Biology: Molecular Genetics
What is a gene?
(Unit of inheritance) It is a small segment of DNA in a chromosome where its specific sequence of nucleotides codes for one polypeptide with a specific sequence of amino acids. There are many genes along the length of a DNA molecule.
Mutations (extra)
- Change in gene structure, chromosome structure or chromosome number - Changing the sequence of bases in a gene --> changes the mRNA sequence made --> changes the amino acid sequence made --> changes how the protein folds (if 3D structure of protein changes, function changes) - Mutations can be good, bad or neutral E.g. Sickle cell anaemia - Cause: point mutation of GAG to GTG of the haemoglobin gene - 6th amino acid changed from Glutamic acid → Valine - Changes how haemoglobin folds - RBC become sickle shaped - Reduced oxygen carrying ability
Social and ethical implications of genetic engineering: Golden Rice
- Golden rice is transgenic plant (containing genes from other species of organisms; beta-carotene gene from corn and soil bacteria) - Created using genetic engineering and biotechnology methods - Beta-carotene is precursor (inactive substance converted to active one) of vitamin A and found in edible parts of the rice; beta-carotene is converted to vitamin A in human body Background: - Philippines: poor country, peope consume diets low in vitamin A - Vitamin A deficiency causes blindness - White rice (low in vitamin A) is their staple (standard) food Benefits: - Reduces suffering due to vitamin A deficiency + reduce blindness especially in children and females - Less expensive alternative vs vitamin supplements, for people in poorer nations - Rice is staple food in Philippines, consumption of golden rice helps supplement cheap source of vitamin A - Genetic engineering of transgenic organisms can help combine beneficial traits from 2 organisms - Research has shown proteins from new genes in GR do not cause allergies Controversy/concerns: - Earlier strains of GR had low amounts of vitamin A; problem solved by developing new strains of rice with higher amounts of vitamin A - Use of GR opens door to more widespread use of GMOs (genetically modified organisms) which hold risks that may not be understood - Some religious individuals feel creation of transgenic organisms is similar to "playing God" - If transgenic plant contains animal genes, vegetarians may not want to consume (NA for GR) Another e.g.: Bt corn - Gene from bacterium (Bacillus thuringiensis) introduced into corn plant - The corn plant produces proteins that can kill insect pests - Bt corn is considered GMO (genetically modified organism)
Recombinant DNA technology (key ideas)
- Take the gene-of-interest & insert into plasmid - Plasmid is used as vector to introduce gene into bacteria - Bacteria then produce useful protein product from this gene - The protein product can be harvested, purified & used [Combining DNA from 2 different species produces recombinant DNA] [Organism that has received foreign DNA from another species is called TRANSGENIC organism] [If protein product is not needed, just want to insert a gene into organism --> do usual steps to get RECOMBINANT BACTERIA, then introduce bacteria directly into target organism (eg. maize plant)]
Describe the structure of DNA. (essay question)
1. The basic unit of DNA (deoxyribonucleic acid) is a nucleotide. 2. A nucleotide consists of a phosphate, a deoxyribose sugar and a nitrogenous base. 3. There are 4 types of bases in DNA: Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). 4. There is a complementary base-pairing in this manner: A with T and C with G. 5. The ratio of A:T is 1:1, and the ratio of C:G is 1:1. 6. The base-pairs interact via hydrogen bonds. 7. Nucleotides are bonded to each other via strong covalent phosphodiester bonds, to form a polynucleotide strand. (Each polynucleotide strand has a sugar-phosphate backbone with nitrogenous bases projected at right angles) - sugar-phosphate backbones of both strands lie on the outside of the DNA molecule whereas the nitrogen bases point towards the centre of the molecule 8. Two polynucleotide strands run in an antiparallel direction to each other, one strand in a 5' to 3' direction, the other strand in a 3' to 5' direction (opposite directions) 9. The two strands are brought close to each other via the hydrogen bonds between bases on opposite strands. 10. The two strands twist to form a double helix structure.
Describe the process of protein synthesis.
1. Transcription occurs in the nucleus 2. Transcription is where DNA makes mRNA (genetic information encrypted on the DNA is relayed from the nucleus to the cytoplasm in the form of a messenger RNA (mRNA) molecule) 3. Template strand is used to make mRNA, after DNA is unwound 4. RNA polymerase catalyses the transcription process 5. mRNA has exited the nucleus via nuclear pore into cytoplasm where translation occurs 6. Translation is when mRNA is used to synthesis protein (occurs at ribosomes attached to the surface of the rough endoplasmic reticulum) 7. Ribosome binds to mRNA and reads it 3 bases at a time 8. Each set of 3 bases is called a codon 9. One codon codes for one amino acid 10. Amino acids are added to the growing polypeptide chain, one at a time 11. The polypeptide folds into a 3-dimensional structure that is a protein (RER packages proteins into vesicles and transports to Golgi body...)
What are hydrogen bonds?
A strong intermolecular force between the hydrogen atom and fluorine, oxygen or nitrogen.
Input the mRNA sequence for the CODING DNA sequence below: ATGTCGCTGATACTGT
AUGUCGCUGAUACUGU Coding strand is non-template strand, exact same as mRNA strand except thymine is changed to uracil (Transcription)
What is an amino acid, and how is it related to polypeptides?
Amino acids are individual molecules which are the building blocks of proteins, and amino acids are linked together by peptide bonds to form polypeptides.
What are visible, discrete structures? (i.e. chromosomes under the microscope when stained)
Chromosomes can be seen as individual, separate entities rather than an indistinct mass.
Synthesis of human insulin by bacteria
Context: - Type 1 diabetes mellitus: chronic condition, pancreas produces little or no insulin - Insulin: hormone needed to regulate blood sugar levels - Patients with Type 1 diabetes mellitus must receive intravenous (within vein) injections of insulin proteins routinely - Animal insulin protein: can be extracted and purified from pancreas of animals but no ideal as it is not identical to human insulin + diseases and allergens can be transferred from animals to humans (some can be allergic to animal insulin) Process: 1) Human insulin gene is isolated from human chromosome; ends of gene are cut by restriction enzyme to generate sticky ends 2) Bacterial plasmid (double-stranded DNA in circular form) is isolated from bacterial plasmid donor; serves as a vector which will carry DNA fragments into host cell; plasmid is cut by same restrictive enzyme to generate same sticky ends 3) Sticky ends on human insulin gene and bacterial plasmid are complementary to each other and can bind to each other 4) DNA sugar-phosphate backbones between bacterial plasmid and insulin gene are repaired using DNA ligase, creating recombinant plasmid (plasmid containing human insulin gene) 5) Bacterial cell is induced to take up recombinant plasmid through process called transformation; bacterial cells are either heat shocked or applied with electrical current to make cell walls and membranes permeable so that recombinant plasmid can enter bacterial cell 6) After transformation, bacterial cells are plated on agar-coated petri dish containing antibiotics and incubated at suitable temperature (37 degree celsius) overnight for screening; bacterial plasmid often carries antibiotic resistant gene that confers bacterium resistance against particular antibiotic; transgenic bacteria that have taken up recombinant plasmid would grow and form distinct colony of cells on antibiotic-containing agar; those that have not taken up recombinant will not grow, no resistance (to get rid of them) 7) Successfully transformed bacteria containing insulin gene are cultured and multiplied in fermenter industrially 8) Human insulin mRNAs are transcribed from human insulin DNA on recombinant DNA plasmid inside bacterial cells; they are then translated by bacteri
How are chromatin fibres formed?
DNA is wound/coiled around 8 histone protein molecules to form a nucleosome. Nucleosomes join together and the string of nucleosomes ("beads on a string" structure) coils to form the chromatin fibre. DNA normally exists are chromatin in the nucleus.
What is the role of DNA in protein synthesis?
DNA located in the nucleus contains the genetic information for the manufacture of proteins such as enzymes. These proteins are involved in the metabolic activities of the cell.
What are the differences between DNA and RNA?
DNA: - Double stranded - Basic unit: deoxyribonucleotide - Deoxyribose sugar - Nitrogenous bases: Adenine, Thymine, Cytosine, Guanine (ATCG) - Ratio of A:T is 1:1, ratio of C:G is 1:1 - One type - Relatively larger in size - Amount: constant in all cells of same species (except multi-nucleated cells, dividing cells and gametes - Bulk found in nucleus, some in mitochondria and chloroplasts - Relatively stable, permanent molecule found in cell RNA: - Single stranded - Basic unit: ribonucleotide - Ribose sugar - Nitrogenous bases: Adenine, Uracil, Cytosine, Guanine - No fixed ratio of A:U or C:G - More than 1 type - Relatively smaller in size - Amount varies between cells depending on transcription levels/rate - Bulk found in cytoplasm, some in nucleus (place of synthesis) - Relatively unstable, temporary molecule that is synthesised only when required
Describe the structure of RNA. (including the functions of the 3 main types of RNA)
Each RNA molecule is usually single stranded (except for RNA in some viruses) Structurally similar to a single strand of DNA except: - 5-carbon ribose sugar instead of deoxyribose sugar - Uracil nitrogenous base instead of thymine 3 main types of RNA: mRNA - messenger RNA, carries information from a gene to the ribosome for translation rRNA - ribosomal RNA, forms part of the ribosomal complex tRNA - transfer RNA, brings a specific amino acid to the ribosome to be added to the growing polypeptide chain
Input the complementary sequence of nucleotides for the DNA sequence below: CGTAAGCGCTAATTA
GCATTCGCGATTAAT (Complementary base pairing rule: G pairs with C, A pairs with T)
What is the genetic code? (explain how sequence is read)
It describes the relationship between the sequence of DNA bases (A, C, G and T) in a gene and the corresponding protein sequence that it encodes. The sequence of bases in DNA determines the sequence of amino acids in a protein. The ribosome reads the sequence of the gene in groups of 3 consecutive bases. Every 3 consecutive bases form a codon which specifies an amino acid. There are 64 different codons, 61 specify amino acids while the remaining 3 are used as stop signals for translation. (how the information contained in DNA and RNA molecules is translated into the sequence of amino acids in proteins)
What is "The Central Dogma"?
It is the flow of genetic information from DNA through RNA to protein.
What is transcription?
It is the process by which a gene is copied to form a piece of messenger RNA (mRNA)
What is translation?
It is the process by which genetic information on the messenger RNA (mRNA) is read by a ribosome to synthesis a polypeptide
What is genetic engineering and how is it effective?
It is the process of using recombinant DNA (rDNA) technology to alter the genetic makeup (genome) of an organism. Genes can be transferred from one organism to another organism of the same species or a different species. It involves the direct manipulation of one or more genes. It is often used to insert a gene from another species to an organism's genome to give the organism a desired phenotype. As the genetic code is universal, the inserted gene can control the production of the desired protein even in a different organism.
What are complementary base-pairings? (elaborate on ratio and hydrogen bonds)
It is where each type of nitrogenous base on one strand forms hydrogen bonds with a different type of base on the opposite strand. Adenine pairs only with thymine, forming 2 hydrogen bonds Cytosine pairs only with guanine, forming 3 hydrogen bonds (within DNA molecule) % of A = % of T, and % of C = % of G
Input the protein sequence encoded by the mRNA: AUGGCGAUUGGGCUAUACGUC
Met-Ala-Ile-Gly-Leu-Tyr-Val (Translation)
Break up the word pentose.
Pen = 5 Tose = sugar
What is a nucleotide?
Pentose (5-carbon) sugar + phosphate (PO4 3-) + nitrogenous base It is a molecule formed by atoms of carbon (C), hydrogen (H), oxygen (O), nitrogen (N) and phosphorus (P) DNA: deoxyribose sugar RNA: ribose sugar Phosphate group gives nucleic acid its acidic properties Nitrogenous base is attached to the 1'-carbon atom of central pentose sugar Phosphate base is attached to the 5'-carbon atom of central pentose sugar
Input the mRNA sequence for the TEMPLATE DNA sequence below: AATGAATAGCTAGCTT
UUACUUAUCGAUCGAA mRNA strand is complementary to template strand, with thymine replaced by uracil T to A A to U C to G (Transcription)
What are proteins?
They are polypeptide chains folded into a three-dimensional shape which determine the presence of a trait in an organism.
What are chromatin fibres?
They are structures found in the nucleus in which genetic material, in the form of deoxyribonucleic acid (DNA) molecule, is organised.
What are nucleic acids? (types, structure)
They form the genetic material of all living organisms. There are two types, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). They are macromolecules made up of basic units called nucleotides. Multiple nucleotides are covalently joined /bonded via phosphodiester linkages to each other to form a polynucleotide strand. Phosphate group of nucleotides give it its acidic properties
What are transgenic organisms?
They possess a gene or genes that have been transferred from a different species.
Why is DNA coiled around histones? (i.e. benefits of histones)
To organise DNA, for quick access in cellular processes (e.g. earpiece)
What is the relationship between chromatin fibres and chromosomes?
When a cell prepares for nuclear division, the chromatin fibres coil further and fold up (condenses) to form compact structures called chromosomes. A chromosome can contain many genes.
continuation
bacterial ribosomes to synthesise human insulin protein 9) Human insulin proteins made by bacteria are subsequently isolated and purified by crystallisation
