Biomed test Unit 1
This person answers a call leading to an emergency
911 operator
purines
Adenine and Guanine
The pills found at the crime scene were
Asprin/ Acetylsalicylic acid
Pyrimidines
Cytosine and Thymine
Which person is responsible for providing short term care and to take them to the hospital
EMT
The last name of the person who is famous for an x-ray showing DNA's structure
Franklin
What is used to help determine the time of death?
Glastier Equation
Clear prediction of the anticipated results of an experiment.
Hypothesis
Which of these terms are in the correct order of smallest to largest?
Nucleotide, DNA, Gene, Chromosome
Scientists are able to produce millions of copies of a specific DNA sequence from a small amount of DNA through
Polymerase chain reaction
Biomedical Science
The application of the principles of the natural sciences, especially biology and physiology, to clinical medicine.
What is the last name of the person who discovered which nitrogenous bases pair together? His base pairing rules are named after him.
chargaff
Which of the following is NOT found in DNA?
chromosome
In an experiment the measured effect, outcome, or response in which the research is interested is called the:
dependent variable
When you drink water, this is the system it enters your body through.
digestive
Two types of PPE that must be worn when working with chemicals in the Biomedical Sciences classroom are goggles and earplugs
false
The smaller the DNA fragment, the
further it moves down the gel
Worn by researchers, csi, police investigators
gloves
The organ that is central to the cardiovascular system
heart
Which of these is not a manner of death?
heart attack
Which of these is not a cause of death?
homicide
A toxicologist does NOT do which one of these?
perform an autopsy on a body
What is the purpose of the filter when performing DNA extraction on strawberries?
seperates the cell debris from the DNA
The deer species DNA separates differently, creating varying RFLP's. Why?
sequence of bases in the DNA
What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?
the negative charge of the phosphate groups
what systems main role is waste removel
urinary
The double helical structure of DNA was discovered in 1953 by the scientists
watson and crick
A certain restriction enzyme cuts DNA at the following sequence: TTAA AATT If we used this enzyme to cut following piece of DNA, then how many RFLPs would there be? CCGAATTATGCTTAACGAATGCCCGATACTTAAGC GGCTTAATACGAATTGCTTACGGGCTATGAATTCG
3
Which of the following best illustrates the increasing levels of complexity? (1) Cells; (2) Organs; (3) Organelles; (4) Organism; (5) Tissues; (6) Organ systems
3,1,5,2,6,4
1. Collect Evidence 2. Conduct Interviews 3. Protect the Crime Scene 4. Photograph the crime scene
3,4,1,2
Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?
38%
Alicia wants to find out how much weight a person will gain as a result of eating Halloween candy. She will use a volunteer set of quintuplets (5 identical siblings) and each one will eat an equal mass of a different candy. The first child eats 4 kg of Hershey's chocolate. The second child will eat 4 kg of candy corn. The third will eat 4 kg of Skittles. The fourth will eat 4 kg of Hot Tamales. And the last child will eat no candy. Alicia will weigh each child prior to the candy eating, and again after 3 days. She will record the amount of weight gain for each child. These children will not be allowed to be active in any way, so that they will not accidentally lose weight. Alicia's data is in the table below... How much weight the children gain is the independent variable
False
Which of the following bases is a purine?
Guanine
What is the minimum education needed to be a Morgue Examiner?
High school or GED degree
In DNA profiling by gel electrophoresis, DNA is separated on the basis of?
Number of Base Pairs
An examination of the body after death that includes a dissection of vital organs to determine the cause of death is a (an)
autopsy
Restriction endonucleases or enzymes are produced naturally by:
bacteria
What evidence found at the crime scene would contain DNA?
blood
The name of the system that pumps blood around the body.
cardiovascular
An asthmatic would have difficulty getting oxygen into which system?
cardiovasular
What do you add to get the DNA to precipitate out of solution, and form a layer on top?
cold alcohol
The part of the experiment where the independent variable being tested is not applied, so that it may stand as a standard for comparison
control group
Given the DNA strand GAATTCCTCGAG, what would be the complimentary strand to make the double stranded DNA?
cttaaggagctc
In the DNA isolation lab, what was the purpose of the detergent?
dissolve the cell and nuclear membrane
A blood stain pattern that is round, flat and has no tail, pulled by gravity towards the floor
drip or passive stains
This body system includes the adrenal glands and the pancreas
endocrine
Joe McCleod, who is a recent college graduate, has been admitted to the ER for treatment. He "opted out" of communications with family and friends and specifically indicated that nothing about his condition or treatment was to be discussed with his parents. Unable to learn what is happening with their son, Mr. & Mrs. McCleod ask their friend, Dr. Steve, who isn't involved in Joe's care, to review Joe's records. Dr. Steve reviews the records and informs Joe's parents that Joe has hepatitis B and shows signs of drug abuse. Were proper procedures followed when sharing information with Joe's parents? True = yes False = No
false
Julie, a hospital clinic employee, was in a car accident and brought by ambulance to the ER. Her physicians discovered that she was pregnant. Julie's clinic co-worker, Sarah, found out Julie was in the ER and called to ask about her condition. Sarah was told Julie suffered minor bruises and cuts, but was stable. Did the ER follow proper procedures in releasing information to Sarah? yes = true no = false
false
What type of chemical bond is found between paired bases of the DNA double helix?
hydrogen
This is the body system affected if you get a paper cut on your finger.
integumentary
This system protects you from pathogens and foreign substances in the body.
lymphatic
Very tiny characteristics in fingerprint ridge patterns used to identify the identity of an individual
minutiae
When is bloodstain pattern analysis typically used
murder investigations
The system responsible for movement
muscular
The three types of tissue that make up this system are skeletal, cardiac, and smooth
muscular
Which body system is most closely associated with information assessment?
nervous
DNA is a polymer, a large molecule made of repeating units or monomers called
nucleotides
DNA is a very large molecule (a polymer) made up of a long chain of repeating sub-units called
nucleotides
Which of these is NOT a job description of a Forensic DNA Analyst?
perform an autopsy on a body
What does PPE stand for?
personal protective equipment
When running a gel electrophoresis, DNA will migrate towards the ________ end because DNA has a __________________ charge.
positive,negative
Genes contain instructions for assembling
proteins
This system meets up with the cardiovascular system in the lungs (blood vessels attached to the lungs)
respiratory
Which body system is most closely associated with transport and delivery? Nervous
respiratory
DNA is cut at specific nucleotide sequences by
restriction enzymes
Which body system is most closely associated with the support and protection of the body organs?
skeletal
Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel ______________ through the gel.
slower than the smaller fragments
What characteristic separates DNA fragments during gel electrophoresis?
the length of fragment
A blood spatter can be high, medium or low velocity in shape, and is determined by the direction of travel.
true
On her way to morning rounds, Betty is approached by Dr. Steve, who hurriedly sticks a note in her hand before going to another exam room. Betty is a bit surprised to see that an invitation for drink and dinner is written on the back of a patient's lab report. "Really!?" Betty thinks to herself before throwing the crumpled note into the nearest trash bin. Is this a violation of HIPPA, yes or no? True = yes False = No
true
Two reasons for wearing PPE when forensic scientists analyze a crime scene are to not tamper with the evidence and to not get their fingerprints on anything.
true
