is why we need to use cDNA

What happens when DNA is subjected to heat?

The double helix is denatured and it unwinds, and during unwinding, the viscosity decrease and UV adsorption increases

Which three steps constitute a PCR cycle?

The double-stranded product is denatured, the primers anneal to the target sequence, and then DNA synthesis (extension) by Taq polymerase proceeds.

Why is DNA more stable than RNA, therefore better to store genetic information?

The chemistry at the 2' pentose carbon, because on the ribose there is an -OH group on the 2' carbon, and deoxyribose doesn't have this extra -OH which is chemically relative and leads to instability, so RNA degrades faster than DNA

Prophase I

The chromosomes condense, and the nuclear envelope breaks down. crossing-over occurs.

Cloning Vector vs. Expression Vector

The cloning vector doesn't always have a promoter because they aren't always used to express proteins and drive protein production, which is necessary for expression The expression vector is for expressing the gene and you need correct promoters and transcription termination site, maybe even a translation start site or translation stop site Cloning vectors are just used for the propagation of plasmids if you end goal isn't to produce a whole bunch of protein

What is the relationship and sequence correspondence of the mRNA transcript to the DNA coding strand? Select the two correct statements. The coding DNA strand and the RNA transcript are identical. The coding DNA strand and the RNA transcript are antiparallel to each other. The coding DNA strand and the RNA transcript are identical, except that thymidine nucleotides in the DNA are uridine nucleotides in corresponding sites of the mRNA transcript. The coding DNA strand and the RNA transcript are complementary. The coding DNA strand and the RNA transcript are parallel to each other.

The coding DNA strand and the RNA transcript are identical, except that thymidine nucleotides in the DNA are uridine nucleotides in corresponding sites of the mRNA transcript. The coding DNA strand and the RNA transcript are parallel to each other.

How can the expression of the PitX1 gene change in one part of the body in the lake fish, but not in another?

The coding regions of most genes are surrounded by a number of regulatory switches controlling gene expression, and like all DNA sequences, the regulatory "switches" can acquire mutations. A mutation of just one switch region only affects the particular part of the body that it regulates, so the gene will function normally everywhere else. They believe that the regulatory sequence of the PitX1 gene in the pelvic region of the lake fish had a mutation that completely deleted the pelvic switch, but all of the other switches that regulate the pituitary and jaw PitX1 gene were normal

Imagine an XY male who has a nonfunctional copy of the Xist gene. What would you predict about his daughters?

The daughter must have inherited one X from her father and one from her mother. Since the father only has one X chromosome to give, he must have passed on the nonfunctional XIST gene. The daughter will be able to silence the maternally inherited X chromosome but unable to silence the paternal X chromosome.

What was the hypothesis about the evolution of dark skin color?

The degradation of folate, which is important for preventing birth defects, by UV selected for darker skin, which gives more protection against UV in regions with higher UV exposure, so there is higher reproductive success with darker skin because dark skin has more melanin, which protects folate

Which of the following dimensions in chromatin packing is INCORRECT? The diameter of a chromatid arm is 700 to 1000 nm. The diameter of the chromatin fiber is 25 nm. The diameter of a DNA double helix is 20 Angstroms. The diameter of the solenoid is 30 nm.

The diameter of the chromatin fiber is 25 nm. (It is approximately 700-1000 nm)

Design a drug that changes acetylation that would make rats less anxious. Include what gene is involved, how the drug works, and the end result.

The drug would act on the GR gene, adding acetyl groups to histones. making the histones less positively charged, which will not be able to bind as tightly to negatively charged DNA, causing more DNA to be exposed to transcription factors and the GR gene will be able to be expressed and produce GR protein which can bind to cortisol and turn off the fight or flight response and signal pathway that results in relaxation in the rats.

What is the N-terminus?

The end made first by the ribosome

Law of Independent Assortment

The equal segregation of one allele pair is independent of the equal segregation of the other allele pair during gamete formation and when the homologs align differently during metaphase, we will get different combinations of alleles.

What does the central dogma of biology describe?

The fact that hereditary information flows from DNA through RNA to proteins, which form the functional products of genes

What happens if you fuse a leg specific promoter to a gene that sets up eye development in flies? What is the phenotype?

The fly will have eyes on its leg

Pod shattering is a major problem in the canola industry. You are studying a gene involved in pod shattering (SHTR) and wonder whether this gene is expressed in the canola flower or the canola seed itself. To examine expression patterns you fuse the promoter and upstream cis-regulatory elements of SHTR to GFP. To your surprise, the flowers fluoresce but the seeds do not. What do these results suggest about the SHTR gene expression?

The gene is expressed in the flowers, because the flower specific transcription factors recognize the cis regulatory elements and promoter for the SHTR, and express GFP gene. The transcription factors are only in the flowers, not in the seed, so we know that the gene is normally expressed in the flowers

When lactose is present, it binds the repressor and prevents the repressor from binding the operator. Expression of operon is induced. Explain how this demonstrates negative regulation of the Lac operon.

The lac operon can only be transcribed once the repressor protein has been removed by the binding of lactose

While some of this research on epigenetic is still controversial (it is quite new) most scientists agree it is time to map the human epigenome. What will make this so much more difficult than mapping the human genome?

The genome is the same from cell to cell, but the epigenome differs from tissue to tissue, between individuals and over time;

What pattern was found in global UV distribution (light intensity)?

The greater the light intensity, the greater the UV intensity, and the farther away from the equator, the less intense the UV rays are, except for mountains and places that increased UV exposure and cloud cover decreased it

Compare diploid and haploid number

The haploid number (n) is ½ of the diploid number (2n). The genetic information contained in a haploid set of chromosomes is the genome of the species. During meiosis, the diploid number is converted into the haploid number. Haploid gametes contain just one member of each homologous pair of chromosomes, but following fusion of gametes, the diploid number is reestablished

What would happen if you used human DNA polymerase III for PCR rather than Taq polymerase?

The human DNA polymerase III enzyme would denature and would no longer be able to function properly.

In 2005, Laura applied for private health insurance and was asked to provide a DNA sample. Two weeks later, she learned that she has been denied coverage because she was at a high risk for heart disease. Laura was shocked, considering how none of her family members have heart disease. How might the health insurance company used data about her SNPs to reach this conclusion?

The insurance company could have analyzed Laura's DNA to determine her haplotype for SNPs associated with heart disease. Laura may have had a haplotype associated with a higher risk for developing the disease. A single SNP doesn't tell much about someone, so in order to find an association between SNPs and other things, scientists have to look at many SNPs, a haplotype

It has been recently determined that the gene for Duchenne muscular dystrophy (DMD) is more than 2000 kb (kilobases) in length; however, the mRNA produced by this gene is only about 14 kb long. What is a likely cause of this discrepancy?

The introns are spliced out during mRNA processing

What would be the effect of a mutation in the lacI gene that prevented the repressor from binding to lactose?

The lac Z, Y, and A genes would not be expressed. (If lactose could not bind to the repressor, the repressor would stay bound to the operator and repress the transcription of the lac Z, Y, and A genes.)

Give two examples of dosage compensation.

The method of dosage compensation in humans, which is where females turn one X chromosome into a Barr body, and also the method in other organisms where the male double expresses its one X chromosome

How does the GR protein affect the stress response?

The more GR receptor you have, the easier it is to recover from the stress response Cortisol travels to an area of the brain called the hippocampus, where it binds to GRs. When enough cortisol is bound, the hippocampus sends out signals that turn off the stress circuit, shutting down both the Fight or Flight response and cortisol production and promotes relaxation and recovery Rats with higher levels of GR are better at detecting cortisol, and they recover from stress more quickly.

Enzyme X is responsible catalyzing the conversion of A→B in mice. A mutation in gene X causes the protein to work much faster. Unfortunately, this leads to a shortage of A and mice with this mutation become sick and eventually die. Is the mutation above a loss-of-function or gain-of-function mutation?

The mutation in gene X is a gain-of-function mutation. The enzyme's function is improved, even though the overall health of the mouse decreases as a result.

Where are Barr bodies located in the cell?

The nucleus, because that is where chromosomes are

Aneuploidy

The occurrence of one or more extra or missing chromosomes leading to an unbalanced chromosome complement, or, any chromosome number that is not an exact multiple of the haploid number. Arises by non-disjunction in meiosis.

If all the other alleles are normal, what is the affect on the operon with these two alleles: Is/I+ And what is the type of transcription?

The operon is always repressed because Is is dominant to I+, and the cell will not be able to digest and use lactose because none of the structural genes are ever transcribed Noninducible

Determine which strand is the template strand when you are given the directionality of RNAP or the location of the promoter.

The polymerase reads the template strand from 3' to 5' and the location of the promoter will be on the 5' end of the coding strand and the 3' end of the template strand

How is tryptophan a repressor?

The presence of tryptophan inhibits gene expression because bacteria can synthesize tryptophan, but if a sufficient supply of it is available, it is energetically inefficient for the organism to synthesize the enzymes needed to produce tryptophan. Tryptophan can repress transcription of genes that encode the appropriate biosynthetic enzymes

How can the epigenome be the cause of some cancers?

The problems begin when our stem cells, the master cells that repair injury, overwork Every time the cell divides, there is a chance of epigenetic damage As epigenetic errors pile up in older people, the switches that turn genes off or on can be damaged and wreck havoc in the cell Oncosupressor genes: there can be genes that are active in normally preventing tumors that can epigenetically become silenced Oncogenes: methylation tags can come off and activate these genes

What are cis-acting sites in the lac operon?

The promoter and the operator

Using molecular biology, we can also drive expression of the "leg" HOX gene by the promoter of the head HOX gene in a fly (we fuse them together). To do this, scientists must make a hybrid gene (transgene) and introduce this to a normal embryo early in development. Predict what happens when you fuse the promoter of the head HOX gene to the coding region of the leg HOX gene and express this additional hybrid gene (transgene) in the fly. (Assume here the promoter is sufficient for expression)

The promoter, because it dictates where genes are expressed, makes the leg genes be transcribed in the head region, and it is not coding for a head though, it is coding for a leg, so it is going to have a leg coming out of its head A cell in the head of the animal has green trans-acting factors in the head area that recognize the head promoter, but now the promoter is driving expression of the HOX gene that typically specifies development of the leg, in the head gene. The leg HOX gene encodes a TF that specifies leg formation and now we are directing the orange HOX gene in the head and have a leg forming from the head

What are exons?

The protein coding region of a gene

size of the proteome relative to the number of genes?

The proteome is several hundred thousand proteins, while the genome is about 20,000 genes

When there is no lactose and no glucose, what is the genetic activity of the lac operon and the lac repressor and CAP protein?

The repressor is bound to the operator, and CAP is bound to its binding site. The operon is not transcribed.

When there is no lactose, and glucose, what is the genetic activity of the lac operon and the lac repressor and CAP protein?

The repressor is bound to the operator, and CAP is not bound to its binding site. The operon is not transcribed.

When there is lactose, and no glucose, what is the genetic activity of the lac operon and the lac repressor and CAP protein?

The repressor is inactive, and CAP is bound to its binding site. The operon is being transcribed at a high level.

When there is lactose, and glucose, what is the genetic activity of the lac operon and the lac repressor and CAP protein?

The repressor is inactive, and CAP is not bound to its binding site. The operon is transcribed at a low level.

If telomere shortening could be stopped in an individual, what might be the result?

The risk of cancer may increase, but we may also be able to mass produce cells for transplantation and help test new drugs and gene therapies.

The exact same deletion on chromosome 15 can lead to two different syndromes: • Angelman's syndrome (children are non-verbal, jerky in their movement but always smiling) • Prader-Willi syndrome (children are floppy at birth, mentally retarded, and obese from insatiable appetite) What is unique about their inheritance pattern?

The same deletion (genetic abnormality) can cause a different syndrome. If the deletion was from the paternal chromosome, you have Prader-Willi, and if the deletion was on the maternal chromosome, you have Angelman's syndrome. There must be a tag/imprint placed on that chromosome that came from the egg or sperm, so that chromosome 15 knows where it came from The different sets of genes were being silenced depending on whether they came from mother or father, even though the DNA sequence was the same This is the first evidence that something other than just genes was passed between generations

What is the sense strand of DNA? Antisense?

The sense strand is the strand of DNA that has the same sequence as the mRNA, which takes the antisense strand as its template during transcription

Name 4 lifestyle changes that may lengthen chromosomes and describe the significance of lengthening.

The significance of the lengthening of telomeres is it will prolong cell life and human life because each time a cell divides, telomeres get shorter because DNA cannot be replicated all the way to the end. and four lifestyle changes that can be made are to reduce stress, be social, eat healthy, and exercise.

In a population of mice, 99.5% have straight tails. 0.5% of mice are heterozygotes and have bent tails. Which type is wildtype? Which allele is dominant?

The straight is the wild type, but the bent is dominant

If all the other alleles are normal, what is the affect on the operon with these two alleles: I-/I- And what is the type of transcription?

The system is constitutive, but it can still digest and use lactose because the structural genes are always transcribed because there is no functional repressor that can bind to the operator Constitutive

What is the relationship and sequence correspondence of the RNA transcript and the DNA template strand with respect to transcription? Select the two correct statements. The template DNA strand and the RNA transcript are identical, except that thymidine nucleotides in the DNA are uridine nucleotides in corresponding sites of the mRNA transcript. The template DNA strand and the RNA transcript are parallel to each other. The template DNA strand and the RNA transcript are antiparallel to each other. The template DNA strand and the RNA transcript are identical. The template DNA strand and the RNA transcript are complementary.

The template DNA strand and the RNA transcript are antiparallel to each other. The template DNA strand and the RNA transcript are complementary.

If cis-acting elements are the same in all cells, what makes cells express different protein products?

The trans acting factors are different in different cells, such as transcription factors, which are proteins that bind to cis-regulating elements and help recruit RNA polymerase For example, if you only have trans-acting factors in the liver cell fibrinogen gene, you will only have transcription in the liver cell Trans-acting factors that are present are going to be different in different cells, and that is how you can get a skin cell having different protein products than a liver cell for example

Trans-acting site/gene

The trans-acting gene may be on the same chromosome as the target gene, but the activity is via the intermediary protein or RNA that it encodes. Both the trans-acting gene and the protein/RNA that it encodes are said to "act in trans" on the target gene.

Describe transcription

The two DNA strands must first separate at the place where the process will start. In transcription, only one DNA strand serves as a template for the RNA molecule, and the other strand is unused. The "start" signal is a nucleotide sequence called a promotor, which is located in the DNA at the beginning of a gene (a gene is a length of DNA that will code for a protein). The RNA polymerase will attach at the promotor. Then as RNA grows longer, the strand peels away from the DNA template, allowing the 2 separated DNA strands to come back together in the region already transcribed. Lastly, the RNA polymerase reaches a sequence of bases in the DNA template called the terminator, which signals the end for the gene. Then, the polymerase detaches from the RNA molecule, and the gene and the DNA strands rejoin. Remember, RNA is a single stranded molecule.

A brown thin mouse and an obese, yellowish mouse are shown from Randy Jirtle's lab at Duke. These mice are identical twins but differ at the agouti gene. What specifically is different in the brown mice vs. the yellow, fat mice?

The yellow mouse's agouti gene is on all the time, and blocks satiation signals. A chemical tag called a methyl molecule affixes near the agouti gene in the brown mouse shutting it down. If they give the fat, yellow pregnant mothers food rich in vitamins and folic acids, which helps them make the methyl tags that silence genes, and they would give birth to thin mice no longer prone to disease Epigenetic change that occurred without altering a single chemical in the agouti gene

How is PitX expression different in a spineless vs. a spined stickleback?

There is a deletion in the cis-regulatory pelvic enhancer that interacts with a pelvis specific activator trans-acting factor in spineless sticklebacks, and since they did not have that enhancer, the trans-acting factors could not bind to it and the PitX gene could not get turned on. The coding region of the PitX gene that is responsible for the protein product that led to development of the pelvic spine was the not altered, but the fact that the cis-regulatory enhancer was deleted is what caused no protein product to be made

Why is it important to include control plates that are not treated with the potential mutagen in the Ames test?

There will be some spontaneous mutation - you want to use the control plate as a baseline for this. If the plates treated with the potential mutagen have about the same number of revertant colonies as the control, it is likely the result of spontaneous mutations rather than ones induced by the test compound.

What would happen if an XY male has a nonfunctional copy of the XIST gene?

There would be no phenotype; since XY males do not silence any X chromosomes, the XIST gene is never normally active anyway.

What if you are a vet and you get 3-4 male calico cats per year, and these males are often sterile and have underdeveloped testes. Explain.

These cats have Kleinfelter's syndrome, and are XXY and have one Barr body

How are liver cells and skin cells from the same person similar and how are they different?

They all have the same genetic material (DNA), but in the different cells, different genes are expressed because they have different functions and they make different proteins

Scientists now think that transcriptionally active genes may be located where in a nucleus?

They are at the edge of chromosome territories in the nucleus, at the boarder of interchromomsomal domains and this organization may bring actively expressed genes closer to transcription factors or other expressed genes, facilitating coordinated expression (Each chromosome occupies a discrete domain called a chromosome territory)

What us the result of having mRNAs that exist longer in eukaryotes (not degraded) compared to prokaryotes that degrade within minutes?

They are available much longer to orchestrate protein synthesis

How are bacterial genes for the lactose metabolism organized on a bacterial chromosome?

They are organized in clusters (these clusters are called operons) on the bacterial chromosome and they are downstream on the same DNA molecule from the regulatory region (cis-acting site) that controls transcription of all of the genes

What is the role of a cis-acting regulatory sequence in transcription initiation?

They are sequences that trans-acting factors can bind to recognize the promoter of the gene and when trans-factors are bound to them they can initiate transcription. Help regulate gene expression and help trans-acting factors recruit RNA polymerase

If enhancers or silencers are far from the promoter, how do they interact with the complex of proteins that initiate transcription?

They bend or loop out the intervening DNA.

How are telomeres an example of repetitive DNA? Are there genes that code for proteins in the telomeres?

They consist of short tandem repeats that contributes to the stability and integrity of the chromosome. There are not genes that code for proteins in the telomeres.

What is a linked SNP?

They do not reside within genes and do not affect protein function, but they do correspond to a particular drug response or the risk of getting a certain disease, and can still be a source of genetic variation

How do the -10 and -35 consensus sequences in the bacteria promoter relate to our theme of evolution?

They have been conserved throughout evolution, proving that they are very important and they are similar in different genes of the same organism or related organisms

Viral genomes and eukaryotic genomes are similar in which of the following ways? They have the ability to pack a genome into a small volume. There are few, if any, DNA-binding proteins. Their nucleic acid may be single-stranded or double-stranded. They are unable to replicate their own DNA.

They have the ability to pack a genome into a small volume (Viral DNA is associated with very few, if any DNA-binding proteins)

Why would bacteria need to regulate gene expression?

They need to respond metabolically to changes in their environment (adapt) and they need to regulate gene expression in order to synthesize protein products required for a variety of cellular activities; they also need to regulate synthesis of gene products; Not all genes are expressed at all times in all situations. Activation or repression of gene expression at the wrong time, in the wrong cell type, or in abnormal amounts can be disastrous, cause cancer, or even cell death even if the gene is normal

What is the main function of the rRNA molecules that make up the ribosome and how do scientists know this?

They perform the important catalytic functions associated with translation, such as catalyzing peptide bonds between amino acids because catalytic functions in ribosomes still occur in experiments involving ribosomal protein depleted ribosomes. These catalytic functions include catalyzing the formation of the peptide bond that links amino acids together

Explain the Avery, MacLeod, and McCarty experiment

They started out with IIIS (virulent pneumonia), then heat killed them, and then obtained a filtrate that retained the ability to induce transformation of IIR (avirulent) cells (they tested this in their control to make sure that the filtrate could still induce transformation in the IIR cells). They extracted carbohydrates, lipids, and proteins, because these are some of the things that all organisms contain, and after just this step, they realized that the IIR cells were still transformed, so neither carbohydrates, lipids, nor proteins were the transforming principle. Then they treated the filtrate with protease to destroy any remaining protein activity, and it was found that transformation still occurred, so protein was not the transforming principle. Then the filtrate was treated with ribonuclease to destroy any RNA, and it was found that transformation still occurred, meaning that RNA was not the transforming principle. After the filtrate was treated with deoxyribonuclease, it was found that no transformation occurred, meaning that DNA was the transforming principle and was the genetic material because the transformation was heritable.

Why are bacterial cells grown on agar plates that also contain ampicillin (amp)?

This will rule out any bacteria that are not transformed, because without the plasmid they do not have the ampicillin resistance and will not grow on the plates

Explain how tissues can express different genes from the same genome.

Tissues are a group of the similar cells that carry out the same function. All cells have an entire genome in them and contain all of the same DNA, so they all have the same cis-regulatory elements, so cis-regulatory elements do not necessarily regulate gene expression. Different cells have different transcription factors that recognize specific cis-regulatory elements and will bind to them. Transcription factors are expressed in tissue-specific ways and act to enhance or repress transcription in their specific cells. Transcription factors are necessary for transcription to occur, so cells that do not have transcription factors for a particular gene will not have that gene transcribed.

When Avery and his colleagues had obtained the transforming factor from the IIIS virulent cells, they treated the fraction with proteases, ribonuclease, and deoxyribonuclease, followed by the assay for retention or loss of transforming ability. What was the purpose of these experiments?

To determine the exact molecular species of the transforming principle

Electrophoresis of DNA is used for what purpose

To separate different sized fragments of DNA and RNA chains

Why do cloning vectors have DNA primer sequencing sites?

To sequence the plasmid to see if the gene of interest is in it

What are transcription factors?

Transcription factors are proteins that bind to specific DNA recognition sequences of a gene. Influence transcription rates by binding to cis-acting regulatory regions within or adjacent to a gene promoter. They act by enhancing or repressing the association of GTFs at the promoter also, and they may also assist in chromatin remodeling and the release of RNAPII from the promoter; activate transcription via protein-protein interactions with RNA polymerase.

Microbiologists describe the processes of transcription and translation as "coupled" in bacteria. This term indicates that a bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling of transcription and translation possible in bacteria?

Transcription occurs in the cytoplasm like translation and there is no post-transcriptional modifications made to the mRNA. As soon as enough of the mRNA is synthesized and exposed to the cytoplasm, ribosomes can bind and begin translation.

What would be the effect on basal transcription if the TATA box were mutated?

Transcription would be reduced, perhaps to zero because RNA polymerase binding would be disrupted.

Thymine tautaumerizes to pair with guanine. Is this a transition or a transvehrsion?

Transition

T/F: Skin, neuron, and gut cells all have the same genes

True

What is the difference between triploidy and trisomy?

Triploidy means that a cell has 3n of every chromosome. Trisomy means that a cell has 3n of one particular chromosome (i.e. trisomy 21, aka Down Syndrome). Trisomic cells that are otherwise diploid have 2n+1 chromosomes.

T/F: A chromosome may contain one or two chromatids in different phases of the mitotic or meiotic cell cycle.

True

T/F: A large scale study, drawn from 70 studies involving 200,000 people found that people with lower triglyceride levels had a lower incidence of heart attacks.

True

T/F: Alternative RNA processing can result in different mRNAs that start with different exons.

True

T/F: Alternative RNA processing generates different mRNAs that can direct the synthesis of different polypeptides.

True

T/F: Although the public tends to think that it is unsafe to eat foods grown with pesticides, scientists believe that they are generally safe

True

T/F: An intron is a section of an RNA that gets spliced out.

True

T/F: DNA has no sulfur, and proteins have no phosphorus.

True

T/F: DNA strand replication begins with an RNA primer.

True

T/F: Each aminoacyl tRNA synthetase is specific for one amino acid and a small number of tRNAs.

True

T/F: Each aminoacyl-tRNA synthetase enzyme is highly specific for a given amino acid and a given tRNA

True

T/F: G and C are present in both DNA and RNA.

True

T/F: Heterochromatin is more compact than euchromatin and less likely to contain genes being actively transcribed

True

T/F: Heterogeneous nuclear RNA is a primary transcript in eukaryotes that is processed prior to involvement in translation.

True

T/F: If Avery, McCarty, and McCleod had denatured heat killed RII cell extract, added DNA-ase, removed DNA-ase, incubated with live SIII, injected into the mouse, the mouse would have died

True

T/F: If a typical G1 nucleus is 2n and contains 2C (two complements) of DNA, a prophase I cell is 2n and contains 4C of DNA.

True

T/F: In general, DNA replicates semiconservatively and bidirectionally.

True

T/F: In general, one could say that there are fewer levels of regulation possible in prokaryotes than in eukaryotes.

True

T/F: Lactose is an inducer of the lac operon.

True

T/F: Mechanisms of sex determination take many forms in different animals.

True

T/F: Methylation of DNA decreases gene expression

True

T/F: Methylation patterns are passed on

True

T/F: Nondisjunction is viewed as a major cause of aneuploidy.

True

T/F: Recessive alleles are never expressed in the phenotypic level when one copy is present

True

T/F: Regarding the lactose utilization system in E. coli, a constitutive mutant is one in which the three enzymes are produced regardless of the presence or absence of lactose.

True

T/F: Restriction endonucleases typically recognize palindromic DNA sequences and often generate "sticky ends" or single-stranded DNA overhangs at cut sites.

True

T/F: S phase is the part of interphase when DNA duplication takes place.

True

T/F: Alternative splicing of single mRNA transcripts gives rise to multiple mRNAs.

True (Alternative splicing of mRNA transcripts is a process used to regulate gene expression posttranscriptionally.)

T/F: Guanine and adenine are purines found in DNA.

True (Guanine and adenine are indeed purines found in DNA; thymine and cytosine are the pyrimidines found in DNA.)

T/F: Transcriptionally inactive regions of the genome are typically heavily methylated.

True (Methylation of cytosine residues is often associated with decreased transcription levels. Methylation inhibits the binding of Bfs to DNA and methylated DNA may also recruit repressive chromatin remodeling complexes to gene regulatory regions)

T/F: If we attached GFP to the Pitx promoter, Spined Sticklebacks would have a fluorescent pelvis.

True (Pitx is made in a spined stickleback pelvis, so their promoter would make GFP and it would glow because they do not have a removed enhancer)

T/F: The products of restriction digestion can be visualized by gel electrophoresis, which separates fragments based on their size.

True (Restriction digestion produces fragments of DNA, and the sizes of these fragments can be determined by gel electrophoresis using standard DNA fragments of known size.)

T/F: All cells in females heterozygous for a mutation in the XIST gene will express all of the genes on the X chromosome carrying that mutation.

True (The only X chromosome that can be inactivated is the X without the mutation, so all of her cells will express the genes from the X with the mutation)

T/F: Typical bacterial chromosomes have no telomeres

True (circular chromosomes do not shorten and thus do not have telomeres)

T/F: Spineless Sticklebacks have the same length of the Pitx coding region as Spined Sticklebacks.

True (only the enhancers are different. One is deleted, so the length of regulatory regions between the fish would differ)

T/F: The consensus sequences are the same in the fibrinogen gene in the liver cell DNA and the fibrinogen gene in skin cell DNA.

True because all cells have the same genetic information and because the consensus sequences are DNA sequences, they are going to be the same

T/F: The placement of the operator sequence between the promotor and the structural genes is critical to the proper function of the lac operon.

True because the RNAP binds to the promoter, and the repressor protein binds to the operator and so if lactose isn't present, the RNAP cannot get past the repressor protein to transcribe the gene, but if the operator was not between the promoter and the structural genes, they would be always transcribed

What is the semiconservative model of DNA replication?

True one! Each replicated DNA molecule will consist of one old and one new strand

True or false. Most human transposons appear to be inactive

True. 50% of the human genome consists of transposable elements, but only 2% of the human genome comprises gene coding sequences. Even though most are inactive, the potential mobility and mutagenic effects of transposable elements have far reaching implications

What does a phosphodiester bond link in DNA structure?

Two nucleotides; 5' to 3' Phosphoric acid is joined to 2 alcohols (the hydroxyl groups on the 2 sugars)

What makes up the protein component of a nucleosome?

Two tetramers of histone proteins (The protein component of a nucleosome is composed of two tetramers of histone proteins. One tetramer is composed of two units each of histones H2A and H2B, and the other is composed of two units each of histones H3 and H4.)

IS OcZ- Y-/I+ O+Z+ Y+ With and without lactose and the effect on both Y and Z.

Uninducible because the super repressor can bind to both operators

Design an experiment to figure out which cells express an "eyeless protein" in a drosophila fly from embryo to adult state. You are given a GFP promoter + enhancers, a GFP coding region, an eyeless promoter + enhancers, and an eyeless coding region.

Use a promoter swap, because if we put the eyeless promoter with the GFP coding region, RNAP would bind to the eyeless promoter + enhancers whenever the gene is expressed throughout development, but would transcribe GFP instead and we would see a green signal. Using the eyeless promoter to drive expression of GFP.

Explain how to set up a PCR reaction to amplify a gene and interpret the results of gel electrophoresis

Using PCR, we can use primers to identify the gene we want amplified, and put it through many cycles, doubling the amount of DNA each time it cycles. You can do this with many segments of DNA to compare their size, and you will load them all into the same gel (in different wells) and see how they compare. When doing gel electrophoresis, you need to make enough DNA so that it can be analyzed, which is why you need to do the PCR before you run the gel.

What enzyme synthesizes cAMP?

adenyl cyclase.

What is blue/white screening?

We can figure out not only if the bacteria have the plasmid, but also if the plasmid has the vector that has the GH gene Add Ampicillin and Xgal to the plate If the EcoR1 restriction site is in the middle of the LacZ gene, and the GH gene is inserted in the middle of the LacZ gene, then the LacZ is not functional and cannot break down Xgal If lacZ gene functional then blue color in presence of Xgal (a substrate). If lacZ gene disrupted, then white color in presence of Xgal. If we successfully insert the GH gene, we get white colonies

A gene will be off in a cell if it doesn't have the transcription factors to initiate transcription. How can we turn the gene on in this cell?

We can turn it "on" in the cell if we link the coding region to a promoter that drives expression in this type of cell (i.e. link the surfactant coding region to the melanin promoter region) OR we can add the transcription factors needed to turn on that gene

How do we get our gene into a multiple cloning site of a vector?

We have to digest it

Now, we have only a few copies of our "cloned gene" in the cloning vector. How can we make many more copies of this circular vector with our gene of interest?

We insert the vector into bacteria via transformation so it can replicate inside the bacteria This step is transformation: uptake of DNA by bacteria Double stranded recombinant DNA introduced into the bacterial cell Once bacteria take this up, they can produce the protein product of interest Cell culture produces hundreds of millions of new bacteria For example, even if only one bacterial cell took up the plasmid, as the cells divide, they will all have the plasmid The plasmid replicates with the bacteria and we now have a lot of recombinant molecules inside the bacteria

Why do cloning vectors have an origin of replication?

We need a sequence that initiates replication of this piece of DNA in bacteria; bacteria can replicate this plasmid many many times in a single host cell

Why would we use the lacZ gene in a plasmid?

When cloning DNA using plasmids, not all plasmids will incorporate the DNA to be cloned, and the plasmid could close back up on itself, or not all host cells will take up the plasmids, so the lacZ gene will be disrupted if the plasmid takes up the DNA

When the enzyme adenyl cyclase is inhibited, what happens?

When glucose inhibits adenyl cyclase, cAMP cannot be produced and CAP cannot form the cAMP-CAP complex that is essential to the positive control of transcription of the lac operon.

DNA polymerase makes mistakes during replication. When it does happen, can mistakes be repaired? If so, how?

When it makes a mistake, synthesis stalls and the polymerase reverses course (3' to 5'), excising the incorrect nucleotide, and then it proceeds back in the 5' to 3' direction

What is the problem with DNA that is bound to histones and compacted?

When the chromatin fiber is complexed with histones and folded into compaction, it makes the DNA inaccessible to interaction with important nonhistone proteins, such as proteins that function in enzymatic and regulatory roles during the process of replication and gene expression

Some mutations that lead to diseases such as Huntington's are caused by the insertion of trinucleotide repeats. How could the process of DNA replication lead to expansions of these repeats?

When the polymerase slips off and the newly synthesized DNA complementary base pairs with its repeating neighbors, and DNA polymerase reassembles its position on the template strand and resumes normal replication, but during the course of reassembling, the polymerase complex backtracks and repeats the insertion of deoxyribonucleotides that were previously added. This results in some repeats found in the template strand being replicated twice into the daughter strand.

Your friend Laura is taking a course on plant biology and has just learned that a grain of rice is largely composed of a tissue called endosperm. Laura has also recently learned that a daffodil gene is expressed in the endosperm of golden rice plants to get them to produce beta-carotene. Laura wonders how gene expression can be restricted to the endosperm of the plant when all cells of the plant contain the same DNA and thus the daffodil gene. Briefly explain to Laura why the transgene is expressed specifically in the endosperm.

When this transgene was created, they attached the daffodil gene to a promoter that usually expresses other genes in the endosperm and not other parts of the rice because the endosperm is the part that contains the transcription factors that recognize that specific promoter.

What pattern does she find globally in human skin color? And what is the conclusion of this finding

Wherever UV is strong, skin is dark, like near the equator or at high altitudes. At the poles, the skin color of indigenous people is always lighter. Variation in human skin melanin production arose as different populations adapted biologically to different solar conditions around the world because melanin guards skin cell DNA that protects the nucleus so UV rays cannot penetrate

In eukaryotes and prokaryotes, what does gene expression ultimately depend on?

Which trans-acting factors are interacting with what cis-elements

What does it mean that DNA is antiparallel?

While one chain runs 5' to 3', the other chain runs 3' to 5' because of the constraints of the bond angles of the nucleotides, the double helix could not be constructed easily if the chains were parallel

What conclusion can you draw from this? I+ O+ Z+ Y+

Wildtype is inducible

What makes a SNP different from what geneticists might call a single nucleotide change or point mutation?

With an SNP, 2 or more versions of the sequence must each be present in at least 1% of the general population. Also, point mutations are usually deleterious, and no known disease causing mutation has a prevalence of 1%. Also, must mutations occur within a gene's coding or regulatory regions and affect the function of the protein encoded by the gene. SNPs are not necessarily located within genes and they do not always affect the way a protein functions.

The cloned gene of interest is inserted where in the Ti plasmid?

Within T. DNA

Is it possible for more than two alleles of a gene to exist?

Yes (There can be many such variants in a population, but for a diploid organism, only two such alleles can exist in any given individual)

Do eukaryotes have repressors?

Yes (can bind to silencers)

Do eukaryotes have cis-acting regulatory elements?

Yes (many more than prokaryotes)

Do prokaryotes have repressors?

Yes (think lac operon)

Is the 3' UTR part of the mRNA transcript?

Yes! The mRNA contains both translated and untranslated parts

Do prokaryotes have trans-acting molecules?

Yes! Think repressor protein in the lac operon and CAP binding protein that recruits polymerase

The locations of numerous lac I- and lac Is mutations have bee determined within the DNA sequence of the lacI gene. Among these, lacI- mutations are in the 5' upstream region and lac Is are in the downstream. Are these consistent with what is known about the function of the repressor?

Yes, because the N-terminus portion is involved in DNA binding and the C- terminal protein is more involved with binding lactose and its analogs

One gene in the human genome may be expressed at a much higher level than another. Can differences in types of cis elements present account for this?

Yes, it may have more enhancers, or the one that is expressed at lower levels may have a silencer or more silencers

Do prokaryotes have noncoding regions?

Yes, just as the organism complexity increases, so does the space between the genes

Do both the leading and lagging strands of the DNA get replicated at the same time? How?

Yes, one is continuously replicated, and one is replicated into Okazaki fragments that will get joined together by the DNA ligase. The lagging strand is just looped in order to invert the physical direction of synthesis, but not the biochemical direction. The DNA polymerase III is a dimer, with each core enzyme synthesizing one strand

Could scientists use Xist in Down syndrome research?

Yes, they could use Xist to inactivate the 3rd copy of chromosome 21, but they must inactivate the same chromosome in every cell, and because Xist acts in cis, you must put the gene on the 3rd copy of 21. You also need to catch it extremely early in development

You are working to create a transgenic line of rice that can survive floods. After you clone the Sub1 gene into an expression vector, and transform rice, you find Sub1 is not expressed. You included all the appropriate cis-regulatory elements and when you sequence the gene, you do not find a mutation. How can Sub1 be silenced in the transgenic rice?

You inserted it into a part of the genome that is heavily methylated, or the cells do not have appropriate transcription factors to recognize the cis-regulatory elements of the promoter of Sub1

Describe gel electrophoresis

You put fragmented DNA into the wells made in the agarose gel (porous), which, because DNA is negatively charged, it will travel to the positively charged pole at the end, through the porous agarose, and the smaller fragments will travel farther and faster than the larger fragments

If the non-disjunction occurs in meiosis II, what is the outcome?

You will get two disomatic gametes (normal), one trisomatic gamete, and one monosomatic gamete. The sister chromatids are together becasuse in normal MII, the sisters separate

Rather than typing out the three structural genes for bacterial phenotypes how are the structural genes abbreviated in the lac operon model?

Z

Higher order transcriptional complex

a bunch of trans acting factors assembling together at the promoter

What is an operon?

a cluster of genes with its regulatory sequence that encode proteins with coordinate functions; often under coordinated control; they all have the same promoter and are all transcribed at the same time because the protein products are all needed at the same time

What is a haplotype?

a group of SNPs across a stretch of DNA or it can also be a group of alleles on the same chromosome that were inherited together

What is a helicase?

a group of proteins that break hydrogen bonds and denature the double helix (localized unwinding)

What might prevent a repressor protein from binding to an operator?

a mutation in either the repressor protein or the operator so that the repressor protein and operator cannot interact or if lactose is present, lactose will bind to the repressor protein, so it cannot bind to the operator. Because the repressor is allosteric, it will change shape when it is bound to lactose so it can no longer bind to the operator

Missense mutation

a mutation that changes a codon to that of another amino and and thus results in an amino acid substitution in the translated protein; such changes make the protein nonfunctional

lethal mutation

a mutation that disrupts a process that is essential to survival of the organism

The three essential components of the building blocks are

a nitrogenous base, a pentose sugar (5-carbon sugar), and a phosphate group.

What is a SNP?:

a source of genetic variation; single nucleotide polymorphism. A single nucleotide substitution of one base for another than occur in more than one percent of the general population. Many differences in people come from differences in the sequence of DNA, and many of the differences in DNA sequences come from SNPs; basically a variation at a single nucleotide

merozygote

a strain of bacteria that is made diploid by inserting F' factors and now they have 2 copies for any given gene (These are small circular pieces of DNA - plasmids that can be taken up by bacteria)

The loss of what molecule allows the formation of the dipeptide?

a water molecule (1 H from the amine group and 1 H and 1 O from the carboxyl group)

For each of the anticodon sequences identify all codon sequences to which it could potentially pair using third base wobble. a) 5′-UAG-3′ b) 5′-AAA-3′ c) 5′-CUC-3′ d) 5′-AUG-3′ e) 5'-GUA-3' f) 5′-CUA-3′

a) 5′-CUA-3′ & 5′-CUG-3′ b) 5'-UUU-3' c) 5′-GAG-3′ d) 5′-CAU-3′ e) 5'-UAC-3' & 5'-UAU-3' f) N/A no amino acid

Identify the amino acid carried by tRNAs with the following anticodon sequences. a) 5′-UAG-3′ b) 5′-AAA-3′ c) 5′-CUC-3′ d) 5′-AUG-3′ e) 5'-GUA-3' f) 5′-CUA-3′

a) 5′-UAG-3′ Leu b) 5′-AAA-3′ Phe c) 5′-CUC-3′ Glu d) 5′-AUG-3′ His e) 5'-GUA-3' Tyr f) 5′-CUA-3′ None - this anticodon doesn't even exist on any tRNA since there are no "stop" tRNAs.

RNA polymerase functions similarly to DNA polymerase. However, there are two differences:

a) The substrate nucleotides contain ribose rather than deoxyribose b) No primer is required to initiate synthesis

Why do cloning vectors have selectable marker genes?

a) To distinguish host cells that have taken up the vectors from host cells that have not taken up the vector, the vector has a selectable marker gene, which is usually an antibiotic resistant gene or a gene for an enzyme absent from the host cell, so you can tell which cells have taken up the vector because not all cells will take up the DNA that we want cloned, and non-recombinant plasmids are not desired, so we want to kill the cells that contain them

Which of these DNA sequences could be a restriction enzyme recognition site? a. ATATAT b. GCTTCG c. AGTCCA d. CCCCCC

a. ATATAT

Which of the following is NOT a similarity between DNA replication and transcription? a. Both processes occur with the same fidelity (accuracy) b. Polymerization in both processes is based on reading a DNA template c. The newly synthesized polynucleotide is antiparallel to its template d. Both processes build a polynucleotide in the 5' to 3' direction

a. Both processes occur with the same fidelity (accuracy)

Describe the three steps of a single PCR cycle.

a. Denaturation: the double stranded target DNA to be cloned is denatured into single strands by heating the strands to 95˚ for one minute b. Hybridization/annealing: the reaction temperature is lowered to 45˚ to allow the primer to bind to the single stranded DNA c. Extension: the reaction temperature is again adjusted and the DNA polymerase uses the primers as starting points to synthesize new DNA strands by adding nucleotides to the ends of primers in a 5' to 3' direction

6. Which of the following is/are true with respect to eukaryotic mRNA? a. Monocistronic b. Transcription stops at the stop codon c. Has the same sequence as the template DNA that it was transcribed from

a. Monocistronic (An mRNA molecule is said to be monocistronic when it contains the genetic information to translate only a single protein chain (polypeptide). This is the case for most of the eukaryotic mRNAs.)

Which one of the following pairs of processes may occur simultaneously on the same RNA molecule in a prokaryotic cell? a. Translation and transcription b. Transcription and splicing c. Splicing and translation d. Polyadenylation and translation

a. Translation and transcription

Given the following DNA sequence, answer the questions below: 5' -TTGATTCAGGGAAGGTTCGTGCGAAATAAGTGCATAAC -3' 3'- AACTAAGTCCCTTCCAAGCACGCTTTA T TCACGTATTG-5' Suppose there is a mutation in the DNA sequence isolated T is now an A... a. Is this a transition of a transversion? b. Write out the ORF mRNA sequence c. Write the sequence of the protein for which this mutated gene codes d. What type of mutation is this? (Circle all that apply) Silent Missense Nonsense Insertion Deletion Frameshift Point e. Would you expect this mutation to be loss-of-function of gain-of- function? f. Would you expect this mutation to be amorphic, hypomorphic, hypermorphic, or neomorphic? Why? g. Would you expect this mutation to dominant or recessive? Why?

a. transversion because it is a pyrimidine to a purine b. 5'- AUG CAC UAA -3' c. MET - HIS d. nonsense and point e. Loss-of-function f. A protein's function is determined by its structure. This mutation would likely be amorphic (null) because the protein's structure has been severely compromised and therefore it will not be able to perform its normal function, even at a decreased rate. g. Recessive; most loss-of-function mutations are recessive.

Genetic ways to affect gene expression

add or take away the gene, mutate the coding sequence of DNA, mutate the regulatory region, add or take away silencers or enhancers of the gene

trans-acting mutations

affect all structural genes regardless of what chromosome they are on.

cis-acting mutations

affect the expression of genes on same chromosome. Example: Oc and P-

regulatory mutation

affect the regulation of gene expression; may inappropriately active or inactive expression of a gene

When does methylation take place?

after replication

When do sister chromatids separate in mitosis?

anaphase

The condition that exists when an organism gains or loses one or more chromosomes but not a complete haploid set is known as ________.

aneuploidy

After being cut into fragments with the same restriction enzymes, the fragments can be _________ (or "stuck together" via hydrogen bonds). Addition of an enzyme known as ___________ will then seal the phosphodiester bonds of the backbone to form recombinant DNA molecules.

annealed; DNA ligase

There are two important sites on a tRNA, they are:

anti codon and the region that is covalently bonded to the corresponding amino acid

The growing RNA polynucleotide is parallel or antiparallel to its template DNA strand?

antiparallel

GMO

any organism that scientists have gone in and used recombinant DNA technology to modify their DNA

vectors

are plasmids, bacteriophages, or cosmids that receive, through ligation, a piece or pieces of foreign DNA; an agent through which a foreign DNA segment can be inserted and used to transform host cells

tetrads

are synapsed homologous chromosomes, which are composed of four chromatids; each bivalent and their sister chromatid

host cells

are the cells that express foreign genes introduced in the recombinant DNA.

Initiation of translation

attachment of the mRNA to the ribosome and the first charged tRNA docks to the ribosome carrying Methionine after it recognizes the start codon, AUG

Which of the following statements about DNA structure is true? a) The pentose sugar in DNA is ribose. b) The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. c) Hydrogen bonds formed between the sugar‑phosphate backbones of the two DNA chains help to stabilize DNA structure. d) Nucleic acids are formed through phosphodiester bonds that link nucleosides together.

b) The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. (the 5′-3′ orientation of each chain runs in opposite directions)

. You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. 5' TCAATGTAAGCTACCCGGAGCTCTGGGTTTCATCCACT 3' a) Find the longest open reading frame (ORF). b) Is the sequence given to you the template strand or the coding strand? c) Transcribe the longest ORF into mRNA, indicating the 5' and 3' ends. d) Write out the sequence of the protein for which it codes.

b) template c) 5' - AUGAAACCCAGAGCUCCGGGUAGCUUACAUUGA - 3' d) Met Lys Pro Arg Ala Pro Gly Ser Leu His

Given the following DNA sequence, answer the questions below: 5' -TTGATTCAGGGAAGGTTCGTGCGAAATAAGTGCATAAC -3' 3'- AACTAAGTCCCTTCCAAGCACGCTTTATTCACGTATTG-5' a. Identify the open reading frame b. Write the sequence of the ORF as it is in the mRNA (include 5' and 3' designations) c. Write the sequence of the protein for which this gene codes

b. 5'- AUG CAC UUA UUU CGC ACG AAC CUU CCC UGA -3' c. MET - HIS - LEU -PHE - ARG - THR - ASN - LEU - PRO

You find a scorpion with a rare dominant genetic disorder that leaves it unable to produce venom. The mutant allele that causes this disease is transcribed but not translated. Which of the following terms describes the wild-type allele? a. Neomorphic b. Haploinsufficient c. Hypermorphic d. Haplosufficient e. Codominant

b. Haploinsufficient (the wild-type allele is needed in 2 copies to produce the wild-type phenotype that is producing venom)

Is cDNA always used in recombinant DNA technology as opposed to genomic DNA?

cDNA is not always used, sometimes we need to use genomic DNA For example, if regulatory regions are in introns If you are expressing something in bacteria, use cDNA because they do not have splicing capabilities

You wish to amplify a 22,345 base-pair region of mouse DNA using polymerase chain reaction. You design a pair of primers that are 20 and 22 bases in length (respectively) and have identical melting temperatures. However, when you run your reaction it fails. this is most likely because: a. Your primers are not the same length b. The region of DNA you are attempting to target is too large c. Your primers are too short d. Your targeted mouse DNA; only human DNA can be used e. You used more than 1 primer in the reaction

b. The region of DNA you are attempting to target is too large

Which one of the following pairs of processes may occur simultaneously in a eukaryotic cell? a. Translation and transcription b. Transcription and splicing c. Splicing and translation d. Polyadenylation and translation

b. Transcription and splicing

What is a primase?

because DNA polymerase III needs a primer in order to elongate the polynucleotide chain (it needs a free 3'-OH), a short segment of RNA (10-12 nucleotides) that is complementary to DNA is first synthesized on the DNA template, and the synthesis of this RNA is directed by a RNA polymerase called primase. The DNA polymerase adds deoxyribonucleotides to this segment of RNA to initiate DNA synthesis.

What is a tautomeric shift?

because purines and pyrimidines can exist in tautomeric forms (alternate chemical forms differing by only one proton shift in the molecule), these shifts can change the bonding structure of the molecule and allow them to bind with noncomplementary bases. This will also cause incorrect nucleotides to be added during replication

Where is upstream in relation to the gene in RNA and DNA?

before it

Sometimes when the enhancers are far away, the DNA has to _____ to get the transcription factors together at the site of the promoter

bend

In Figure 17-3 you see that the fragment will be cloned into the multiple cloning site and disrupt the LacZ. Bacteria that have a plasmid without your cloned fragment of interest will be________ when plated with X-gal.

blue

Do eukaryotes, prokaryotes, or both have replication forks?

both

Do eukaryotes, prokaryotes, or both use bidirectional synthesis, leading to leading and lagging strands?

both

What type of enzyme is made with lactose and I+ O+ Z-/F' I+ O+ Z+?

both

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) binds. Which of the following is a common consensus sequence? a) any trinucleotide repeat b) GGTTC c) TATA d) satellite DNAs e) TTTTAAAA

c) TATA

In the lac operon, the role of the catabolite activator protein (CAP) is to: a) ensure the use of lactose before any other sugar b) ensure that lactose can enter the cell c) ensure that glucose is used before lactose d) ensure that glucose is stored for future use

c) ensure that glucose is used before lactose

Which of the following is part of a DNA molecule? a) sigma b) activator c) promoter d) transcription factor e) RNA polymerase

c) promoter

Assume that the sequence of bases given in this problem is present on one nucleotide chain of a DNA duplex and that the chain has opened up at a replication fork. Synthesis of an RNA primer occurs on this template starting at the T that comes before 2x Gs 3'...........GGCTACCTGGATTCA......5' a. 3' ACCUGAGU b. 5' ACCUGAGU c. 5' ACCUAAGU d. 3' ACCUAAGU

c. 5' ACCUAAGU

Homologous chromosomes are brought together during: a. Mitosis b. DNA replication c. Fertilization d. ALL

c. Fertilization

In order to bind to the CAP-binding site, what is CAP complexed with?

cAMP (cyclic adenosine monophosphate)

Low levels of glucose means:

cAMP and CAP bound to promoter

Consequences of mitosis going awry

cancer

What is messenger RNA?

carry genetic information from DNA to the ribosome.

What does CAP stand for?

catabolite-activating protein; it helps activate expression of the lac operon, but is also able to inhibit expression when glucose is present

DNA ligase

catalyzing the formation of the phosphodiester bond that seals the nick between fragments of DNA

constitutive mutation

cause the lac structural genes to be expressed whether or not lactose is present. Operon is always on!

prophase of mitosis

centrioles move apart, spindle fibers are organized, chromatin fibers begin to condense until chromosomes become visible

Where would you find heterochomatin?

centromere and telomere

changes in DNA/chromosome structure that can influence overall gene output.

chromatin remodeling

Homologous chromosomes

chromosomes that synapse or pair during meiosis and that are identical with respect to their genetic loci and centromere placement; One chromosome of each homologous pair comes from the mother and one comes from the father. Homologous chromosomes are similiar but not identical. Each carries the same genes in the same order, but the alleles for each trait may not be the same.

Prokaryotes have what shape of chromosomes?

circular

What are the shapes of the chromosomes in mitochondrial and chloroplast chromosomes?

circular

In E. coli (a bacterium), the genetic material is composed of ________. RNA and protein polypeptide chains circular, double-stranded RNA linear, double-stranded DNA circular, double-stranded DNA

circular, double-stranded DNA

What is a promoter element, a cis or a trans factor

cis

Are the following transcriptional regulators cis or trans? Enhancer Promoter Repressor Silencer Activator Transcription factors

cis cis trans cis trans trans

In the Meselson-Stahl experiment, which mode of replication was eliminated based on data derived after one generation of replication and why?

conservative. The conservative replication theory says that parental strands reanneal with parental strands and daughter strands reanneal with daughter strands after DNA replication. This experiment showed that this was not the case. If it was the case, after one generation, two bands would have been seen, a 14N/14N, and a 15N/15N.

I+ Oc Z+ is constitutive, repressed, or inducible?

constitutive

In the presence of lactose, are the structural genes constitutive, permanently repressed or inducible with I-+ Oc Z+/F' O+?

constitutive

The enzymes used in glycolysis are produced at all times by bacteria, regardless of the environment. This illustrates the concept of ___________ enzymes.

constitutive

Type of transcription: I-

constitutive

Type of transcription: Oc

constitutive

I- O+Z+ Y+ With and without lactose and the effect on both Y and Z.

constitutive for both

What happens if an individual has only a Y and no X chromosome?

death

Where are chromosomes found in prokaryotes?

cytoplasm

Which of the following accurately describes a possible meiotic nondisjunction event? a) Meiosis fails to proceed to completion. b) Fusion of gametes results in trisomy. c) Sister chromatids fail to separate during meiosis I. d) Homologs fail to separate during meiosis I.

d) Homologs fail to separate during meiosis I. (Ordinarily, homologs separate during meiosis I. Failure of this separation is one of the ways in which nondisjunction can occur)

The base content of a sample of DNA is as follows: A=31%, G=31%, T=19%, C=19%. Which of the following could this sample be? a. Bacterial chromosome b. Nuclear DNA c. PCR product d. Primer

d. Primer

A scientist clones a regulatory gene that is involved in controlling the expression of other genes, and discovers that the regulatory gene encodes an enzyme that acetylates histones. It is likely that this enzyme regulates gene expression by... a. causing tighter packing of the chromatin at the target gene, thereby inhibiting transcription b. causing tighter packing of the chromatin at the target gene, thereby enhancing transcription c. causing looser packing of the chromatin at the target gene, thereby inhibiting transcription d. causing looser packing of the chromatin at the target gene, thereby enhancing transcription

d. causing looser packing of the chromatin at the target gene, thereby enhancing transcription

After replication is complete, the new DNAs, called ___________, are identical to each other.

daughter DNA

what do repressors do?

decrease levels of transcription. They can bind at the silencer to inhibit formation of the PIC, stimulate or recruit chromatin remodeling proteins that create repressive chromatin structures or they can block the association of a gene's regulatory elements with activators or with the PIC Help regulate gene expression at the level of transcription

Okazaki fragments are short DNA fragments synthesized in a _______ manner.

discontinuous

Termination phase in DNA directed synthesis of RNA

dissociation of RNA, RNAP, and DNA.

Telophase

division of the cytoplasm; two cells are produced from one cell; in each new cell, chromosomes begin to uncoil and become diffuse chromatin again, while the nuclear envelope forms around them

Two proteins interact to form a multimeric complex. When one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as

dominant negative (loss of function)

Is the promoter double stranded or single stranded DNA?

double

_________ are the "post-S phase" structure of replicated chromosomes. Because they are composed of two chromatids joined by a centromere, they are also called ________

dyads; sister chromatids

Which of the following enzymes can be used to synthesize cDNA from an mRNA template? a) DNA-directed RNA polymerase b) DNA-directed DNA polymerase c) restriction endonuclease d) DNA ligase e) reverse transcriptase

e) reverse transcriptase

What is the conservative model of DNA replication?

each strand of the double helix still serves as a template for the new strands, but following synthesis, the two newly created strands come together and the parental strands reassociate; the original helix is "conserved" Not true

What are the switches being talked about in regards to the PitX gene?

enhancer sequences

cis-acting DNA sequences to which transcription factors bind to regulate transcription. They can act over distances of thousands of base pairs and can be upstream, downstream, or internal to the gene they affect

enhancers

Activators bind ________.Repressors bind ______-

enhancers; silencers Help regulate gene expression at the level of transcription

DNA methyltransferase

enzymes catalyze the transfer of a methyl group to cytosine of DNA in CpG islands.

Genes that are being expressed (transcriptionally active) are found in ___________- regions of chromosomes.

euchromatic

If one compares the base sequences of related genes from different species, one is likely to find that corresponding ________ are usually conserved, but the sequences of ________ are much less well conserved.

exons; introns

Elongation of translation

formation of peptide bonds between amino acids of the growing chains as the tRNAs are moving through the sites A, P, E;

The _________ of an organism is defined as its observable sum of features.

phenotype

I+ Oc Z-/F' O+ Z+ with lactose. Is a functional, nonfunctional, or no enzyme made?

functional and non functional enzymes are made because there is a constitutive operator and a mutant Z and a normal operator and normal Z

I+ O+ Z-/F' I+ O+ Z+ with lactose. Is a functional, nonfunctional, or no enzyme made?

functional and nonfunctional enzymes are made since lactose is present, transcription will occur both in the F factor and the gene

I+ Oc Z+ with lactose. Is a functional, nonfunctional, or no enzyme made?

functional enzyme made because the operator is constitutive and the Z gene is not mutated; constitutive cis-acting mutation

Hypermorphic mutation

gain of function; greater than the wild type. These alleles produce more gene activity per allele than the wild-type form and are usually dominant. The gene product is indistinguishable from the wild-type, but it is present in a greater amount and thus induces greater level of activity. It essentially goes into "over-drive" and pushing processes more rapidly, at the wrong time, wrong place, and longer than normal. They often result from regulatory mutations that increase gene transcription, block normal response to regulatory signals that silence transcription, or increase the number of gene copies by gene duplication

Neomorphic mutation

gain of function; new form; acquire new gene activities not found in the wild-type; functional gene products, but have structures that are different from the wild-type gene product. The mutant protein functions differently than the wild-type, and may cause a severely affected phenotype

A DNA sequence coding for a single polypeptide and can be found anywhere on the chromosome

gene

Positive control means

gene expression occurs only if a regulator molecule directly stimulates RNA production

Negative control means

gene expression occurs unless it is shut off by some sort of regulator molecule

Neomorphic

gene product has a different function

Alternative splicing

generation of different forms of mRNA from identical pre-mRNA molecules, so that on gene can give rise to a number of proteins with similar or different functions

The Ames test assays various chemicals that may affect human health by causing mutations in ______

genes

"Do you hate it when your DNA gets all tangled and coiled ahead of your replication fork? If so, lets journey ahead together and fix these problems together"

gyrase

A metabolic reaction requires 10 units of enzymatic activity to proceed. If a dominant allele "D" can generate 8 units of enzyme and a recessive allele "d" can generate 2 units of enzyme, is the dominant allele haplosufficient or haploinsufficient?

haploinsufficient (half is not enough)

A metabolic reaction requires 40 units of enzymatic activity to proceed. If a dominant allele "D" can generate 40 units of enzyme and a mutant allele "d" generates 20 units of enzyme, is the dominant wild-type allele haplosufficient or haploinsufficient?

haplosufficient (half is enough)

Hemizygote

having a gene with no allelic counterpart

Monomorphic

having or existing in only one form in the population; everyone in the population has the same allele at a particular locus

In 1928, Frederick Griffith established that _______.

heat-killed bacteria harbor the constituent(s) necessary to convey genetic properties to living bacteria. Because some of the nonvirulent bacteria acquired properties of the virulent bacteria, instructions for this transformation must be carried by the virulent bacteria.

"Looking for a good time. Someone to break my H-bonds and denature me"

helicase

What breaks H-bonds between bases and binds at the replication fork?

helicase

What separates the 2 strands of DNA in vivo?

helicase

What separates the 2 strands of DNA in PCR?

high temperatures

Mitochondria have small quantities of DNA within them with only one copy of each gene. A mutation in a mitochondrial DNA gene is found in a boy. Which other members of the family likely have the inherited mutation?

his mother and grandmother (Since sperm only deliver the nucleus, all organelles originate in the cytoplasm in the egg. Mitochondrial DNA is inherited from our mother.)

Cancer causing agents are frequently identified by their ability to cause mutations in bacteria (The Ames test). Briefly explain the connection between the ability to cause reversions in his- bacteria and the ability to cause cancer in humans.

his- bacteria need histidine supplemented since they have a mutation that prevents them from synthesizing it themselves. Reversions in his- bacteria colonies are caused by a mutation that reverses the original mutations. If a compound can cause a reversion, that means it must cause mutations. Mutations can lead to cancer in humans.

The nitrogenous bases of each nucleotide project into the double helix. They form complementary base pairs through the formation of _________ bonds with bases on the opposite DNA strand.

hydrogen

Gain of Function

hypermorphic and neomorphic; more gene product produced; increase in protein product or new function; often dominant

The amount of enzyme activity in a cell that is homozygous for a mutant allele is 600 units. The amount of enzyme activity in a cell homozygous for for the WT allele is 300 units. The amount of enzyme activity in a heterozygote is 450 units. What type of allele is the mutant allele?

hypermorphic because there is more expression and more gene product

NuMA is a protein involved in cell division in mice. A mutation in the promoter of the NuMA gene leads to weaker binding of transcription factors. What type of mutation (null, hypomorphic, neomorphic, etc.) is this?

hypomorphic, because you still get transcription, but at a much weaker level

Explain how these steps must be altered if you want to express the gene's protein in bacteria.

i. If you want to express the gene's protein in bacteria, you cannot use genomic DNA, and you cannot use a cloning vector, because a cloning vector does not contain a promoter sequence for RNAP to attach to, and even if it did contain a promoter sequence, using genomic DNA in bacteria would not give you the human protein product, because prokaryotes do not have splicing machinery. ii. First, take the mRNA from a cell where your gene is expressed (because in that cell there are the transcription factors to recognize the promoter and the upstream cis-regulatory elements of that gene, so there will be mRNA there). Make a cDNA library using reverse transcriptase. Add a TTTT primer to the mRNA, which will anneal to the Poly-A tail, and then from there, reverse transcriptase can synthesize a cDNA strand complementary to the mRNA strand, which will be only the coding sequence with no introns. After reverse transcriptase does that, RNase is added to the mixture to digest the ½ of the strand that is RNA, and then DNAPI is added to synthesize the other strand of DNA. iii. Isolate your gene of interest from this cDNA library using primers specific for that gene, and amplify it using PCR. When designing primers, include restriction sites at the 5' end so that they can be cut by restriction enzymes to be ligated into the cloning vector. iv. Cut the gene and the expression vector (which has a drug resistance, a promoter, a termination sequence, maybe even a start and stop codon, a MCS in the middle of the lacZ gene), and allow the two to come together anneal, then ligate them using DNA ligase which will seal the phosphodiester backbones of the two, which were cut by restriction enzymes, allowing the gene to be expressed v. Introduce the new, recombinant DNA molecule into bacteria via transformation, which can be done by permeablizing the membrane with a heat shock or with an electric shock to allow the bacteria to take up the plasmid vi. Plate the transformed bacteria on a plate with Ampicillin and Xgal. Any bacterial cells that did not take up the plasmid will die once plated, since they do not have the ampicillin resistance, but this does not necessarily mean that they have the gene of interest in them, because the vector may be an empty vector that closed up without taking up the gene. vii. To check for the gene, select white colonies, because white colonies mean that lacZ does not produce a functional protein to break down Xgal, which would turn blue if there was a functional protein, and because our MCS is in the middle of lacZ, if the plasmid has the gene of interest in it, it will disrupt lacZ. We can confirm this by selecting a white colony, then a blue colony and isolating them and allowing them to culture more, then isolating the recombinant DNA and then digesting the DNA with EcoR1 or whatever restriction enzyme was used, and then running a gel with the DNA fragments. If the gene of interest is there, 2 fragments will be seen on a gel, and if not, just one fragment viii. we can also verify if our gene of interest is in the plasmid through PCR and then running a gel. First we will isolate DNA. If we design a primer that is SPECIFIC to our gene of interest, and then we run a PCR with it and our DNA, if the gene of interest is in the plasmid, we will get many copies of it and we will see its bands after we run it through a gel. If the plasmid does not have the gene of interest, our primer will have nothfing to anneal to and because DNA polymerase must have a primer to replicate off of because it cannot just lay down nucleotides de novo, when we run a gel with a DNA product that does not have our gene of interest we will not get a band because either there is not enough DNA to see it on a gel because nothing was amplified, or there is just nothing at all. ix. Then, colonies that have the gene need to be tested for protein expression, and those that express the protein can be grown and the protein can be purified for use

Why would the first AUG not be a start codon?

if it doesn't create the longest polypeptide sequence

Silent mutation

if the point mutation alters a codon, but does not result in a change in the amino acid at that position

Come up with a list of mutations that you might find in the lac operon and hypothesize what effect they would have on the expression of the lac genes. Ignore CAP binding protein for now.

if you mutated the operator and changed a base, the repressor protein could not recognize it and bind to it and the enzymes would always be transcribed (OC), and RNAP will not be blocked if you mutated the promoter, RNAP cannot recognize it and if you don't recruit RNAP to the promoter the genes will not be transcribed (P-) if the repressor protein could not bind to the operator, the operon would be always transcribed because RNAP will not be blocked and could not be turned off (I-) if the repressor protein was mutated so that it could not bind to lactose and get changed so it couldn't get removed from the operator, and it continuiously blocks RNAP, the enzymes would never be transcribed (IS)

What is the role of the repressor in an inducible system and a repressible system?

in an inducible system, the repressor that normally interacts wit the operator to inhibit transcription is inactivated by an inducer, permitting transcription. In a repressible system a normally inactive repressor is activated by a corepressor, enabling it to bind and inhibit transcription

Where does RNAP bind in prokaryotes and eukaryotes?

in eukaryotes, it binds to transcription factor proteins on the TATA box of the core promoter, and in prokaryotes it binds to the -10 and -35 regions of the core promoter; RNAP always binds in the promoter

Why is the final mRNA often shorter than the DNA gene that coded for it?

introns removed

I- O+ Z+/F' I+ is constitutive, repressed, or inducible?

inducible because I+ is a diffusible trans acting factor and can bind to the wildtype operator

Contrast inducible from constitutive expression:

inducible expression is expressing a product (enzymes) only when a chemical substrate (inducer) is present to adapt to their environment, but constitutive expression is when enzymes are produced continuously, regardless of the chemical makeup of the environment

I+ O+Z+ Y+ With and without lactose and the effect on both Y and Z.

inducible for both

The lactose metabolism system is ____ while the tryptophan expression system is _____

inducible; repressible

What does the proximal promoter do?

influence efficiency and rate of transcription initiation by RNAPII by recruiting trans-acting factors

Regulatory region of a gene

information (bases, a sequence) on where and when a gene will be transcribed during development; usually upstream of the coding region, but can sometimes be downstream

How does the RNA polymerase know where to start transcribing a gene?

it recognizes the gene's promotor, a specific nucleotide sequence

A fly carries a loss of function mutation in an enzyme, which is responsible for adding the 7-methylguanosine residue to the hnRNA. Suggest 4 potential ramifications to the presence of this mutation:

it will not continue to get processed in the nucleus, because the cap is important for subsequent processing it is subject to nuclease attack, because the cap protects it it may not get transported out of the nucleus, because the cap is important to transport the mature mRNA across the nuclear membrane into the cytoplasm it may not be able to initiate translation because the 5' cap is important for the initiation

Haploinsufficient

just one copy will not produce a wildtype phenotype

A constitutive mutation in the lac operon may be of several types. Name two types of constitutive mutations.

lac I-, lac Oc

What is a mutation in the permease gene and what problem does this cause?

lac Y-; it doesnt let lactose into the cell, so lactose cannot be digested and used by the cell and therefore the cell cannot grow

What is the lacOc mutation?

lacO is the regulatory region of the gene and when mutations are here, the repressor cannot bind and enzymes are synthesized continuously; constitutive cis-dominant mutation

In the lactose metabolism system ______ is the inducer.

lactose

If lactose is present, what happens?

lactose binds to the repressor molecule and causes the repressor molecule to not be able to bind with operator DNA by causing an allosteric conformational change, so RNA polymerase can transcribe the structural genes and the enzymes necessary for lactose metabolism are produced

Okazaki fragments appear on the ____ strand during replication

lagging

The DNA strand that does NOT shorten at a telomere.

leading (It replicates in the same direction of replication fork and goes to the end. The lagging strand will have the last primer removed and will be shortened.)

The APOC3 gene is believed to inhibit the uptake of triglycerides from the blood into the liver. Thus, it keeps triglycerides in the blood. The APOC3 mutation described in the article is what type of mutation?

leaky/null mutation because when a mutation destroyed the function of this gene, it didn't work (loss of function)

Hypomorphic

less gene product; leaky

What are the molecular players in translation?

mRNA tRNA ribosome (small and large subunits, and A, P, and E sites) amino acids aminoacetyl tRNA synthetase anti-codon codon release factors: help dissociate the complex when you get to the stop codon

Blocking the 3'UTR from shortening would lead to

mRNA stability

RNA processing contributes to ___________ which regulates translation.

mRNA stability,

What would happen if a mutation changed a start codon to some other codon?

mRNA transcribed from the stated gene would be nonfunctional because ribosomes would not initiate translation

Transcription is the synthesis of ________ using _______ as a template.

mRNA; DNA

What protects you from degradation of folate?

melanin in skin

Melanin is found inside melanosomes inside what cell type?

melanocytes

Prometaphase and metaphase of mitosis

migration of every chromosome to the equatorial plane Prometaphase: the period of chromosome movement Metaphase: the chromosome configuration following migration

Major differences between meiosis and mitosis

mitosis leads to the production of two cells, each with the same number of chromosomes as the parents, whereas meiosis reduces the genetic content and the number of chromosomes in half and meiosis leads to the production of sex cells, gametes. Mitosis is a one step process, while meiosis is a 2 step process. Mitosis produces 2 daughter cells, while meiosis produces 4 daughter cells. Mitosis has no synapsis (homologs coming together), while meiosis has synapsis.

Eukaryotic mRNA is ___________, while prokaryotic mRNA is ___________

monocistronic; polycistronic

Assume that a base addition occurs early in the coding region of a gene. Is the protein product of this gene expected to have more or fewer altered amino acids compared with the original gene with a base deletion late in the coding region?

more

Hypermorphic

more gene product

Does trisomy 21 happen in the mother or the father during gamete formation?

mother

Transposable sequences fall into a unique group of repetitive DNA sequences that are identified by their ability to __________.

move from place to place within the genome (move from one chromosomal site to another. The move might affect the function of genes they land in or leave from)

Two ways variation is created during transmission of information from one cell to another.

mutation and recombination (crossing over and independent assortment)

What would be predicted for a cell in which the repressor could not bind the inducer Is. Would an I+ rescue this? Why?

mutation in which the repressor molecule cannot bind to the inducer molecule, lactose, and as a result, the repressor would always bind at the operator and the structural genes would be permanently repressed. No, because if the binding site for lactose is altered, it couldn't be removed from the DNA

Haploid

n; a cell or an organism having one member of each pair of homologous chromosomes

Regulation of sucrose utilization in yeast is similar to lactose utilization in E. coli. They use the enzyme invertase break down sucrose, and invertase is not produced when glucose is available. Suc1 is a gene that encodes invertase and in an assay for Suc1 mRNA, it was found that the gene is not transcribed when glucose is present. You find a mutant Inv1 that makes invertase even when glucose is present. You mate this haploid mutant with a wildtype and the diploid progeny show normal invertase regulation. This data suggests that the Suc1 gene is ___________ regulated.

negatively (a repressor protein can bind and it is able to be turned off)

The repressor negatively or positively regulates the lac operon?

negatively because transcription will occur only in the absence of the repressor...protein is interacting with DNA to block transcription

DNA is ______________ charged and histones are ______________ charged allowing them to interact with DNA

negatively; positively

For the genotype, Is Oc Z-/ F' I s O+ Z+ what would happen to ß-galactosidase?

never made at normal levels; can say non inducible

Adenine, guanine, cytosine and thymine are

nitrogenous bases.

Are all genes in the prokaryote expressed at all times?

no

DNA polymerase requires an RNA primer to initiate DNA replication. Does RNA polymerase require such a primer?

no

Do prokaryotes have nucleosomes?

no

In mitosis, do homologous chromosomes ever pair?

no

Can we predict relative genome size based on the complexity of the organism?

no (Plants have the largest genome, but are not necessarily the most complex organism)

Are the number of genes proportional to genome size?

no (There is a lot of noncoding DNA in the human genome and repetitive DNA in the genome that doesn't necessarily code for anything. The genome is the complete set of DNA in an organism...all of the genetic material)

Do all eukaryotic promoters have a TATA box?

no (consensus)

I- O+ Z+ /F 'I+ with no lactose. Is a functional, nonfunctional, or no enzyme made?

no enzyme made because with lactose absent, the normal repressor will bind to the operator because it is a diffusible product

Is O+ Z+ /F' O+ with no lactose. Is a functional, nonfunctional, or no enzyme made?

no enzyme made because with this mutant I gene, the repressor cannot be removed from the operator even if lactose was present

Amorphic

no gene product produced at all; null

Johnny is studying the gene that codes for amylase, an enzyme that is found in saliva. He is curious about what happens if he moves certain cis elements of the gene. Predict the transcriptional outcome of the following manipulation: He inverts the orientation of the promoter

no transcription

Johnny is studying the gene that codes for amylase, an enzyme that is found in saliva. He is curious about what happens if he moves certain cis elements of the gene. Predict the transcriptional outcome of the following manipulation: He moves the promoter 100 bases upstream of its usual position

no transcription because a promoter has a fixed position because its position determines where transcription starts

Do silencers have to be adjacent to a gene?

no, they can be upstream, downstream, in introns, etc

Type of transcription: Is

non inducible

How can mosaicism arise other than through Barr bodies?

nondisjunction during mitosis in somatic cells

How do Kleinfelter's and Turner's syndrome arise and when?

nondisjunction of sex chromosomes in meiosis

What type of enzyme is made with lactose and I- O+ Z-?

nonfunctional

What type of enzyme is made with no lactose and I- O+ Z-?

nonfunctional

I- O+ Z- with lactose. Is a functional, nonfunctional, or no enzyme made?

nonfunctional enzyme made since I is constitutive and Z is mutant

I- O+ Z- with no lactose. Is a functional, nonfunctional, or no enzyme made?

nonfunctional enzyme since I is constitutive and Z gene is mutated

The majority of repetitive sequences are

nongenic and thus serve no function

Type of transcription: Y-

noninducible

Type of transcription: Z-

noninducible

Johnny is studying the gene that codes for amylase, an enzyme that is found in saliva. He is curious about what happens if he moves certain cis elements of the gene. Predict the transcriptional outcome of the following manipulation: He inverts the orientation of the enhancer

normal transcription

Johnny is studying the gene that codes for amylase, an enzyme that is found in saliva. He is curious about what happens if he moves certain cis elements of the gene. Predict the transcriptional outcome of the following manipulation: He moves the enhancer 100 bases upstream of its usual position

normal transcription

In eukaryotes, DNA and its associated proteins are called:

nucleosomes

The building blocks of DNA are

nucleotides

The genetic material DNA consists of basic subunits called ________.

nucleotides

What are cis-acting factors composed of?

nucleotides

DNA is comprised of four different types of ________. Each one is made up of a pentose _________, a ________ group, and one of four _________

nucleotides; sugar; phosphate; nitrogenous bases.

In which cellular organelle do the three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes occur?

nucleus

Where would you find spliceosomes in the cell?

nucleus (this is where RNA processing takes place)

A mutation resulting in an inactive gene product is classified as

null/amorphic (loss of function)

Interphase of mitosis

occurs between each division process and the DNA of each chromosome is replicated here. DNA is not replicated the whole time while in interphase though, and that time is devoted to cell growth and differentiation

What is a DNA ligase?

once DNA polymerase I clips out the RNA primers and replaces the missing nucleotides with deoxyribonucleotides, DNA ligase joins the Okazaki fragments by catalzing the formation of the phosphodiester bond that seals the nick between the discontinuously synthesized strands

Haplosufficient

one copy of an allele is "enough" to produce a normal function; half is enough

How many different restriction enzymes are there?

over 3500

What kind of bond is formed between successive amino acids during translation?

peptide bonds

During elongation, amino acids are brought close together because they are bound to tRNAs in the P and A sites. What kind of bond forms between the two amino acids and what catalyzes this reaction?

peptide bonds; the rRNA of the large subunit

In the presence of lactose, are the structural genes constitutive, permanently repressed or inducible with Is O+ Z+/F' I+?

permanently repressed (super repressor...gain of function mutation)

In the presence of lactose, are the structural genes constitutive, permanently repressed or inducible with Is O+ Z+?

permanently repressed...non-inducible (super repressor)

Regulation of sucrose utilization in yeast is similar to lactose utilization in E. coli. They use the enzyme invertase break down sucrose, and invertase is not produced when glucose is available. Suc1 is a gene that encodes invertase and in an assay for Suc1 mRNA, it was found that the gene is not transcribed when glucose is present. A haploid mutant fails to transcript invertase under any condition. You isolate the genome of this yeast mutant and you find the Suc1 gene unaltered, but find a mutation in a gene that encodes a transcription factor. Taken together, all of you data suggest that Suc1 is ___________________ regulated

positively (turns on when it is acted on by the transcription factor)

telomeres

preventing chromosomes from losing base pair sequences at their ends. They also stop chromosomes from fusing to each other; .found at the ends of the chromosome; repetitive DNA strands; they shorten over time and as they shorten, cells age and eventually die

What is a gyrase?

prevents supercoiling, which is what happens as unwinding proceeds and it is increased coiling that creates tension. It makes small cuts in the strands and catalyzes localized movements that have the effect of undoing the twists and knots created during supercoiling.

The core promoter functions in eukaryotes like the ______________ in prokaryotes, which is where RNA polymerase II binds the DNA and begins copying DNA into RNA.

promoter

You wish to create a mutation in which you prevent access of RNA polymerase to the gene. Which region of a gene would you target?

promoter sequence, because that is where RNAP binds

Transcription factors

proteins that bind to cis-regulating elements and can increase or decrease levels of transcription in response to different signals (also called regulatory factors or trans-acting factors)

The other three cis elements in eukaryotes other than the core promoter are regulatory and affect

proximal promoter elements, enhancers, and silencers influence the efficiency or the rate of transcription initiation by RNPII.

Adenine and guanine, which have a nine-member double-ring, are called

purines.

Cytosine and thymine, which have a six-member single-ring, are called

pyrimidines.

What two macromolecules make up ribosomes?

rRNA and protein

Complexes brought to the 3' untranslated region (UTR) cause poly A tails to shorten which leads to

rapid degradation

Tom has one wildtype allele and one mutant allele for a blood protein gene. As a result, there is only about 50% of the protein expressed compared to normal protein levels. Tom bruises easily and has numerous small hemorrhages internally. The wildtype allele is

recessive and haploinsufficient (the heterozygote has a mutant phenotype, and it is haploinsufficient, becuase with only one wildtype allele, he only produces 50% of the protein product, so half is not enough)

Chiasmata

refers to the structure, when viewed microscopically, of crossed chromatids.

Open reading frame

region of transcribed mRNA; a nucleotide sequence organized as triplets that encodes the amino acid sequence of a polypeptide, including an initiation codon and a termination codon

Result of nondisjunction in meiosis II (what types of chromosomes are together in gametes?)

sister chromatids are together in gametes (homozygous duplicate)

Why can't normal activity in the lac operon be restored in an Oc by adding an O+ in an F' plasmid?

regulation depends on the presence of an O+ region immediately adjacent to the structural genes; a cis-acting regulator; Oc is cis-dominant

What do snRNAs do?

remove introns from pre-mRNA by catalyzing the splicing process; part of the spliceosome

Green Fluorescent Protein

reporter gene we can see in living tissues to learn about gene expression. When this gene is expressed, we see a green signal because the protein product emits a green light

Nucleosomes assembled on the TATA box of a gene would __________.

repress transcription

to turn down the expression of genes encoding enzymes that are not needed.

repress transcription

Is O+ Z+/F' I+ is constitutive, repressed, or inducible?

repressed and not inducible (super repressor)

Is O+ Z+ is constitutive, repressed, or inducible?

repressed...not inducible (super repressor!)

When tryptophan is present in the environment, enzymes that are involved in tryptophan production are not manufactured. If trypophan is absent, these enzymes are then synthesized. This illustrates the concept of _____________- enzymes.

repressible

How does DNA methylation regulate gene activity?

repressing transcription by inhibiting the binding of transcription factors to DNA

Anaphase of mitosis

sister chromatids separate and migrate to the opposite sides of the cell

gain of function mutation

results in a gene product with enhanced or new functions; protein product increases in abundance

What are the 3 major cellular classes of RNA that function during the expression of genetic information?

ribosomal RNA, messenger RNA, transfer RNA

where does the translation of cytoplasmic proteins take place?

ribosomes

Where have we seen RNA and protein complexed?

ribosomes, spliceosomes, telomerase

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky?

single-stranded complementary tails

What are the components of the spliceosome?

snRNA and proteins

What type of cells does X inactivation occur in in mammals?

somatic cells

In the lac operon, the product of structural gene lacZ is capable of ________.

splitting the β-linkage of lactose

Mutations that arise in nature, from no particular artificial agent, are called ________.

spontaneous mutations

What is a single stranded binding protein?

stabilize the open conformation after it is opened by helicases

During translation, what molecule bears the anticodon?

tRNA

Are mature mRNAs used in transcription, translation, or RNA processing?

translation

The discontinuous aspect of replication of DNA in vivo is caused by ________.

the 5' to 3' polarity restriction of the DNA polymerase III

Where on the lac operon does CAP bind?

the CAP-binding site, which is in the promoter

When histones are acetylated, ______________

the DNA is less tightly associated with histones

What is a negative control in the Ames test?

the His gene mutated in a plate with not mutagen, so we expect no revertants

What is a wild type allele?

the allele that is more common

If we look at the same gene in different cell types, we will see:

the exact same DNA, including the promoter and all of its cis regulatory elements, but different trans acting regulatory factors are acting on the cis elements; same polymerase

What is the process of synthesizing proteins from mRNA sequences?

translation

What is a way to change the expression of genes without changing the actual DNA sequence?

the genome structure and the packing of DNA either tightly, or not tightly

The more GR receptor proteins present in the brain, ________________

the greater the ability to recover from stress.

What is the lacI- mutation?

the lacI gene is the repressor gene, and so the repressor protein is not made and enzymes are synthesized continuously; constitutive mutation

What is ribosomal RNA?

the largest kind of RNA and constitutes about 80% of RNA in the cell; important structural component of ribosomes, which are important "workbenches" where proteins are synthesized during translation

What is the relationship between organism complexity and space between genes?

the more complex the organism, the more base pairs between genes that do not code for proteins (Repetitive and noncoding...there are a bunch of base pairs that do not code for proteins)

Summarize what two factors are in tension that drove human evolution of skin color variation:

the need to protect ourselves from most UV radiation, but also the need to use the UVB to our advantage

What was the negative control in the Avery, MacCleod, and McCarty experiment?

the negative control is where there will be no response that you expect, so in this case the negative control was the sample where no components destroyed, because the response they were looking for was the transformation blocking

Where are chromosomes found in eukaryotes?

the nuclei of the cells

What does n equal?

the number of UNIQUE chromosomes

The haploid number is

the number of unique chromosomes in gametes after meiosis.

The phenotype of an organism is __________.

the observed features of an organism (Different combinations of alleles may produce different phenotypes.)

Why did Hershey and Chase use phage?

the only 2 parts of it are DNA and protein

What is the dispersive model of DNA replication?

the parental strands are cleaved during replication and are dispersed into two new double helices following replication, and each new strands consists of old and new DNA

On a DNA strand, the 5' end of the backbone binds to which group?

the phosphate group

What happens if glucose is present in the lac operon?

the presence of glucose determines whether cAMP levels are high or low and if glucose is present the cell doesn't need to metabolize lactose for energy and the presence of glucose results in low levels of cAMP and without cAMP, CAP cannot bind to the CAP-binding site and help RNAP bind to the promoter and the transcription of the lac operon is inefficient

What inhibits the activity of adenyl cyclase and what is the consequence?

the presence of glucose inhibits the activity and when this happens, the enzyme adenyl cyclase cannot catalyze the conversion of ATP to cAMP, and in order for CAP to bind at the CAP binding site and facilitate RNAP binding, CAP and cAMP must complex.

Explain the sex ratio question

the presence of heteromorphic sex chromosomes in one sex of a species but not the other provides a mechanism for equal proportions of males to females in the population, but this is not the case because today, about 1.7 men are born for every 1.0 woman that is born, suggesting that the assumptions of: • Males producing equal numbers of X and Y bearing sperm • Each type of sperm has equivalent viability and motility • The egg surface is equally receptive to both the X and Y bearing sperm are false and at least one of them is broken. The Y chromosome is smaller than the X chromosome (less information), and therefore less mass, making it more motile and having a greater probability of fertilizing an egg.

Meiosis

the process of cell division in gametogenesis or sporogenesis during which the diploid number of chromosomes is reduced to the haploid number; cells formed by meiosis receive only one chromosome each chromosome pair; this reduction in chromosome number is essential if the offspring arising from the fusion of egg and sperm are to maintain the constant number of chromosomes characteristic of their parents and other members of the species

Which strand has the promoter sequence embedded in it?

the promoter is on both strands, but the coding strand has the +1 and -35 and -10 specifically labeled (5' upstream)

We see negative regulation for the lac operon when

the repressor protein does not bind to the operator and this is when the inducer, lactose, is bound to the repressor

The process, performed by the ribosome, of reading mRNA and synthesizing a protein is called

translation.

What if there was a mutation in the repressor gene such that it could no longer bind the operator (I-). Predict/explain phenotypic consequence on transcription of the structural genes:

the repressor protein product has been altered and so the structural genes are always transcribed and there are always enzymes produced, even in the absence of lactose.

Where does the translation of secreted proteins take place?

the rough ER (for cells that are transported out of the cell, like insulin, and they are packaged into vesicles)

The FEI gene is expressed in roots, but not leaves of Arapod seedlings. SHOU gene is expressed in the flowers of the leaves. FEI has ________________ cis regulatory elements in the leaf and root cells. The nuclei of root and leaf cells have _____________ transcription factors. The FEI promoter in a root cell has ____________ cis-regulatory elements when compared to the SHOU promoter.

the same; different; different

We see positive regulation for the lac operon when

there is NO glucose in the system, which allows the formation of the cAMP-CAP complex, which then binds to the CAP-binding site of the promoter, which then recruits RNA polymerase to bind to the RNA-polymerase site of the promoter

In the lac operon, when the repressor protein is bound to the operator ____

there is no transcription of the 3 structural genes because the action of RNA polymerase is inhibited, and no enzymes are produced

If loss of PitX expression in the pelvis of freshwater sticklebacks is the reason they don't have pelvic spines, then putting PitX into freshwater sticklebacks will cause:

these fish to develop pelvic spines.

How did they find the specific switches for the PitX1 gene in sticklebacks?

they cut DNA sequences into fragments in the regulatory region of the PitX gene and attached them to a green reporter gene, then injected those fragments into stickleback eggs and after testing many different fragments, they wanted to find one that caused the sticklebacks to glow green in the pelvis, and this was the stretch of DNA that had the PitX1 switch for the pelvic region because the pelvic region had the transcription factors to recognize the switch

How are the proteins in the bacterial genome different from histones?

they do not wrap the DNA as tightly

If we look at two different genes in one cell, we will see:

they have different cis-acting regulatory elements and different trans acting elements; same polymerase

What is different about RNA polymerases in prokaryotes from eukaryotes?

they recognize different sequences, which just comes down to the fact that trans and cis-factors are different for different organisms

What does it mean when we say the genetic code is non-overlapping?

three nucleotides in mRNA (a codon) specify one amino acid in a protein. The code is non-overlapping. This means that successive triplets are read in order. Each nucleotide is part of only one triplet codon.

The role of the primers in PCR is _______.

to define the target region and provide a 3' end that can be extended by taq polymerase because polymerase cannot initiate DNA synthesis on a template. Primers bind to end of the target DNA strands, then taq polymerase synthesizes a new strand using the target DNA as a template.

What is the function of the spliceosome?

to recognize introns and remove them

What is the function of the snRNA in the spliceosome?

to recognize the sequences of introns

What binds ahead of the replication fork and breaks covalent bods in DNA backbone?

topoisomerase (breaking this bond allows the DNA to swivel around the corresponding bond in the other strand and relieves the strain caused by the unwinding of the DNA at the helicase)

What is the trans-acting molecule and the cis-acting site in the lac operon?

trans-acting molecule is the repressor protein and the catabolite activator protein and the cis-acting site is the operator and the promoter and CAP binding site

RNA synthesis from a DNA template is called __________.

transcription (Transcription is initiated when the cell signals for the expression of a particular gene and involves the synthesis of RNA from a DNA template.)

What do activators do?

transcription factor that increases levels of transcription; some activators bind near the promoter and recruit chromatin remodeling complexes. Another way activators affect transcription is to make direct contact with GTFs and enhance or inhibit the ability to associate with the promoter. Others bind to enhancers. May increase rate of DNA unwinding within the gene and accelerate the release of RNAP from the promoter into the transcribed region of the gene Help regulate gene expression at the level of transcription

Each cell is a different environment, and thus has a different set of _________________ that may or may not bind the regulatory elements of different genes.

transcription factors

Regarding eukaryotic and prokaryotic genetic regulation, what process seems to be the most similar between the two?

transcriptional regulation

While there are many different kinds of cloning vectors, let's focus on bacterial plasmids. The name of the process to get a plasmid into a bacterial cell is called

transformation

When a gene from a bacterium is inserted into a corn plant, we would call this corn plant a ______ organism.

transgenic

Cytosine deaminates and becomes uracil which then pairs with adenine. Does deamination result in a transition or a transversion?

transition

Deamination causes what kinds of mutations?

transition mutations

When three nucleotides are bound together we call this a

trinucleotide

T/F: A typical XX human female has one Barr body.

true

T/F: An individual with Turner syndrome has no Barr bodies.

true

T/F: Taq polymerase is used in PCR because it is heat stable

true

T/F: The E. coli chromosome is circular and double-stranded DNA. (E. coli is a bacterium)

true

True or false. Most eukaryotic genes contain introns.

true

True or false. Some mRNAs are degraded within minutes and others last for years.

true (The lifetime of mRNAs can vary widely between different mRNAs and can be regulated in response to the needs of the cell...regulates how much protein product the mRNA can make)

T/F: Many chemicals are more mutagenic after being processed in the liver and why

true, becasue a chemical may not be mutagenic, but the byproducts of it are mutagenic, and when the liver breaks it down and metabolizes it, it releases the byproducts (Many potential mutagens are poorly mutagenic until passing through the liver)

euchromatin

uncoiled, non-staining part of the chromosome; majority

Is O+Z+ Y+ With and without lactose and the effect on both Y and Z.

uninducible

Regulation of sucrose utilization in yeast is similar to lactose utilization in E. coli. They use the enzyme invertase break down sucrose, and invertase is not produced when glucose is available. Suc1 is a gene that encodes invertase and in an assay for Suc1 mRNA, it was found that the gene is not transcribed when glucose is present. A haploid mutant fails to transcript invertase under any condition. This makes Suc1 _______________

uninducible

How do we use PCR to obtain the gene of interest in recombinant DNA technology?

we can use primers specific to the GH gene to target it and use PCR to amplify just that gene out of the genome and we will have tons of copies of it

The lac repressor is allosteric. What does this mean?

when it binds to lactose, lactose changes the conformation of it so it can no longer bind the at the operator

When is a frameshift mutation the most serious?

when it occurs early in the sequence

Termination of translation

when it reaches the stop codon, since there is NO tRNA that comes with an anti-codon and an amino-acid, a small protein (signal release factor) comes and then the complex dissociates. There is no tRNA that recognizes a stop codon

2 specific things that promoters specify:

where transcription begins and the direction of transcription

When you are cloning a fragment into a plasmid, and you plate your transformed bacteria on plates containing Xgal and amp, which colonies will you be interested in choosing?

white colonies

You have transformed bacteria with a plasmid that hopefully contains the gene for human insulin. To confirm, you perform a blue/white screen. To be extra sure, you also do a PCR using primers specific to the insulin gene followed by gel electrophoresis. Successfully transformed bacteria with a plasmid containing the insulin gene will be _________ on the plate and produce _______ bands on a gel.

white; one

Predict the level of gene expression of the lac operon, as well as the status of the lac repressor and the CAP protein when bacterial growth media contain lactose but no glucose

with lactose, the lac repressor is inactivated and the operon is transcribing the structural genes. With no glucose, CAP is bound to the CAP-binding site and thus enhancing transcription because we want glucose and to get glucose we want to transcribe the lacZ gene, which encodes for ß-galactosidase, which converts lactose to glucose and galactose

Predict the level of gene expression of the lac operon, as well as the status of the lac repressor and the CAP protein when bacterial growth media contain no lactose or glucose

with no glucose or lactose, the operon is off because the lac repressor is bound to the operator and even though CAP is bound to the CAP-binding site, it will not override the repressor's actions

Predict the level of gene expression of the lac operon, as well as the status of the lac repressor and the CAP protein when bacterial growth media contain glucose but no lactose

with no lactose, the lac repressor is bound to the operator and since glucose inhibits adenyl cyclase, the CAP protein will not interact with its binding site and the operon is off

Do prokaryotes have operators?

yes

Do prokaryotes have promoters?

yes

Is ligase needed in vivo?

yes

What enzyme hydrolyzes lactose to glucose and galactose?

ß-galactosidase

For the genotype, I- Oc Z-/ F' I- Oc Z-what would happen to ß-galactosidase?

ß-galactosidase is not made at normal levels; can say that it is non-inducible

For the genotype, I - Oc Z+/ F'I - O+ Z-, what would happen to ß-galactosidase?

ß-galactosidase would always be made and the one normal copy is enough to make enough ß-galactosidase in the cell

For the genotype, I + O+ Z+/ F' I - O+ Z+ what would happen to ß-galactosidase?

ß-galactosidase would be made when there is lactose

There are two mechanisms that bacteria can use that promote RNA polymerase dissociating from the DNA and RNA, they are:

• there is a unique sequence that is transcribed into RNA that causes the newly formed RNA transcript to fold back on itself, forming a secondary hairpin structure held together by hydrogen bonds • the termination factor, rho, a large protein that physically interacts with the RNA transcript

Why is the gene for insulin transcribed in 𝛽-cells in the pancreas but not in skin cells?

𝛽-cells have the transcription factors necessary to recognize the insulin promoter and induce transcription of the insulin gene. Skin cells do not.