Biomed test Unit 1

¡Supera tus tareas y exámenes ahora con Quizwiz!

This person answers a call leading to an emergency

911 operator

purines

Adenine and Guanine

The pills found at the crime scene were

Asprin/ Acetylsalicylic acid

Pyrimidines

Cytosine and Thymine

Which person is responsible for providing short term care and to take them to the hospital

EMT

The last name of the person who is famous for an x-ray showing DNA's structure

Franklin

What is used to help determine the time of death?

Glastier Equation

Clear prediction of the anticipated results of an experiment.

Hypothesis

Which of these terms are in the correct order of smallest to largest?

Nucleotide, DNA, Gene, Chromosome

Scientists are able to produce millions of copies of a specific DNA sequence from a small amount of DNA through

Polymerase chain reaction

Biomedical Science

The application of the principles of the natural sciences, especially biology and physiology, to clinical medicine.

What is the last name of the person who discovered which nitrogenous bases pair together? His base pairing rules are named after him.

chargaff

Which of the following is NOT found in DNA?

chromosome

In an experiment the measured effect, outcome, or response in which the research is interested is called the:

dependent variable

When you drink water, this is the system it enters your body through.

digestive

Two types of PPE that must be worn when working with chemicals in the Biomedical Sciences classroom are goggles and earplugs

false

The smaller the DNA fragment, the

further it moves down the gel

Worn by researchers, csi, police investigators

gloves

The organ that is central to the cardiovascular system

heart

Which of these is not a manner of death?

heart attack

Which of these is not a cause of death?

homicide

A toxicologist does NOT do which one of these?

perform an autopsy on a body

What is the purpose of the filter when performing DNA extraction on strawberries?

seperates the cell debris from the DNA

The deer species DNA separates differently, creating varying RFLP's. Why?

sequence of bases in the DNA

What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?

the negative charge of the phosphate groups

what systems main role is waste removel

urinary

The double helical structure of DNA was discovered in 1953 by the scientists

watson and crick

A certain restriction enzyme cuts DNA at the following sequence: TTAA AATT If we used this enzyme to cut following piece of DNA, then how many RFLPs would there be? CCGAATTATGCTTAACGAATGCCCGATACTTAAGC GGCTTAATACGAATTGCTTACGGGCTATGAATTCG

3

Which of the following best illustrates the increasing levels of complexity? (1) Cells; (2) Organs; (3) Organelles; (4) Organism; (5) Tissues; (6) Organ systems

3,1,5,2,6,4

1. Collect Evidence 2. Conduct Interviews 3. Protect the Crime Scene 4. Photograph the crime scene

3,4,1,2

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?

38%

Alicia wants to find out how much weight a person will gain as a result of eating Halloween candy. She will use a volunteer set of quintuplets (5 identical siblings) and each one will eat an equal mass of a different candy. The first child eats 4 kg of Hershey's chocolate. The second child will eat 4 kg of candy corn. The third will eat 4 kg of Skittles. The fourth will eat 4 kg of Hot Tamales. And the last child will eat no candy. Alicia will weigh each child prior to the candy eating, and again after 3 days. She will record the amount of weight gain for each child. These children will not be allowed to be active in any way, so that they will not accidentally lose weight. Alicia's data is in the table below... How much weight the children gain is the independent variable

False

Which of the following bases is a purine?

Guanine

What is the minimum education needed to be a Morgue Examiner?

High school or GED degree

In DNA profiling by gel electrophoresis, DNA is separated on the basis of?

Number of Base Pairs

An examination of the body after death that includes a dissection of vital organs to determine the cause of death is a (an)

autopsy

Restriction endonucleases or enzymes are produced naturally by:

bacteria

What evidence found at the crime scene would contain DNA?

blood

The name of the system that pumps blood around the body.

cardiovascular

An asthmatic would have difficulty getting oxygen into which system?

cardiovasular

What do you add to get the DNA to precipitate out of solution, and form a layer on top?

cold alcohol

The part of the experiment where the independent variable being tested is not applied, so that it may stand as a standard for comparison

control group

Given the DNA strand GAATTCCTCGAG, what would be the complimentary strand to make the double stranded DNA?

cttaaggagctc

In the DNA isolation lab, what was the purpose of the detergent?

dissolve the cell and nuclear membrane

A blood stain pattern that is round, flat and has no tail, pulled by gravity towards the floor

drip or passive stains

This body system includes the adrenal glands and the pancreas

endocrine

Joe McCleod, who is a recent college graduate, has been admitted to the ER for treatment. He "opted out" of communications with family and friends and specifically indicated that nothing about his condition or treatment was to be discussed with his parents. Unable to learn what is happening with their son, Mr. & Mrs. McCleod ask their friend, Dr. Steve, who isn't involved in Joe's care, to review Joe's records. Dr. Steve reviews the records and informs Joe's parents that Joe has hepatitis B and shows signs of drug abuse. Were proper procedures followed when sharing information with Joe's parents? True = yes False = No

false

Julie, a hospital clinic employee, was in a car accident and brought by ambulance to the ER. Her physicians discovered that she was pregnant. Julie's clinic co-worker, Sarah, found out Julie was in the ER and called to ask about her condition. Sarah was told Julie suffered minor bruises and cuts, but was stable. Did the ER follow proper procedures in releasing information to Sarah? yes = true no = false

false

What type of chemical bond is found between paired bases of the DNA double helix?

hydrogen

This is the body system affected if you get a paper cut on your finger.

integumentary

This system protects you from pathogens and foreign substances in the body.

lymphatic

Very tiny characteristics in fingerprint ridge patterns used to identify the identity of an individual

minutiae

When is bloodstain pattern analysis typically used

murder investigations

The system responsible for movement

muscular

The three types of tissue that make up this system are skeletal, cardiac, and smooth

muscular

Which body system is most closely associated with information assessment?

nervous

DNA is a polymer, a large molecule made of repeating units or monomers called

nucleotides

DNA is a very large molecule (a polymer) made up of a long chain of repeating sub-units called

nucleotides

Which of these is NOT a job description of a Forensic DNA Analyst?

perform an autopsy on a body

What does PPE stand for?

personal protective equipment

When running a gel electrophoresis, DNA will migrate towards the ________ end because DNA has a __________________ charge.

positive,negative

Genes contain instructions for assembling

proteins

This system meets up with the cardiovascular system in the lungs (blood vessels attached to the lungs)

respiratory

Which body system is most closely associated with transport and delivery? Nervous

respiratory

DNA is cut at specific nucleotide sequences by

restriction enzymes

Which body system is most closely associated with the support and protection of the body organs?

skeletal

Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel ______________ through the gel.

slower than the smaller fragments

What characteristic separates DNA fragments during gel electrophoresis?

the length of fragment

A blood spatter can be high, medium or low velocity in shape, and is determined by the direction of travel.

true

On her way to morning rounds, Betty is approached by Dr. Steve, who hurriedly sticks a note in her hand before going to another exam room. Betty is a bit surprised to see that an invitation for drink and dinner is written on the back of a patient's lab report. "Really!?" Betty thinks to herself before throwing the crumpled note into the nearest trash bin. Is this a violation of HIPPA, yes or no? True = yes False = No

true

Two reasons for wearing PPE when forensic scientists analyze a crime scene are to not tamper with the evidence and to not get their fingerprints on anything.

true


Conjuntos de estudio relacionados

Physical Science Test Review: Chapter 4, Sections 1-3

View Set

Bible 700 - Unit 3: The Attributes of God QUIZ 2: ATTRIBUTE OF MERCY

View Set

Entrepreneurship and Starting a Small Business

View Set

ASDV 2520: Final Study Guide (Chapter 18, 19, 20, 21, 22, 23, 24, 25, 30)

View Set

Embryology Test 2 Practive from BRS

View Set

Online Homework 5- Organic Molecules

View Set

Skill in Context Journeys Unit 1 Week 3 My Librarian is a Camel

View Set