Biomed Test

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?

38%

PvuII is a restriction enzyme that cuts a DNA at the sequence CAG CTG. How many fragments of DNA will be present after the following DNA sequence is cut with PvuII? A T T A C A G C T G T T C C A G C T G G T A T C T C A G C T G A A C A G C T T A A T G T C G A C A A G G T C G A C C A T A G A GT C G A C T T G T C G A

4

If the following DNA sequence was cut using the restriction enzyme KB502, how many pieces of DNA would be made? KB502 restricts at the end of the sequence TCCG, this enzyme cleaves after the G. ATAACGCCTCCGAAACTATCTCCGATCCGAATCCGACCGATTCA

5

Restriction enzymes (such as HaeIII) are used to:

Cut DNA at certain locations

The basic structural unit of DNA is called a nucleotide, which is composed of the following:

Phosphate group, deoxyribose molecule, nitrogenous base

Which are purines and pyrimidines?

Purines- Adenine and guanine Pyrimidines- Thymine and cytosine

If the sequence of a DNA strand is ATCGTTACGAAA, what would its complimentary strand be?

TAGCAATGCTTT

DNA has been extracted from a brother (age 17) and a sister (age 23). Which of the following is true regarding their RFLPs (restriction fragment length polymorphisms)?

Their RFLPs will be different from each other.

Gel electrophoresis can be used to:

create DNA fingerprints

RFLPs (restriction fragment length polymorphisms) represents:

different lengths of DNA fragments

Who stated that A always equal to T and C will always equal to G?

erwin chargaff

What type of chemical bond is found between paired bases of the DNA double helix?

hydrogen

What characteristic separates DNA fragments during gel electrophoresis?

length of fragment

PCR (polymerase chain reaction) is used to:

make many copies of small amounts of DNA

Scientists are able to produce millions of copies of a specific DNA sequence from a small amount of DNA through

polymerase chain reaction (pcr)

When running a gel electrophoresis, DNA will migrate towards the ________ end because DNA has a __________________ charge.

postive, negative