Chapter 13 Learning Curve

Only 2.5 percent of the human genome actually codes for proteins. The other 97.5 percent includes: A. noncoding RNA. B. repetitive DNA. C. introns. D. All of other answer options are correct.

D. All of other answer options are correct.

Transposable elements are: A. proteins that can move outside of the nucleus. B. proteins that can move into the nucleus. C. DNA sequences that can insert themselves into RNA. D. DNA sequences that can insert themselves into new positions within the genome. E. None of the answer options is correct.

D. DNA sequences that can insert themselves into new positions within the genome.

The most likely origin of human HIV1 virus is a related virus that infects: A. horses. B. cats. C. sheep. D. chimpanzees. E. cows.

D. chimpanzees.

The enzyme reverse transcriptase synthesizes: A. DNA from RNA. B. RNA from DNA. C. proteins from RNA. D. proteins from DNA. E. None of the answer options is correct.

A. DNA from RNA.

The C-value paradox is the disconnect between genome size: A. and organismal complexity. B. and gene ratio. C. within the same species. D. and gene size. E. and protein ratio.

A. and organismal complexity.

A cell in which viral reproduction occurs is called a: A. host cell. B. daughter cell. C. sex cell. D. somatic cell. E. None of the answer options is correct.

A. host cell.

Whole genome sequencing is often approached by a shotgun sequencing technique in which large genomes are: A. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order. B. digested in a few specific spots, large fragments are sequenced, and the overlapping sequences are assembled in order. C. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from largest to smallest. D. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from smallest to largest. E. All of these choices are correct.

A. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order.

What was the goal of the Human Genome Project? A. sequencing every gene in the human cell B. identifying every gene in the human sex cell C. identifying every gene in the human somatic cell D. sequencing every protein in the human sex cell E. identifying every protein in the human somatic cell

A. sequencing every gene in the human cell

Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called _____ repeats. Repeated sequences in eukaryotic genomes can also be spread throughout the genome, and are called _____ repeats. A. tandem; dispersed B. dispersed; tandem C. overlapping; adjacent D. adjacent; overlapping E. None of the answer options is correct.

A. tandem; dispersed

DNA supercoils that result from overwinding produce _____ supercoils. A.negative B. positive C. constant D. neutral E. charged

B. Positive

The coding region of mRNA is called an _____, whereas the noncoding region is called a(n) _____. A. intron; exon B. exon; intron C. exon; open reading frame D. intron; transposable element E. intron; sequence motif

B. exon; intron

This enzyme is responsible for breaking the backbone on the DNA double helix. Please choose the correct answer from the following choices, and then select the submit answer button. A. ligase B. topoisomerase II C. transcriptase D. supercoilase E. polymerase

B. topoisomerase II

Which of the following statements is true regarding a genome? A. Genomes always contain DNA. B. Genomes are composed of chromosomes. C. Genomes are "heritable," or passed from parents to offspring. D. Only prokaryotic and eukaryotic organisms possess genomes. E. All of these choices are correct.

C. Genomes are "heritable," or passed from parents to offspring.

A small infectious agent that contains a nucleic acid genome packaged inside a protein coat is called a(n): A. archaeon. B. tRNA. C. virus. D. bacterium.

C. Virus

Sequence assembly is accomplished by: A. aligning the fragments in the laboratory by running them through gel electrophoresis. B. aligning the fragments on paper. C. aligning the fragments by using a complex computer program. D. aligning the fragments by joining histones. E. None of the answer options is correct.

C. aligning the fragments by using a complex computer program.

In the eukaryotic DNA sequence below, the highlighted repeat is a tandem repeat. It is also what other kind of repeat? CACACACACACACACA CACACACACACACACACACACA A. long terminal repeat B. short terminal repeat C. simple sequence repeat D. dispersed repeat E. transposon repeat

C. simple sequence repeat

The region of DNA sequences before the start of a gene is often called the promoter. One type of promoter is called the TATA box. Many species' promoters are TATA boxes or a variation of the TATA box. DNA sequences that are similar in different organisms are called _____ sequences. A. convergent B. adjoined C. conjugate D. conserved E. transposable

D. conserved

In the hierarchical packaging of eukaryotic DNA, the 30 nm fiber is formed from: A. the coiled chromatin fiber. B. double-stranded DNA. C .the metaphase chromosome. D. double-stranded DNA packaged with nucleosomes. E. None of the answer options is correct.

D. double-stranded DNA packaged with nucleosomes.

Repeated sequences make genome sequencing challenging for of all of the following reasons except: A. repeated sequences are typically longer than the short sequences obtained by automated sequencing. B. there is no easy way to determine how many copies of the same repeat are present within one chromosome. C. short repeats may fold back upon themselves to form a double-stranded structure that is not easily sequenced. D. the long repeats often have mutations that are not easily sequenced. E. All of these choices are correct.

D. the long repeats often have mutations that are not easily sequenced.

Viruses come in several shapes. All of the following are shapes of viruses except: A.icosahedral. B. helical. C. spiral. D. triangular. E. head and tail.

D. triangular.

Retrotransposons are a class of transposable elements that: A. uses ribosomes as an intermediate. B. uses protein as an intermediate. C. uses DNA as an intermediate. D. uses RNA as an intermediate. E. replicate and transpose via DNA replication and repair.

D. uses RNA as an intermediate.

A researcher annotating the rabbit genome would describe: A. non-coding DNA. B. tandem or dispersed repeats. C. intron/exon boundaries in genes. D. DNA encoding hairpin RNAs. E. All of these choices are correct.

E. All of these choices are correct.

The genome of a virus can contain which of the following? A. genes that code for surface proteins B. genes that code for components of the capsid C. genes that code for reverse transcriptase D. genes that code for proteases E. All of these choices are correct.

E. All of these choices are correct.

Which of the following are sequence motifs? A. open reading frame B. hairpin structures C. promoters D. coding region E. All of these choices are correct.

E. All of these choices are correct.

Knowing an individual's DNA sequence may be beneficial because it makes it possible to predict: A. susceptibility to disease. B. response to medications. C. physical differences. D. the occurrence of a disease. E. All of these choices are correct.

E. All of these choices are correct.-

_____is the process by which researchers identify various types of sequences. A. Karyotype synthesis B. The C-value paradox C. Comparative genomics D. Chromosome condensation E. Genome annotation

E. Genome annotation

Imagine that a researcher is comparing the sequence of several protein-coding genes among mice, rabbits, and humans. She finds that, for most of these genes, the rabbit sequences are more similar to the human sequences than are the mouse sequences. What can she deduce? A. Mice and humans share a more "recent" common ancestor than do rabbits and humans. B. Mice and rabbits do not share a common ancestor. C. No similar proteins exist in mice and humans. D. Humans and mice do not share a common ancestor. E. More sequences are conserved between rabbits and humans than between humans and mice.

E. More sequences are conserved between rabbits and humans than between humans and mice.

Imagine that a researcher discovers a new type of virus. This virus contains single-stranded RNA with "negative" sense. Which of the following statements is true regarding this virus? A. This virus must use reverse transcriptase to produce mRNA. B. Based on the presence of single-stranded RNA, this virus likely behaves as an adenovirus. C. According to the Baltimore system, this virus would be classified as a type VII virus. D. This virus will likely have a larger genome compared to a DNA-containing type II virus. E. None of the answer options is correct.

E. None of the answer options is correct.

An arrangement of homologous pairs of chromosomes in order from longest to shortest is called: A. chromosome painting and numbering. B. a nuclear genome. C. chromosome numbering. D. chromosome painting. E. a karyotype.

E. a karyotype.

In the eukaryotic DNA sequence below, which type of repeat is highlighted? ATTATTTACTAATCCT (CATCATCATCATCAT) GGAATTCATAATGCTAATGG A. long terminal repeat B. tandem repeat C. short terminal repeat D. dispersed repeat E. simple sequence repeat

E. simple sequence repeat

All DNA sequences are transcribed into RNA. True or False

False

All DNA sequences are transcribed into RNA. Please choose the correct answer from the following choices, and then select the submit answer button. True or False

False

In eukaryotes, genome size is a good predictor of gene number and organismal complexity. True or False

False

The majority of both plant and animal viruses have been discovered, and their genomes have been annotated. True or False

False

Transposable elements make up about 75 percent of the DNA in the human genome. Please choose the correct answer from the following choices, and then select the submit answer button. True or False

False

When a genome is annotated, researchers identify all of the protein-coding genes and assign each protein with a function. True or False

False

it is always true that the larger the organism, the more genes the organism will have in its genome. True or False

False

DNA wraps around histone proteins to form units called _____.

Nucleosomes

"Shotgun" sequencing involves aligning many small sequences from a genome based on sequence similarities. True or False

True

Except for identical twins and other monozygotic multiple births, the genome sequence is different in every individual. True or False

True

Two major types of transposable elements are those that transpose via a DNA intermediate and those that transpose via an RNA intermediate. True or False

True