Chapter 21: Genomes and Their Evolution

What did the Cambrian explosion consist of

-sudden appearance of fossils resembling all modern animals -first evidence of predator/prey -

What was the Miller-Urey experiment?

-tested the Onarin-Haldan experiment -numerous amino acids had formed under conditions that stimulated a volcanic eruption -alkaline vents, high temp/pressure, mineral compounds may form organic compounds

Gene Density and Noncoding DNA

Eukaryotes generally have larger genomes but fewer genes in a given number of base pairs. Humans have hundreds or thousands of times as many base pairs in their genomes as most most bacteria, as you have already noted but only 5 to 15 times as many genes; thus gene density is lower in humans

What is a shared ancestral character?

OLD -originated in an ancestor of the taxon, shared by all members ex) backbone

Genome Size

The total amount of DNA contained within one copy of a single genome

Metagenome

The total gene content of the organisms present in an environment

Bioinformatics

The use of computers, software, and mathematical models to process and integrate biological information from large data sets.

Exon Shuffling

The variation in the patterns by which RNA may produce diverse sets of exons from a single gene.

Sometimes...

a newly identified sequence will match at least partially, the sequence of a gene or protein and other species whose function is well known

a-lactalbumin

a nonenzymatic protein that plays a role in milk production in mammals

TPA (tissue plasminogen activator)

a powerful chemical that dissolves blood clots in vessels supplying the brain Is thought to be a product of exon shuffling in the wat that it may have arise by several instances of exon shuffling and duplication

what is a hybrid zone?

a region in which members of a different species meet and mate producing an offspring of mixed ancestry

How do prions, which are misfolded proteins, infect organisms?

Prions enter brain cells and cause normal forms of the protein to refold into the prion form.

whole-genome shotgun approach

Procedure for genome sequencing in which the genome is randomly cut into many overlapping short segments that are sequenced; computer software then assembles the complete sequence.

what is speciation?

Process by which one species splits creating a new species

Order of who ruled the earth?

Prokaryotes Eukaryotes then oxygen revolution and thats when organisms began to change

Genetic Profile

an individual's unique set of genetic markers use STR analysis to determine, can be used to identify individuals (such as crime scene)

Cladistics ingroup and outgroup comparisons

an outgroup is a species from an evolutionary lineage that is closely related to BUT not part of the group of a species that we are studying (ingroup)

What is adaptive radiation?

comes after something happened, survivors have to adapt to their new environment

BLAST is a computational tool used by genome biologists to _____.

compare a given DNA or protein sequence to all other DNA or protein sequences in a database

What is the ecological species concept?

how members of a species interact with non-living and living parts of the environment (adaptation)

fossils illustrate

how new features arise and how long it takes for such features to occur

what is taxonomy?

how organisms are named and classified

Therefore we must study when and where are proteins are produced in an organism as well as

how they interact in networks , if we are to understantd the functioning of cells and organisms

CNVs and SNPs are useful for studying

human evolution

What does pattern mean in terms of Evolution?

it's revealed by data (facts)/observations about the natural world

what is balanced polymorphisms?

keep 2 or more alleles for a trait due to the advantage

What are stromalites?

layered rocks that form when certain prokaryotes bind thin films of sediment together

basal taxon represents

lineage that diverges early in history from the other groups; near the common ancestor

What is an extant?

living species (this eat the end of the branches)

copy-number variants (CNVs)

loci where some individuals have one or multiple copies of a particular gene or genetic region, rather than the standard two copies, one on each homolog

Larger multicellular eukaryote genomes have _______ gene density

lower, ex) humans have lowest gene density

the boundaries between eras correspond to...

major extinction events

What is repetitive DNA?

present in multiple copies in the genome

The DNA at telomeres is essential for

preventing genes from being lost as DNA shortens with each round of replication. Telomeric DNA also binds proteins that protect the ends of a chromosome from the degradation and from joining two other chromosomes. Short repetitive sequences like those described here provide a challenge for the whole-genome shotgun sequencing, because the presence of many short repeats hinder accurate reassembly of fragment sequences by computers.

What is artificial selection?

process of modifying other species over generations by selecting and breeding individuals that posses desired traits

What is Paedoorphosis?

retains body features that have juvenile structures but their reproductive organs accelerate

What is analogous?

same function, not due to common ancestry

What is Strata?

sedimentary rock layers

what is an Exaptation?

structures that evolve for one thing but become co-opted for a different function

Systems Biology is a very efficient way to

study emergent properties at the molecular level

Genomics

study of whole genomes, including genes and their functions

What are the types of chromosome mutations?

substitution insertion deletion inversion

Natural selection is based on _________ and _______ success

survival and reproductive

habitat differentiation and sexual selection can lead to _____ speciation, reasons?

sympatric 1. different food sources ex) flies 2. climate changes (light) ex) fish in lake

What is Hardy-Weinberg equilibrium?

states that shuffling alleles during meiosis and random fertilization does not change allele frequency in the population

What is a transposable element?

stretches of DNA that can move from one location to another within the genome

Transposable elements

stretches of DNA that can move from one location to another within the genome Genetic element that has the ability to move (transpose) from one site on a chromosome to another. Do transposition

What is used to construct phylogenetic trees?

systematics

How Systems are studied

systems biology approach model the dynamic behavior of whole biological systems, gene circuits and protein interation networks, microarrays, cancer project iin different stages to look at the entire organism as one body

transposons and retrotransposons

two types of eukaryotic transposable elements comprise about a lot of human genome

transposons

(jumping genes) short strands of DNA capable of moving from one location to another within a cell's genetic material; They move via a double-stranded DNA intermediate

GenBank

A database of previously sequenced and identified genes available through the NCBI

What did the Ediacaran period consist of

-age soft bodied organisms (filter feeders/algae) -modern day sponges/jellyfish

What does continental drift cause

-extreme changes in habitat or climate -allopatric separation

Permian mass extinction consisted of

-extreme volcanic activity -CO2 warmed the planet -95% of marine life perished

Evolution of Eukaryotic cells

-greater range of unicellular forms -had organelles -increased complexity of organisms

why have not all fossils have been discovered?

-many have been destroyed by geologic processes -only a few have been discovered

The Human Globin Genes

-multi-gene family -evolved by successive gene duplications

How many base pairs does the average bacteria and archaea range from?

1 to 6 million base pairs (Mb)

DNA fragment A consists of _____ base pairs.

1,268

What were the main advances of the Human Genome Project?

1. Instrumentation (faster sequencing) 2. Software (handle enormous datasets) 3. Commercial Kits (come remade/removes variability) 4. Internet (more available/lot of info) 5. Cheaper (less material)

Part A - Steps in shotgun sequencing What are the steps in the shotgun approach to whole-genome sequencing? Drag the labels to their appropriate locations on the flowchart. Only some labels will be used.

1. Multiple copies of the same chromosome are prepared 2. Chromosome copies are broken into 1-kb fragments. 3. 1-kb fragments are cloned into plasmids 4. The plasmids are sequenced. 5. A computer combines the fragment sequences.

5 conditions for Hardy-Weinberg Equilibrium Hint: 3 No's 2 Must's

1. No mutations 2. Random mating 3. No natural selection 4. Large population size 5. No gene flow

What are the 4 types of documentation?

1. Observation 2. Fossil record 3. Homology 4. Biogeography

Movement of Eukaryotic Transposable Elements

1. Transposons can move using a DNA intermediate (cut/copy and paste) 2. Retrotransposons move by means of RNA intermediate that is a transcript of a retrotransposon DNA. Leaves a copy at original site

conditions that allowed life to begin

1. abiotic synthesis of organic molecules (chemistry allows formation) 2. joining of these molecules formed macromolecules (by applying energy/lightening) 3. molecules packaged into protocells (resembles plasma membrane) 4. molecules began to self replicate

What are the limitations of the Biological species concept?

1. cannot evaluate the reproductive isolation of fossils 2. asexual organisms are not affected by repro isolation 3. no organisms can bring in or leave with their alleles

Natural selection is an ___________ mechanism. Selects for favorable traits already ____________ in a population.

1. editing 2. present

fossils are in favor of species that are...

1. existed for a long time 2. widespread 3. hard hard shells/skeletons

What can happen if duplication happens during meiosis?

1. genes can be duplicated 2. failure of homologs to separate; duplicate chromosomes = polyploidy 3. can mutate= new functions

What are the 3 mechanisms that cause microevolution to happen?

1. natural selection 2. genetic drift (chance mutation events) 3. genetic flow (transfer of individuals into/out of a population)

Good things to know for chapter 23

1. selection can only act on existing variants (new alleles cannot appear out of nothing) 2. limited by your ancestors 3. adaptations are usually a compromise (flexible but sprains)

3 key points of phylogenetic trees

1. shows descent, not phenotypic similarity 2. branching reflects pattern of descent not a timeline 3. did not evolve from adjacent taxon (both evolved from a common ancestor)

Genetic drift summary

1. significant in a small population 2. can lead to a loss of genetic variation

What percent of exons encodes regions for proteins?

1.5%

What percentage of the human genome is made up of exons?

1.5%

In how many positions are there nucleotide differences between your query sequence and the sequence of accession AY259214.1?

10

Humans have as much as

10,000 times as much as noncoding DNA as Bacteria

Other repetitive DNA

14% of the human genome consists of repetitive DNA due to resulting errors of replication. 1/3 of DNA consists of duplicated DNA from one location to another.

How long ago did bacteria, archaea, and eukaryotes diverge from each other?

2 and 4 billion years ago

What is allopolyploidy?

2 different species mate, hybrids are sterile ex) mules

hybrids are the result of _______

2 species breeding successfully

On which chromosome is the BCR gene normally located?

22

What is diploidy?

2n the state of having 2 chromosomes per somatic cell (1 mom, 1 dad)

There are about 4,300 completely sequenced genomes with

4000 genomes of Bacteria, 186 Archea, and 183 vertebrates

Gene regulatory sequences and introns account respectively for about

5% and 20% of the human genome

For the human genome, what percentage do regulatory sequences and introns account for?

5% and 20% respectively

The genomes of humans, rats, and mice contain alomost

500 regions of noncoding DNA that are identical in sequence for all three species

How long ago did humans and chimpanzees diverge?

6 million years ago

When did humans and mice diverge from one another?

65 million years ago

What percentage of human repetitive DNA is made up of transposable elements?

75%

Which segment of the normal ABL protein aligns with the query sequence? Provide your answer in this format: number of first amino acid, number of last amino acid. (For example, if the first amino acid is 23 and the last amino acid is 413, enter 23, 413.)

80,246

What percentage of the human genome does not code for proteins, rRNAs, or tRNAs?

98.5%

The gene FoxP2 has been evolving rapidly in humans, but not in primates. The wild type protein product of FoxP2 in mice is involved in _______. A. Vocalization B. Complex speech C. Damaging brain structure

A

Viruses like HIV most likely evolved from ______ because _________. A. retrotransposons; they encode reverse transcriptase B. transposons; they are mobile genetic elements C. retrotransposons; they always leave a copy at the original site during transposition D. transposons; they encode transposase E. transposons; they move via a "copy and paste" mechanism

A

What is the purpose of functional maps in systems biology? A. To organize genes and proteins by function. B. To learn more about Saccharomyces cerevisiae. C. To organize organs by function into body systems. D. To better understand each body system individually.

A

Which is a difference between the globin superfamily and lysozyme/alpha-lactalbumin? A. Lysozyme and alpha-lactalbumin have vastly different functions. B. Only the globin superfamily arose from gene duplication. C. The globin family came from one ancestral gene. D. Lysozyme and alpha-lactalbumin are not similar in their sequence or structure. Question 15

A

Homeobox

A 180-nucleotide sequence within homeotic genes and some other developmental genes that is widely conserved in animals. Related sequences occur in plants and yeasts. Codes for a 60-amino acid homeodomain in encoded proteins

simple sequence DNA

A DNA sequence that contains many copies of tandemly repeated short sequences. many of it located at chromosomal telomeres and centromeres suggests it plays a role in the structure of chromosomes

Simple Sequence DNA

A DNA sequence that contains many copies of tandemly repeated short sequences. Accounts for about 3% of human genomes ~ included in the other repetitive DNA category

multigene families

A collection of genes with similar or identical sequences, presumably of common origin.

Homeodomain

A conserved sequence of 60 amino acids used in the binding to DNA. Usually found in transcription factors, it is used to express genes that are related, more specifically in development to make tissues associated with one another.

What is a homeobox?

A gene code for a domain that allows a protein to bind to DNA and function as a transcription regulator. These are also known as Hox genes.

What is the FOXP2 gene?

A gene that contributes toward the production of language

What is a gene?

A genetic code for protein

ENCODE (Encyclopedia of DNA Elements)

A goal of the ENCODE Project is to link variations in the expression of certain genes to the development of disease. The ENCODE Project has given researchers insight into how the human genome functions

whole-genome shotgun sequencing

A method for determining the DNA sequence of an entire genome. After a genome is cut into small fragments, each fragment is sequenced and then placed in the proper order. It is widely used today

sequencing by synthesis (SBS)

A next-generation form of DNA sequencing in which the synthesis of DNA is directly monitored to deduce the base sequence. * Has resulted in massive increases in speed and decreases cost of sequencing a genome

The Cancer Genome Atlas (TCGA)

A project to sequence the genomes of many different cancers to identify the types of mutations that develop, , by comparing gene sequences and patterns of gene expression in cancer cells with those in normal cells

What is a short tandem repeat (STR)?

A series of repeating unites of about 2-5 nucleotides long.

expressed sequence tag (EST)

A short sequenced fragment of a cDNA sequence that can be used to identify an actively expressed gene. These tags are found by a software and are cataloged in computer databases. This type of analysis identifies sequences that may turn out to be previously unknown protein-coding genes.

single nucleotide polymorphism (SNP)

A single base-pair site in a genome where nucleotide variation is found in at least 1% of the population.

Gene Annotation

Analysis of genomic sequences to identify protein-coding genes in a sequence and determine the function of their products.

Select the true statements about genomes of bacteria, archaea and eukaryotes. A. Bacteria and archea have roughly the same genome size, both of which are smaller than eukaryotes. B. Eukaryotes have many more genes on average than prokaryotes. C. Animal genomes are larger than plant genomes. D. Genome size and gene density are negatively correlated. E. The number of genes positively correlates with body size.

A, B, D

Select the true statements regarding next-gen and shotgun sequencing. A. Both require the DNA to be cut up into small pieces. B. Shotgun sequencing is newer and faster. C. Both require the use of plasmids to amplify the DNA. D. Shotgun sequencing requires the use of plasmids for cloning, next-gen does not.

A, D

Which statements accurately describe the function of homeotic genes? A. To generate the individual identities of various body regions. B. To create the human body plan from an embryo. C. To generate developmental disabilities. D. To bind to DNA using the homeobox region. E. To regulate transcription of downstream genes.

A, D, E

What can be learned from comparing the genomes of distantly related species, such as yeast and humans, or plants and fruit flies? (Section 18.6) A. Conserved genes provide insight into their evolutionary relationships. B. Conserved genes indicate that they were transferred laterally from one species to the other. C. Genes found in humans but not in yeast provide insight into human evolution. D. All of the choices are correct. E. None of the choices is correct.

A. Conserved genes provide insight into their evolutionary relationships. right answer feedback:Genes present in both species can provide information about when they last shared a common ancestor, and insight into their evolutionary lineages.

Why might active transposons be rare in natural populations? (Section 18.5) A. Individuals with active transposons are usually eliminated by natural selection, because transposition events usually produce harmful mutations. B. Organisms do not wish to evolve new genes. C. The immune system attacks active transposons as foreign invaders. D. Multiple copies of a transposon suppress each other. E. Transposons have a dramatically higher rate of mutation.

A. Individuals with active transposons are usually eliminated by natural selection, because transposition events usually produce harmful mutations. right answer feedback:Any genomic mutation or rearrangement is far more likely to be harmful than beneficial.

Chromosomal rearrangements may be important in evolution because __________. (Section 18.5) A. chromosomal rearrangements lead to gene duplication, thus generating a "spare" copy of the gene that is free to evolve and acquire a new function B. chromosomal rearrangements cause new genes to evolve C. offspring who inherit two differently arranged sets of chromosomes instantly become a new species D. chromosomal rearrangements caused the extinction of dinosaurs, thereby allowing mammals to become dominant E. chromosome rearrangements may cause genetic diseases

A. chromosomal rearrangements lead to gene duplication, thus generating a "spare" copy of the gene that is free to evolve and acquire a new function right answer feedback:Multigene families arose through gene duplication events mediated by chromosome rearrangements.

The highly conserved sequence element present within homeotic genes is called the __________. (Section 18.6) A. homeobox B. globin C. TATA box D. Hox E. bicoid

A. homeobox right answer feedback:Similar or identical nucleotide sequences are found in homeobox segments from a wide range of organisms.

The advantage of copy-number variants (CNVs) over SNPs in human genomic studies is that CNVs __________. (Section 18.6) A. occupy much longer stretches of DNA than SNPs, and are likely to have greater phenotypic consequences B. provide reliable information about human genetic diversity C. occur only in noncoding DNA, which generally mutates at a constant rate and is more informative in measuring the genetic variation among human populations D. have revealed significant genetic diversity existing among different human populations at geographic locations both near and far apart E. are far greater in number but of equal size to SNPs

A. occupy much longer stretches of DNA than SNPs, and are likely to have greater phenotypic consequences right answer feedback:CNVs are loci that represent one or multiple copies of a gene or genetic region and therefore are informative both in terms of human diversity studies and also in the role of CNVs in human diseases.

The similarity of the homeobox in many different kinds of organisms is evidence __________. (Section 18.6) A. of the common ancestry of different life-forms B. of its recent origin C. of analogy D. that it is not responsive to natural selection E. of convergent evolution

A. of the common ancestry of different life-forms right answer feedback:Moreover, such conservation is evidence that the homeobox evolved early in the history of life, and was sufficiently valuable to have been conserved virtually unchanged for hundreds of millions of years.

Line-1 (L1)

About 6,500 base pairs long Generally have a low rate of transposition More active in developing brain, possibly contributes to neuron cell types 17% of human genome

large segment duplications

Account for about 5-6 % of the other repetitive DNA category. These are duplications of long stretches of DNA about 10,000-300,000 base pairs long. These long segments seem to have been copied from one chromosomal location to another site on the same or a different chromosome and probably include some functional genes

What are the 3 observations about Life?

Adaptations, Unity, and Diversity

In which section of the search results can you find nucleotide-by-nucleotide comparisons between your query sequence and similar database sequences?

Alignments

What is the goal of comparative genomic studies?

All of the above are goals of comparative genomic studies.

The Human Globin Family

All the globin genes evolved from one common ancestral gene that underwent duplication and divergence into the a-globin and b-globin ancestral families about 450-500 million years ago. The genes duplicated many times and then continued to diverge One gene coded for the a-globin protein that provided function while other copies accumulated random mutations

Bioinformatics

Allows for study of whole sets of genes and their interactions as well as comparison of genomes from different species

duplication of entire chromosome sets

An accident in meiosis can result in one or more extra sets of chromosomes, a condition known as polyploidy

Systems Biology

An approach to studying biology that aims to model the dynamic behavior of whole biological systems based on a study of the interactions among the system's parts.

systems biology

An approach to studying biology that aims to model the dynamic behavior of whole biological systems based on a study of the interactions among the system's parts.

Lysozyme

An enzyme that destroys bacterial cell walls; in mammals, found in sweat, tears, and saliva.

The Human genome project

An international collaborative effort to map and sequence the DNA of the entire human genome. Began in 1990 Completed in 2006 The ultimate goal of mapping any genome is to determine the complete nucleotide sequence of each chromosome

Medical Relevance

Analysis of the chromosomal breakage points associated with the rearrangement showed that specific sites for used over and over again. A number of these recombination hotspots correspond to locations of chromosomal rearrangements within the human genome that are associated with congenital diseases

Why is it ineffective to treat viral disease with antibiotics?

Antibiotics inhibit enzymes specific to bacteria and have no effect on virally encoded enzymes.

Homeotic Genes

Any of the genes that control the overall body plan of animals by controlling the developmental fate of groups of cells.

Bioinformatics uses

Apart from analysis of genome sequence data, bioinformatics is now being used for a vast array of other important tasks, including analysis of gene variation and expression, analysis and prediction of gene and protein structure and function, prediction and detection of gene regulation networks, simulation environments

Comparing Genomes Within a Species

As a species, humans have only been around about 200,000 years and have low within-species genetic variation Variation within humans is due to single nucleotide polymorphisms (SNPs), inversions, deletions, and duplications Most surprising is the large number of copy-number variants These variations are useful for studying human evolution and human health

Where is much of the genome's simple sequence DNA located?

At telomeres and centromeres, suggesting that this DNA plays a structural role for chromosomes

What is gene annotation? A. Observing an organism's phenotype and deducing its genotype. B. Identifying the function of a gene from its sequence. C. Identifying the genotype of an individual based on pedigree analysis. D. None of the above

B

_____% of the human genome encodes protein or ncRNA. A. 0.001% B. 1.5% C. 10% D. 30% E. 50% F. 75%

B

A gene family has been identified that has undergone extensive duplication in humans, but is present in only one or a few copies in other primates or other mammals. What experimental approaches could be used to determine the function of this gene and its significance in human evolution? (Section 18.6) A. Introduce these genes into yeast and study the phenotype of the resulting cells. B. Create knockout mice to determine their phenotype. C. Reduce the number of copies of this gene in a human subject. D. Determine the timing and location of expression of these genes during embryonic development in fruit flies. E. All of the choices are correct.

B. Create knockout mice to determine their phenotype. right answer feedback:This is both feasible and likely to yield information about the function of the gene.

Detailed comparison of the human and chimpanzee genomes has revealed that __________. (Section 18.6) A. human and chimpanzee genomes are so similar that they should be considered to be the same species B. most differences are in the form of chromosomal rearrangements C. most differences are in the form of single nucleotide substitutions D. chimpanzee transposons are different from human transposons E. chimpanzees have more chromosomes

B. most differences are in the form of chromosomal rearrangements right answer feedback:Insertions, deletions, and rearrangements are more frequent than single nucleotide changes.

Scientists use bioinformatics

Bioinformatics research uses computer software and algorithms to perform gene annotation, the process of identifying genes, determining their function, and recording their position. Once genes are sequenced, they can be uploaded into a data bank used to store and compare hundreds of thousands of sequences.

Widespread conversion of Developmental Genes among animals

Biologists in the field of evolutionary developmental biology, or evo-devo as it is often called, compare developmental processes the different multicellular organisms. Their aim is to understand how these processes have evolved and how changes to them can modify existing organismal features or lead to new ones

alterations of chromosome structure

Breakage of a chromosome can lead to four types of changes in chromosome structure Deletion removes a chromosomal segment Duplication repeats a segment Inversion reverses orientation of a segment within a chromosome Translocation moves a segment from one chromosome to another

Nondisjunction events in meiosis can cause polyploidy. For which group is polyploidy a common route for speciation? A. Invertebrates B. Vertebrates C. Plants D. Archaea E. Bacteria

C

Why might the number of genes in the genome underestimate the number of different proteins that an organism makes? (Section 18.3) A. The genome rearranges its DNA so that different cells can make different proteins. B. Organisms take up foreign DNA and make proteins encoded by these foreign DNA molecules. C. Many genes undergo alternative splicing, so that different proteins with different exon combinations are produced from the same gene. D. All of the choices are correct. E. None of the listed choices is correct.

C. Many genes undergo alternative splicing, so that different proteins with different exon combinations are produced from the same gene. right answer feedback:About 60% of human genes undergo alternative splicing.

Who discovered transposons? (Section 18.4) A. Crick B. Tatum C. McClintock D. Chase E. Pauling

C. McClintock right answer feedback:Barbara McClintock was the first to discover transposons when she found evidence for mobile genetic elements that affected the color of developing corn kernels.

An example of a systems biology experiment might be __________. (Section 18.2) A. determining what gene mutation causes insulin resistance B. determining the normal biochemical function of the gene involved in insulin resistance C. determining how insulin resistance affects transcription of thousands of other genes in the genome D. comparing the insulin resistance gene in human, mouse, and chimpanzee genomes E. All of the choices are correct.

C. determining how insulin resistance affects transcription of thousands of other genes in the genome right answer feedback:That is an example of a systems biology experiment, one with a broad reach.

Multigene families arise as a result of __________. (Section 18.5) A. transformation B. the action of restriction enzymes C. errors during DNA replication and recombination D. RNA splicing E. protein degradation

C. errors during DNA replication and recombination right answer feedback:Multigene families consist of identical or very similar genes.

Segments of eukaryotic DNA that can move from one site to another in the genome by means of an RNA intermediate are called __________. (Section 18.4) A. transposons B. plasmids C. retrotransposons D. introns E. alleles

C. retrotransposons right answer feedback:Retrotransposons leave a copy at the original site during transposition. To insert at another site, the RNA intermediate is first converted back to DNA by reverse transcriptase.

Hox Genes

Class of homeotic genes. Changes in these genes can have a profound impact on morphology. Short for homeobox-containing genes, because homeotic genes were the first genes found to have this sequence *Other homeobox-containing genes were later found that do not act as homeotic genes; that is they do not directly control the identity of body parts

Who was the Father of Taxonomy?

Carolus Linnaeus

What is microevolution?

Change in allele frequencies in a population over time

Comparing genome sequences provide clues to evolution and development

Comparisons of genome sequences from different species reveal a lot about the evolutionary history of life, from very ancient to more recent. Similarly, comparative studies of the genetic programs that direct embryonic development in different species is beginning to clarify the mechanisms that generated the great diversity of Life - forms present today.

What is intrasexual selection?

Competition among individuals of one sex for mates of the opposite sex

Human and chimpanzee genomes

Considering single nucleotide substitutions, the two genomes differ by only 1.2%. when researchers look at longer stretches of DNA, however, they were surprised to find a further 2.7% difference due to insertions or deletions of larger regions in the genome of one or the other species; many of the insertions were duplications or other repetitive DNA

Which statement might explain the disparity in gene density in prokaryotes and eukaryotes? A. Eukaryote genomes are more dense because they have much more information they have to encode. B. Eukaryote genomes are more dense because they can alternatively splice their mRNAs. C. Prokaryote genomes are more dense because they do not have regulatory sequences. D. Prokaryotes genomes are more dense because they don't have introns.

D

The human genome is thought to contain about how many genes? (Section 18.3) A. 1,000-2,000 B. 4,000-6,000 C. 13,000-15,000 D. >21,000 E. 100,000-110,000

D. >21,000 right answer feedback:This was a major surprise, as many scientists expected the number to be higher.

NCBI provides __________. (Section 18.2) A. a database of protein structures B. Genbank C. BLAST D. All of the choices are correct. E. None of the choices is correct.

D. All of the choices are correct. right answer feedback:The NCBI also provides access to Pubmed, an index of biomedical journal articles, and other resources.

Which best describes the experimental evidence that the FOXP2 gene is vital to the normal development of vocalization in vertebrates and yet has evolved among different vertebrate lineages? (Section 18.6) A. Knocking out one of the two FOX2P genes in mice and humans had no effect on the development of vocalization in either species. B. Replacing the mouse FOX2P gene with songbird versions of the gene caused the transgenic mice to vocalize like songbirds. C. Replacing the FOXP2 gene in mice with the human form of the gene had a neutral effect on development of vocalization in mice. D. Replacing the FOX2P gene in mice with a humanized version of the gene had no negative effects on the mice but did lead to the development of brain cells in neural circuits that are associated with speech development in humans. E. When scientists knocked out the FOXP2 gene in human subjects, they observed the development of severe speech and language impairment.

D. Replacing the FOX2P gene in mice with a humanized version of the gene had no negative effects on the mice but did lead to the development of brain cells in neural circuits that are associated with speech development in humans. right answer feedback:The fact that mice with the human version of the gene were healthy suggests that the importance of FOXP2 to the development of vocalization in vertebrates has curtailed its tendency to mutate over time. However, the human-like brain development in the transgenic mice suggests that the human version of the gene has evolved sufficiently that it regulates and guides the development of human speech.

What factor accounts most for the difference in genome size between vertebrates and prokaryotes? (Section 18.3) A. Vertebrates have more genes for functional RNA molecules. B. Vertebrates have longer and more complex upstream regulatory sequences C. Vertebrates have more protein-coding genes. D. Vertebrates have more noncoding DNA sequences. E. All of the choices are correct.

D. Vertebrates have more noncoding DNA sequences. right answer feedback:Noncoding, apparently nonfunctional DNA sequences such as introns and transposon-derived repeats comprise the greatest percentage of the human and other vertebrate genomes.

Alu elements __________. (Section 18.4) A. make up nearly 50% of the human genome B. encode their own transposase C. are present in all mammals D. are derived from or related to transposable elements E. are found only in the human genome

D. are derived from or related to transposable elements right answer feedback:They appear to be derived from a retrotransposon.

The molecular data indicate that the globin gene family __________. (Section 18.5) A. evolved from a common ancestor of the alpha- and beta-globin genes, but that myoglobin and leghemoglobin arose from a different ancestor B. evolved through exon duplication C. has two distinct evolutionary lineages, originating from an ancestral alpha-globin gene and an ancestral beta-globin gene D. evolved from a common globin gene ancestor that gave rise to both alpha- and beta-globin genes, as well as myoglobin and plant leghemoglobin E. arose through convergent evolution, where genes of different ancestry become similar over time because they have the same function

D. evolved from a common globin gene ancestor that gave rise to both alpha- and beta-globin genes, as well as myoglobin and plant leghemoglobin right answer feedback:Amino acid similarities and phylogenetic trees support this model.

A group of scientists is attempting to sequence the Neanderthal genome with DNA extracted from Neanderthal bones. Information from this project might reveal __________. (Section 18.6) A. whether Neanderthals are the same species as modern humans B. why Neanderthals became extinct C. whether Neanderthals had language ability D. what genetic differences may be connected to differences in behavior between the two species E. All of the choices are correct.

D. what genetic differences may be connected to differences in behavior between the two species right answer feedback:The genetic differences can help to suggest reasons for the numerous differences between the abilities of the two species.

What is Evolution?

Descent with modification

What did the Human Genome Project do?

Determined complete nucleotide sequence of each chromosome

*

Developmental biologists have found that in addition to homeotic genes, many other genes involved in development are highly conserved from species to species. These include numerous genes encoding components of signaling pathways.

What is evolution-devo?

Developmental processes comparisons between different multicellular organisms.

copy number variation (CNV)

Difference among individual organisms in the number of copies of any large DNA sequence (larger than 1000 bp). *Since these variants of encompass much longer stretches of DNA than the single nucleotides of SNPs, CNVs are more likely to have phenotypic consequences and to play a role and complex diseases and disorders.

What is genetic variation?

Differences among individuals in DNA (genes)

What is alleles?

Different forms of a gene found on the same chromosome

Who is Barbara McClintock?

Discovered mobile genetic elements in corn

Barbara McClintock

Discovered the ability of genes to change positions on the chromosome

Domains

Discrete structural and functional regions of proteins.

what are the 3 ways that natural selection alters genes?

Disruptive, Directional, and Stabilizing

*

Diversification of genes and their products is an important factor in the evolution of species. Thus, the accumulation of changes in the Genome of each species provides a record of its evolutionary history. To read this record, we must be able to identify genomic changes.

How does genetic modifications occur?

Duplication, rearrangement, and mutation

What contributes toward genome evolution?

Duplication, rearrangement, and mutation of DNA.

Which is a way that geneticists can determine the function of an unknown gene? A. Comparing the predicted amino acid sequence to those of other known genes. B. Comparing the DNA sequence with other known genes. C. Looking for cDNA that specifies known mRNAs in the DNA sequence. D. Using in situ mutagenesis or RNAi to knock out a gene, then observing what happens. E. All of the above.

E

Although containing about the same number of genes as the nematode genome, the human genome is thought to bear greater phenotypic diversity by means of __________. (Section 18.3) A. post-translation addition of carbohydrates to polypeptides B. regulation of gene expression by miRNAs C. post-translational cleavage of a polypeptide into active forms D. alternate splicing of RNA transcripts E. All of the choices are correct.

E. All of the choices are correct. right answer feedback:It is currently thought that humans and other vertebrates make do with no more genes than nematodes by way of alternate exon splicing in multi-exon genes during post-transcriptional processing; post-translational modification or cleavage of polypeptides; and via gene regulation by miRNAs and other small RNAs.

Which best describes the findings of the ENCODE pilot study that thoroughly studied the human genome? (Section 18.2) A. Most of the DNA studied was composed of protein-coding genes. B. Only 2% of the region was transcribed into RNA. C. Most of the portion studied was composed of exon sequences of genes. D. Over 50% of the region was composed of transcription enhancer sequences. E. Over 90% of the region was transcribed into different types of RNA.

E. Over 90% of the region was transcribed into different types of RNA. right answer feedback:This surprising finding helped reshape our understanding of RNA and the multiple roles it plays in the operation of the genome.

Who has more genes per Mb: E. coli or Home Sapiens?

E. coli

A rapid way for natural evolution to alter a protein-coding gene so it encodes a protein with a different structure and function is __________. (Section 18.5) A. homologous recombination B. mutations in the regulatory sequence of a gene C. single nucleotide substitutions D. recombinant DNA E. exon duplication and exon shuffling

E. exon duplication and exon shuffling right answer feedback:Many protein domains are encoded by an exon, so duplicated exons and new exons can modify protein structure and function.

Proteome

Entire set of proteins expressed by a cell or group of cells and these proteins carry out most of the activities of the cell

Genome characteristics of Bacteria/Archaea (prokaryotes) and Eukarya

Eukarya has more in 1.Genome Size 2. Number of genes 3. Introns 4. Noncoding DNA Bacteria/Archaea has more in GENE DENSITY

There is no systematic relationship between genome size and phenotype for eukaryotes or prokaryotes?

Eukaryotes

alterations of chromosome structure

Evolutionary changes that led to changes in chromosomes and may have driven speciation Ex: Humans and chimpanzees diverged from common ancestor when the fusion of two ancestral chromosomes in the human line led to a different haploid number for each

Evo-Devo

Evolutionary developmental biology; a field of biology that compares developmental processes of different multicellular organisms to understand how these processes have evolved and how changes can modify existing organismal features or lead to new ones.

What is phylogeny? and how is it represented?

Evolutionary history of a species -phylogenetic trees

Globin superfamily

Evolved from mutations in the original GLOBIN ANCESTRAL GENE. Myoglobin and leghemoglobin are part of this family

Rearrangements of Parts of Genes: Exon Duplication and Exon Shuffling

Exon shuffling is the process of creating new genes by the breaking and joining of DNA molecules that results in combining some exons from one gene with some exons from another gene. The resulting "hybrid" gene may code for an entirely new protein with a new function A particular exon within a gene could be duplicated on chromosome and deleted from the other due to unequal crossing over. Quite a few protein-coding genes have multiple copies of related exons, which presumably arose by duplication and then diverged

Which is NOT a way genomes can change over time? A. Chromosomes can duplicate due to nondisjunction. B. Chromosomes can fuse together over time. C. Genes can duplicate due to errors in crossing over. D. Exons can be duplicated and shuffled around in the genome. E. Transposons can bring other genes with them during transposition. F. None of the above.

F

One transcription factor whose gene shows evidence of rapid change in the human lineage is called the

FOXP2 gene

Besides the regions encoding protein and ncRNA, the rest of the genome is "junk DNA".

False

Short repetitive sequences make sequencing more accurate than it otherwise would be because DNA fragments can be paired more easily.

False

True or false: Within each domain, there is a systematic relationship between genome size and phenotype.

False

True or false: number of genes correlates with genome size.

False

Who was Alfred Russell Wallace?

Father of biogeography -admired darwin and shared credit for similar theories

Part B - Assembling a complete sequence from fragment sequences In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence? Enter the complete DNA sequence, which should contain 24 bases.

GATGACATGGCGTCAGTCGATGCG

*

FoxP2 experiments used mice as a model for humans because it would be unethical to carry out such experiments in humans. Mice and humans, which diverged 65 million years ago share about 85% of their genes. This genetic similarity can be exploited in studying human genetic disorders. If researchers know the organ or tissue that is affected by a particular genetic disorder, they could look for genes that are expressed in these locations in mice

Which kingdom does Hypocreales belong to?

Fungi

Which of these genes codes for a protein that plays a role in growth?

GH1

Duplication and Divergence of Gene-Sized Regions of DNA

Gene duplication can occur several times over, leading to an organism having multiple copies of a given gene. With time, extra copies of a gene can undergo mutation, causing them to be slightly different from the original gene. * Usually caused by errors in meiosis and some regions may be the size f genes

alternative RNA splicing

Generates more than one polypeptide from a single gene A typical human gene has 10 exons and approx 90% of these are spliced in at least 2 different ways and some genes are expressed in hundreds of alternative spliced forms

In general terms, describe the events that led to the evolution of the globin super family.

Globing genes all evolved from a common ancestral gene that underwent duplication and divergence. Additional differences accumulated through mutations over several generations. Natural selection then acted upon the favorable genes.

Centralized Resources for analyzing Genome sequences

Government funded agencies carried out their mandate to establish databases and provide software with which scientists could analyze the sequence data EX: NCBI Not to important concept PAGE 438

what are the 4 eons?

Hadean, Archean, Proterozoic, Phanerozoic

What did Carolus Linnaeus come up with and what did he believe?

He came up with "Linneaen Taxonomy" -binomial nomenclature (naming species) (genus, species) -believed species were created perfectly/no evolution

Comparing Distantly Related Species

Highly conserved genes have changed very little over time These help clarify relationships among species that diverged from each other long ago Bacteria, archaea, and eukaryotes diverged from each other between 2 and 4 billion years ago Highly conserved genes can be studied in one model organism, and the results applied to other organisms Very ancient genes can still be suprisingly similar is disparate species. Can help clarify evolutionary relationships among species that diverged from each other long ago

Neanderthals

Homo sapiens neanderthalensis, a European variant of Homo sapiens that died out about 25,000 years ago. May have coexisted with other Humans

The extraordinary similarity among some developmental genes in different animal species raises the question:

How can the same genes be involved in the development of animals whose forms are so very different from each other?

Invertebrates and vertebrates of many different species are patterned by homeotic genes, abbreviated "____" genes in animals.

Hox

What are homeotic genes called?

Hox genes

What are Hox genes?

Hox genes encode transcription factors with a DNA-binding domain called a homeo box, and regulate development of the vertebrate body plan.

What organisms have the lowest gene density in a given length of genes?

Humans and some other mammals

Why does bacteria have higher gene density than humans?

Humans have thousands of times as many base pairs as most bacteria but only 5 to 15 times as many genes Because most of the DNA does not code for proteins nor is it transcribed into RNA molecules. Introns account for most of the diff. in average length b/t human and bacteria genes

What are the two possibilities of Multigene families?

Identical DNA sequences and Non-Identical DNA sequence (most common)

Provide evidence that suggests that the homeobox DNA sequence evolved very early in the history of life.

Identical or very similar genes have been located in many invertebrates and vertebrates. Drosophila are prime examples of this. Related sequences are also evident in plants and yeast.

Evolution of Genes with related functions

In certain multigene families, the genes of the family arose due to duplication and mutation of a single gene.

*

In embryos of drosophila and other animal species, different combinations of homeobox genes are active in different parts of the embryo. The selective expression of regulatory genes, varying over time and space, is central to pattern formation

*

In general, most bacterial genomes have somewhere around 1 to 6 million base pairs. For example, E. coli, a bacterium, has 4.6 million base pairs (which we can abbreviate as 4.6 Mb). The genome sizes for archaea are pretty similar to those of bacteria, but compared to both of these domains many eukaryotic genomes are larger Most plants and animals, which are multicellular, have genomes at least 100Mb. 165 on fruit fly, 3,000 on humans, about 500-1000 times the bacteria

Alu Elements

In humans and other planets, a large portion of Transposable element - related DNA consists of a family of similar sequences called Alu elements. These sequences alone account for approximately 10% of the human genome. Alu elements are about 300 nucleotides long, much shorter than most functional transposable elements, and they do not code for proteins. However many Alu elements are transcribed into RNA, and at least some of these RNAs are thought to help regulate gene expression

Suggested answers:

In some cases, small changes and Regulatory sequences of particular genes cause changes in gene expression patterns that lead to major changes in body form. EX:The different patterns of expression of the Hox genes along the body axis and insects and Crustaceans can explain these segmented animals. In other cases, similar genes directed different developmental processes in various organisms, resulting in diverse body shapes. Several Hox genes, for instance, are expressed in the embryonic and larval stages of the sea urchin, a non-segmented animal has a body plan quite different from those of insects and mice. PAGE 458 HAS A GOOD PICTURE

How does the alignment of the FN397219.1 sequence to your query sequence compare to the alignment of the AY259214.1 sequence you examined in Part F?

In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps.

Evolution of Genes with Novel Functions

In the evolution of the globin Gene families, Gene duplication, and subsequent Divergence produced family members whose protein products performed similarly to each other. However, an alternative scenario is that one copy of a duplicated Gene can undergo alteration that lead to a completely new function for the protein product. The genes for lysozyme and a-lactalbumin are good examples of this type of situation

Metagenomics

In which DNA from an entire group of species is collected from an environmental sample and sequenced. This approach was facilitated by technological advances

WD40 Domain

Interacts with specific proteins to be degraded

What is a striking finding by the ENCODE project?

Is that about 75% of the genome is transcribed at some point in at least one of the cell type studies, even though less than 2% codes for proteins. Furthermore, biochemical functions have been assigned to the DNA elements making up at least 80% of the genome. To learn more about the different types of functional elements, parallel projects are analyzing in a similar way the genomes up to model organisms, a fruit fly and a soil nematode

Chromosomal rearrangements may be important in evolution because __________.

It may lead two populations to unsuccessfully mate, a step towards the way of becoming two separate species * Although individuals with different Arrangements could still mate and produce Offspring, The offspring would have two nonequivalent sets of chromosomes, making meiosis inefficient or even impossible

How has gene duplication played a critical role in evolution?

It produces redundant copies of existing genes, which are then free to mutate and adopt new functions.

Lysozyme and a-lactalblumin

It's the proteins are quite similar and their amino acid sequences and 3 - dimensional structures. Both genes are found in mammals, whereas only the lysozyme gene is present in Birds. These findings suggest that mammals and birds have separated the lysozyme gene was duplicated in the mammalian lineage but not in the avian lineage

Based on the information given in the three different sections, which of the following statement(s) correctly describe(s) the hit that is most similar to the query sequence? Select all that apply.

Its accession number is CAM33009.1. It is identical to the query sequence in length and amino acid sequence. It is a chimeric protein.

Who invented the shotgun approach?

J. Craig Venter

Who invented the "Whole Genome Shot-Gun approach"?

J.C Venter

who are the 2 important influencers of Darwin and what did they do?

James Hutton: theory of gradualism (over time) Charles Lyell: theory of uniformitarianism (uniform/same) same process persisting for long periods

What is gene density?

Number of genes found along a stretch of DNA

Comparing Genomes

Learning about characteristics that are shared or divergent between groups enhances our picture of the evolution of organisms and biological processes

What is locus?

Location of a gene on a chromosome

Which of these genes codes for a protein that plays a role in white blood cell function?

MPO

What genes in plants are the regulatory equivalent of Hox genes in animals?

Mads-box genes

What does process mean in terms of Evolution?

Mechanisms that produce diversity and unity of living things

unequal crossing over

Misalignment of the two DNA molecules during crossing over, resulting in one DNA molecule with an insertion and the other with a deletion

Which of the following statements about genome sizes is true?

Most eukaryotes have larger genomes than most prokaryotes.

How does Retrosposons move?

Moves by mean of RNA intermediate leaving behind a copy at the original site

How do transposable elements contribute toward evolution?

Multi copies of similar transposable elements may facilitate recombination, or crossing over, between different chromosomes Insertion of transposable elements into protein coding region/regulatory sequence could block protein production

sequences related to transposable elements

Multiple copies of transposable elements and sequences related to them are scattered throughout the eukaryotic genome. A single unit is usually hundreds of thousands of base pairs long, and then dispersed "copies" are similar but usually not identical to each other. Some of these are transposable elements that can move; the enzymes required for the movement may be encoded by any transposable element, including the one that is moving. Others are sequences that have lost ability to move all together. Transposable elements and related sequences make up 25 to 50% of most mammalian genomes.

What is a shared derived character?

NEW evolutionary novelty unique to a particular taxon ex) hair is shared by all mammals but not by their ancestors

What is sympatric speciation?

NO seperation (same country) happens within same geographic area polyploidy

Do all humans share the same genome?

No

repetitive DNA

Nucleotide sequences, usually noncoding, that are present in many copies in a eukaryotic genome. The repeated units may be short and arranged tandemly (in series) or long and dispersed in the genome. Take up most of the DNA genome Surprisingly 75% of this repetitive DNA (44% of the human genome) is made of units called transposable units and sequences related to them

What is the whole-genome shotgun approach?

Powerful computer programs begin with the cloning and sequencing of DNA fragments, and continues to assemble these into a continuous sequence.

Genome sizes and estimated number of genes

PAGE 442 HAS A GOOD COMPARISON TABLE

what are the 3 eras?

Paleozoic, Mesozoic, Cenozoic

What are the 2 approaches used to sequence human genome?

Public and Private

genomes vary in number of genes

Scientists estimate that the human genome, for example, has about 20,000 to 25,000 protein-coding genes. Before completion of the draft sequence of the Human Genome Project in 2001, scientists made bets as to how many genes were in the human genome. Most predictions were between about 30,000 and 100,000.

The existence of several psuedogenes among the functional globin genes show that:

Random mutations in these "genes" over evolutionary time have destroyed their function

Is Transposons or Retrosposons more common?

Retrosposons

How do retrotransposons differ from other transposons?

Retrotransposons move via an RNA transcript, whereas other transposons do not.

Human and Mouse Chromosome Comparison

Scientists found in a study that large blocks of genes on human chromosome 16 are found on four Mouse chromosomes, indicating that the genes and each block stayed together in both the mouse and the human lineages during their divergent evolution from a common ancestor

What is the Human Genome Project?

Scientists in 18 different countries collaborated to decode the human genome. This is the order of bases on all the human chromosomes. The project was completed quickly because so many scientists worked on it at the same time. The work was published in 2003. (<21,000 genes were sequenced)

What are transposable elements?

Segments of DNA that insert themselves into new locations within a genome

Noncoding DNA

Sequences of a gene's DNA (also known as introns) that are not coded to produce specific proteins and are excised before protein synthesis.

Which statement best describes the results shown in the Descriptions section?

Several hits derived from Fusarium oxysporum are best matches to the query sequence.

Did you find any sequences in the human genome that were statistically similar to your query sequence?

Similar sequences were found only with the blastn (lower similarity) search.

Genomes vary in size

Smallest virus - 4-5 genes E. coli - single chromosome containing 4,288 genes; 1 mm; 1,000X longer than cell Human cell - 46 chromosomes containing 31,000 genes; 6 feet; 180,000X longer than cell

What website functions as a database for genome sequences?

The NCBI

How do the E values change as you go from the top of the list of hits to the bottom?

The E values get larger.

Explain the significance of the rapid evolution of the FOXP2 gene in the human lineage

The FOXP2 gene has evolved to enable humans to affectively vocalize thoughts. The FOXP2 gene is linked to vocalization skills in several organisms, such as apes. This development likely aided in our deviation from ape species.

Who is Gregor Mendel and what did he do?

The Father of Genetics -parents pass on discrete heritable genes to offspring and in different combinations

Scientists have known long enough that

The ancestors of humans and chimpanzees diverged a species, the fusion of two ancestral chromosomes in the human line let the different haploid numbers for humans (n = 23) and chimpanzees (n = 24) *Chromosomes 12 and 13 fused together end to end

Protein function is usually deduced through a combination of biochemical and functional studies

The biochemical approach aims to determine the three-dimensional structure of the protein as well as other attributes, such as potential binding sites for other molecules. Functional studies usually involve blocking or disabling the gene of an organism to see how the phenotype is affected. RNAi is such an example.

what is a Genome?

The entire set of DNA from an organism

What is a proteome?

The full range of proteins produced by a genome

Comparing Closely Related Species

The genomes of two closely related species are likely to be organized similarly because of their relatively recent Divergence. The recent divergence of two closely-related species also underlies some small number of gene differences that are found when their genomes are compared. The particular genetic differences can therefore be more easily correlated with phenotypic differences between the two species. Comparing the genomes of a chimpanzee, mouse, rat, and other mammals should give us clues about what it takes to make a mammal. And comparing the human genome with that of a chimpanzee will help us answer the tantalizing question: What genomic information defines a human or a chimpanzee

Describe the findings the the HGP in relations to human genome size.

The human genome is relatively smaller than anticipated. There is also no correlation between phenotype and genome size.

"more bang for the buck"

The idea that human genes will get more for their coding sequences because of alternative splicing of RNA trancscripts. A typical human gene contains about 10 exons, and an estimated 90% or more of these multi-exon genes are spliced in at least two different ways

What is gene annotation?

The identification of protein coding genes within DNA sequences in a database

Two approaches which complemented each other in obtaining the complete sequence

The initial approach was a methodical one built on an earlier storehouse of human genetic information However later this was changed to an alternative strategy called the whole genome shotgun approach

What is the general trend that can be seen between genome size and genes per Mb?

The larger the genome, the less genes there are per Mb.

Exon Duplication

The process by which exons are duplicated in a gene, creating more protein domains and novel functions. Might augment its function or alter some other property.

Duplication and Divergence

The process of creating new genes by duplication followed by change in sequence over evolutionary time.

In the human genome and the genomes of many other plants, solitary genes make up less than half of the total gene-related DNA.

The rest occur in multigene families

Are homeobox sequences similar in invertebrates and vertebrates.

The sequences are very similar between humans and fruit flies

evo-devo (evolutionary developmental biology)

The subdiscipline within evolutionary biology that deals with the evolution of developmental pathways and the role that developmental changes have played in the evolution of life's diversity

Although many transposable elements encoded proteins,

These proteins do not carry out normal cellular functions. Therefore transposable elements are usually included in the "noncoding" DNA category, along with other repetitive sequences

Which of the following statements is correct regarding viral infections in plants?

They can spread within a plant via plasmodesmata.

Other than the genus and species information, what characteristics do most of the top hit sequences share? Select the two best answers.

They contain a sequence of an internal transcribed spacer. They contain a ribosomal RNA (rRNA) sequence.

Cancer Genome Atlas

To employ large scale genome sequencing of cancer cells to catalog genetic changes and identify new genes this type of personalized medicine could be used in disease prevention and treatment

How Transposable Elements Contribute to Genome Evolution

Transposable elements (TEs) are DNA sequences that are capable of integrating into the genome at a new site within the cell of its origin. Sometimes, the change in their positions creates or reverses mutations, thereby altering the cell's genotype. Transposable elements can cause deletions or inversions of DNA. When transposition generates two copies of the same sequence in the same orientation, recombination can delete the DNA between them. If the two copies are in the opposite orientations, recombination will invert the DNA between them. * When they move they may carry along a gene or even a group of genes to a new position on a genome. By a similar process, an exon from one gene may be inserted in a mechanism similar to that of exon shuffling during recombination

Retrotransposons

Transposable elements that move within a genome by means of an single-stranded RNA intermediate, a transcript of the retrotransposon DNA. Uses reverse transcriptase

What are the two types of mobile genetic elements?

Transposons and Retrosposons

By what mechanism might transposons contribute to gene duplication?

Transposons may promote unequal crossing over during meiosis.

How does Transposons move and what are the two different ways?

Transposons move within a genome by means of DNA 1. copy and paste 2. cut and paste

The more similar the genomes, the closer related the species are.

True

Gene duplication due to unequal crossing over

Unequal crossing over is a type of gene duplication or deletion event that deletes a sequence in one strand and replaces it with a duplication from its sister chromatid in mitosis or from its homologous chromosome during meiosis * Can cause species to diverge

How do prions differ from viruses?

Unlike viruses, prions are infectious proteins.Unlike viruses, prions do not include any nucleic acids.Unlike a virus, a prion is a single molecule.

Identifying Protein-Coding genes and Understanding their Functions

Using available DNA sequences, genecists can study genes directly. A more recent approach poses a new challenge: What does a gene actually do? Given a long DNA sequence from a data base such as GenBank, scientists aim to identify all protein-coding genes in the sequence and ultimately their functions, a process called gene annotation

Which of the following statements correctly describes vaccines and how they help prevent viral infection?

Vaccines are inactive versions of a virus that stimulate an immune reaction in a person.

How does a virus differ from a bacterium?

Viruses, unlike bacteria, lack metabolic enzymes.

What is allopatric speciation?

WITH separation (other country) geologic features separate populations

*

We can deduce that homeobox DNA sequence evolved very early in the history of life and was sufficiently valuable to organisms have been conserved in animals and plants virtually unchanged for hundreds of millions of years

Homeobox

a DNA sequence within a homeotic gene that regulates development in animals sufficently beneficial to the organisms that it has been conserved in animals and plants virtually unchanged for hundreds of millions of years

What is endosymbiosis?

a cell that lives within a host cell

What is the bottleneck effect?

a drastic natural disaster reduces the size of a population and when it recovers in size certain alleles may be over or under represented and low levels of genetic variation

What is systematics?

a focus on classifying organisms and determining their evolutionary relationships

Retrotransposition

a form of transposition in which the element is transcribed into RNA. The RNA is then used as a template via reverse transcriptase to synthesize a DNA molecule that is integrated into a new region of the genome via integrase

FOXP2

a gene that is important in language and speech production Its gene product turns on genes involved in vocalization

What is a clade?

a group consisting of an organism and all its descendants

What is a species?

a group of population whose members have the potential to intercede in nature and produce offspring but not w/ other species

The development of technology for faster sequencing was

a major push for the Human Genome project

Human Gene Microarray Chip

a silicon, glass chip that is placed in patients with various types of cancer/disease. the chip enables researchers to know the gene expressed within the patient to help them find treatment.

Transposition

a transposable element moves from one site in a cell's DNA to a different target site by a type of recombination process Can be transposons or retrotransposons (retrotransposition)

The total amount of DNA that is gene-related is

about 25% of the human genome including coding and noncoding strands

The genes in one or more of the extra sets can diverge by

accumulating mutations these variations may persist if the organism carrying them survives and reproduces

What is stabalizing selection?

acts against both extremes and favors intermediate variants

Natural selection can cause _________ evolution

adaptive

the descendants of Multicellular eukaryotes are

algae, plants, fungi, and animals

What is reproductive isolation?

barriers that prevent two species from interbreeding

what is radiometric dating?

based on the decay of radioactive isotopes (half life) C-14 minus C-12 parent isotope decays to daughter isotope

Cretaceous Mass extinction consisted of

big asteroid collided into earth -debris blocked the sun for months -half of marine and dinosaurs went extinct

What and which are pre zygotic barriers?

block fertilization from occurring 1. wrong place (top/bottom of tree) 2. wrong time (breed during diff times) 3. wrong behavior (courtship rituals) 4. wrong anatomy 5. wrong physiology

Homeotic genes determine ______

body plan

What are the 2 types of genetic drift?

bottleneck effect and founder effect

What is macroevolution?

broad pattern of evolutionary change; above species level

How was the human genome sequenced?

by looking for overlapping regions between sequenced DNA fragments Mainly using sequencing machines

how can you determine fossil age?

by radiometric dating

The systems biology approach

can be applied to define gene circuits and protein interaction networks PAGE 441

What is systems biology?

categorizes biological systems based on the study of functional interactions among the system's parts

template slippage

causes frameshift mutations Strand slips and bases pop out or hydrogen bonds slip a little which cause DNA polymerase to think it didn't add bases, so it adds in more Basically, a segment of DNA is deleted or duplicated

what does Heterochrony mean?

change in rate or timing of developmental events (rate of skull growth)

What is a mutation?

change in the nucleotide sequence of an organism's DNA

What is a point mutation?

change of a single base in gene=sickle cell disease can alter gene number or position

What does Evolution reflect?

changes in genetic composition of a population over time

What does the Whole Genome Shot-Gun approach do?

clones and sequences DNA fragments from randomly cut DNA

1.5% of the DNA sequences in the Human Genome

code for proteins or is transcribed into rRNAs or tRNAs

Describe and give an example of each of the following: multigene families of identical DNA sequences and multigene families of nonidentical genes

collections of 2+ identical or very similar genes, sequences are usually randomly clustered, ex: family of identical DNA sequences that are the genes for the three largest RNA molecules, so basically the rRNA gene family, and this is what allows millions of ribosomes to be made two related families of genes that encode globins, ex: in humans embryonic and fetal forms of hemoglobin have a higher affinity for oxygen than the adult forms One family which encodes the 'a' globin is located on chromosome 16, while the family that encodes for 'b' globin is located on chromosome 11 *The different forms of each globin are expressed at different times in development, allowing hemoglobin to function effectively in the changing environment of the developing animal.

What are multigene families?

collections of identical or very similar genes

Multigene families

collections of two or more identical or very similar genes ex: globin genes (nonidentical)

What is Evo Devo?

compares the developmental processes of different multicellular organisms

What is a monophyletic group?

complete clade of common ancestor and all descendants

the plate tectonics are always moving causing _____

continental drift

What do Homeotic genes do?

controls the development of head to tail structures in linear sequence

Additional polypeptide diversity

could also result from post-transitional modifications such as cleavage or addition of carbohydrate groups

What are the 3 mechanisms contributing to shuffling of variants?

crossover independent assortment fertilization

One important use of systems biology is to

define gene and protein interaction networks. To map the protein interaction network in yeast for instance researchers use sophisticated techniques to knock out pairs of genes, one pair at a time, creating doubly mutant cells. They then compared the fitness of each double mutant to that predicted from the fitness of each of the two single reasons. The researchers reasoned that if the observed fitness matched the prediction, then the products of the two genes didn't interact with each other, but if the observed fitness match the prediction, then the products of the two genes interacted in the cell. They then graph this using a computer software and build a graphic model

What is the morphological species concept? and what is the disadvantage?

defines a species by similar body shape/structures -scientists can disagree on criteria

What is the Hardy-Weinberg principle?

describes gene pool of a population that is not evolving (stable/no mutations)

What is population genetics?

describes the genetic composition of a population and how it changes over time

branch point represents

dichotomy -divergence of 2 evolutionary lineage from a common ancestor

What is a polyphyletic group?

distant related species group (no common ancestor)

Evidence that unequal crossing-over and template slippage during DNA replication lead to

duplication of genes is found in the existence of multi-gene families such as the globin family

stromatolites are the _____ fossil evidence of life

earliest

What is the biological species concept?

emphasizes the seperateness of different species due to reproductive barriers

Gene duplication occurs due to

errors, slippage, and transposable element activities

Natural selection cannot occur if.......

everyone has the same trait

Hox genes provide _______ information during embryonic development

positional

What is disruptive selection?

favors individuals at both extremes of the phenotypic range, leaving the intermediates at a disadvantage

What is directional selection?

favors individuals at one end of the phenotypic range shifting the curve in one direction

How is fetal hemoglobin different from adult hemoglobin? What is the selective advantage of these different B-globin genes?

fetal hemoglobin have a higher affinity for oxygenhelps ensure efficient transfer of oxygen from mother to fetus

Pseudogenes

former genes that have accumulated mutations and are nonfunctional

What are pseudogenes?

former genes that have accumulated mutations and are nonfunctional

Psuedogenes and gene fragments

former genes that have accumulated mutations and are nonfunctional account for about 15% of the DNA

National Center for Biotechnology Information

funded by US tax dollars and is one of the world's best collections of databases for biomedical information

Which of these genes are located on the q arm of chromosome 17?

gastrin and GH1

FOXP2 gene

gene is involved in turning on genes involved in vocalization

what is neutral variation?

genetic variation that does not help or harm

Junk DNA

genomic DNA that does not encode proteins, and whose function, if it has one, is not well understood.

speciation can take place with or without __________ isolation

geographic -this is when gene flow is interrupted between the populations of the existing species

colonization of land

gradual evolutionary venture out of aquatic environments -small plants (mosses) -insects were the first animals

sister taxa represents

group of organisms that share immediate common ancestor (closest relative to one another) ex) chips and humans

copy and paste mechanism

happens in transposons

Natural selection can only act on ______ traits

heritable

What is a paraphyletic group?

incomplete lacks members

Evolution is through a population but natural selection works on an _________

individual

What are adaptations?

inherited characteristics of organisms that enhance their survival and reproduction

What is phenotype a product of?

inherited genotype and environmental influences

the biological species concept is based on the ability to ________

interbreed

The RP13 gene of chromosome 17 codes for a protein _____.

involved in eye development

The TP53 gene of chromosome 17 codes for a protein _____.

involved in the regulation of the cell cycle

What is the founder effect?

is when a few individuals become isolated from a larger population and this smaller group establishes a new population whose gene pool differs from the source population

What is intersexual selection?

mate choice

What does Mb mean?

megabase=million base pairs

high throughput

methods that can analyze biological materials very rapidly and produce enormous volumes of data.

speciation forms bridge between __________ and __________

microevolution and macroevolution

What is autopolyploidy?

more than 2 chromosomes sets from the same species failure of cell division 2n -> 4n

Phylogenies are inferred from ____ and ______

morphological and molecular data

In all bacterial genomes

most of the DNA consists of genes for proteins, tRNA, or rRNA; the small amount remaining consists mainly of non transcribed regulatory sequences, such as promoters

Root tree represents

most recent common ancestor of all taxa in tree

New genes and new alleles originate only by _______

mutation

what alters allele frequencies in a population?

natural selection, genetic drift, gene flow

majority of genome is _________

noncoding

descent with modification causes organisms to share some, but ______

not all ancestral characters

With sedimentary rocks/strata you can infer the sequence in which the layers were applied, but ....

not the year each layer was added

Genetic drift example

one bird leaves and adapts to another environment, changing the bird's characteristics

What is a homologous chromosome?

one from each parent

Natural selection improves the match between _____ and ______

organism and environment

Hardy-Weinburg Equation

p^2 + 2pq + q^2 = 1

Natural selection acts on __________ directly, not ____________

phenotype, genotype

what is Homology?

phenotypic and genetic similarities due to shared ancestry ex) tall, ground hugging BUT genes are similar

Where is polyploidy most common?

plants; Some botanists estimate that as many as 80% of the plant species alive today, have some polyploidy occuring in their ancestral species

speciation and extinction are influenced by

plate tectonics mass extinctions adaptive radiations

Cost of sequencing genome has gotten higher or has plummeted?

plummeted

Do populations or individuals evolve?

populations

species is a group of ________

populations

The gene that codes for gastrin is located on the _____ of chromosome 17.

q arm

gene density

ratio of the number of genes per number of base pairs

Besides duplication and divergence of whole genes

rearrangement of existing DNA sequences within genes has also contibuted to genome evolution. The presence of introns may have promoted the evolution of new proteins by facilitating the duplication of shuffling of exons.

Possible outcomes for hybrids over time

reinforcement=strengthens whatever makes them 2 diff species fusion-weakens reproductive barriers stability-not enough to bring them together or apart

hybrid zones reveal facts that cause _______ isolation

reproductive

a new species has populations that are no longer _____________

reproductively compatible

Identify the three main categories of hits in terms of similarity to the query sequence. (For help approaching this question, see Hint 1.)

sequences that are similar to the entire length of the query sequence sequences that are similar to the first 75 amino acids of the query sequence sequences that are similar to the last 170 amino acids of the query sequence

What are cladistics?

set of methods for inferring phylogeny from homologous characters

Alu elements

short stretches of DNA that do not code for any protein thought to regulate gene expression 10% of human genome

What is homology?

similarity due to common ancestry

What is analogy?

similarity due to convergent evolution -result of similar environmental selection ex) bird wings, bat wings both moles

Genetic drift has a greater chance of random mutation in _______ populations

small

What is BLAST?

software that allows the visitor to compare DNA sequences with every sequence in GenBank

short tandem repeats (STRs)

tandemly repeated 2-5 base sequences in specific regions of the genome varies from person

Mammals belong to ______, named for having 4 limbs

tetrapods

What did Aristotle believe about species? And what did he come up with?

that they were "fixed" (unchanging)/ no evolution -*Scala Naturae* believed life forms could be arranged on a ladder of increasing complexity with humans at the top

What was Jean-Baptiste Lamarck's mistake?

that you can inherit acquired characteristics ex) if he stretched his necks his babies will also have long necks HAS TO BE WRITTEN IN YOUR DNA

Due to redundancy of the genetic code

the DNA sequence itself may vary more among species than protein sequences. The scientists are interested in protein and often compare the predicted amino acid sequences of a protein to that of other proteins

What is bioinformatics?

the application of computational methods to the storage and analysis of biological data

What is Bioinformatics?

the application of computional methods to store and analyze biological data (store, sort, and analyze)

What is a proteome?

the entire set of proteins expressed by a cell or tissue

Proteome

the entire set of proteins expressed by a given cell or group of cells

Transposase

the enzyme which recognizes host DNA and cuts and glues transposons in and out of the genome generally coded by transposons, and can use both mechanisms of transposons: cut-and-past, and copy-and-paste which uses a double-stranded DNA intermediate

what is a phylogenetic tree?

the evolutionary history of a group organisms represented in a branching diagram

What is systems biology?

the exploration of a biological system by analyzing the interactions among its parts

There are more Alu elements in

the human genome than in the chimpanzee genome, and the latter contains many copies of a retroviral provirus not present in humans

What do you need in order to describe the genetic composition of a population?

the number of alleles and genotypes AND their frequencies

What is natural selection?

the process whereby organisms with certain heritable traits tend to survive and produce more offspring

The DNA at centromeres is essential for

the separation of chromatids and cell division. Centromeric DNA, along with simple sequence DNA located elsewhere, may also help organize the chromatin within the interphase.

The number of genes correlates with _____.

the size of the genome in prokaryotes

Emerging viruses arise by

the spread of existing viruses to new host species. mutation of existing viruses.the spread of existing viruses more widely within their host species.

Proteonomics

the study of an organism's complement of proteins and functions mediated by the proteins

Define metagenomics

the study of genetic material recovered directly from environmental samples

What is proteomics?

the study of the full protein set encoded by a genome

What is biogeography?

the study of the geographic distribution of species

What is Genomics?

the study of whole sets of genes and their interactions

What is genomics?

the study of whole sets of genes and their interactions

What is gene flow?

the transfer of alleles into or out of a population due to the movement of fertile individuals or their gametes

Function of Homeobox encoded homeodomain is to

to bind to the DNA when the protein functions as a transcription factor. Elsewhere in the protein, domains that are more variable interact with other transcription factors, allowing the homeodomain-containing protein to recognize specific enhancers and regulate the associated genes. Proteins with homeodomains probably regulate development by coordinating the transcription of batteries of developmental genes, switching them on or off PAGE 457 HAS A GOOD PICTURE

What was the main goal of the Human Genome Project (HGP)?

to map all the human genes and determine the nucleotide sequence of the entire human genome

what are heritable traits?

traits that can be passed on to future generations

Which type of chromosomal rearrangement accounts for the creation of the gene that encodes the BCR-ABL chimeric protein? (For a review of the four different types of chromosomal rearrangements, see Hint 1.)

translocation

What type of noncoding DNA comprises the largest portion of multicellular eukaryotic genomes?

transposons

What are the two types of transposable elements?

transposons - move by means of DNA intermediate and require transposes enzyme retrotransposons - move by means of RNA intermediate using a reverse transcriptase

Examine the descriptions for the group of hits that align with the N-terminal end of the query sequence. Which of the following terms are found among these descriptions? Select all that apply.

unnamed protein product BCR variant breakpoint cluster region

polytomy represents

unresolved lineage (they don't know)

A trait that is favorable in one environment may be....

useless in another

what is polyploidy?

when a species originates from an accident during cell division that results in an extra set of chromosomes (MORE THAN 2 SETS OF HOMOLOGOUS CHROMOSOMES) happens a lot in plants

genetic flow example

whole flock leaves to another island and interbreeds

LINE-1 (L1)

~ type of retrotransposons ~ accounts for approx. 17% of the human genome ~ 6,500 base pairs long ~ low rate of transposition ~ L1 blocks progress of RNA Polymerase which is needed for transposition ~seem to be more active in the brain and developing neurons