FIS 201 Final Exam

¡Supera tus tareas y exámenes ahora con Quizwiz!

Put the following phases of fire-progression in the correct order

1. Incipient 2. Emergent smoldering 3. Free burning 4. Oxygen-related smoldering

What time information does a skeletonized wipe tell us versus a plain wipe

A skeletonized wipe sat for a bit; a plain wipe was disturbed almost immediately after it was deposited

The two best ways to detect the presence of urine is the use of the ___ or the present of ___

ALS, odor

Scraping of the skin

Abrasion

Assumption that certain parties to an accident operated their vehicle competently and legally

Accident avoidance strategy

A woman believes that her "she shed" has been burned down, and investigates. She finds no evidence of ignitable liquid use, and narrows down the point of origin to an overloaded power outlet serving the entire shed. Based on this information, how should the fire be classified

Accidental

Which term best describes when a laboratory has agreed to operate according to a professional or industry standard and has proven that it can and does operate that way

Accreditation

Smell starts and the body begins to get a green marbling,. The smell attracts insects that lay eggs and new insects feed on the body The open body allows the gas to escape

Active decay

Guilty Act

Actus reus

How do fingerprint powders work

Adherence to the fatty components in fingerprint residue

In the ___ stage, the insects are fully developed with 6 legs, wings, eyes, and antennae. Their main goal is to mate and find a piece of carrion

Adult

Argon fire suppression systems work by flooding an area with inert argon gas. Which aspect of the fire triangle does this fire suppression mechanism knock out

Air

Cooling of the body after death

Algor mortic

A form of a gene with a unique number and sequence of nucleotides

Allele

___ is defined as the ability to estimate stature based on the proportional relationships between sizes of body parts

Allometry

Which type of fingerprinting powders cannot be used for latent prints on computers

Aluminum

Pills (mostly) used for stimulant and happy-feeling purposes

Amphetamines

Which form of machine markings would generally be easiest to individualize to a particular machine

An electric impact typewriter

What is the most common container used to collect fire debris evidence

An unlined paint can

Which of the following could not become a questioned document

An unprinted email

Hairs in which growth stage are most desirable to be collected at a crime scene

Anagen

Period of hair or fur growth

Anagen stage

Bertillonage identifies people based on ___ measurements of their bodies

Anthropometric

Antibodies and antigens are important for doing organ transplants, too, because you don't want a donated organ to be rejected by the recipient. One set of kidney antigens are V, W, X, and Null. They work just like blood type antigens: You can be V, W, X, VW, VX, WX. Null has none of these antigens. If your kidneys are type W, which antibodies do you have

Anti-V and anti-X

When talking about immunoassays, ___ are chemical markers, Individual cells can have ___ of them. ___ recognize and attach to highly specific types of these chemical markers

Antigens, many, antibodies

Which fingerprint pattern lacks definite core

Arch

Depletion of oxygen to the brain

Asphyxia

Generally speaking, what are the most common lethal blunt force injuries to humans

Automobile accidents

A jogger was mugged, and his jacket was collected by the police. Which of the qualities of evidence would affect recovery of the mugger's hairs from this coat

Background noise

___ sketching is a method using a line between two fixed points. Evidence is measured at right angles to the line

Baseline

What animals paws are notoriously similar to human hands and feet

Bear

I knocked over a shelf and broke a clear glass unicorn and clear glass mason jar. both have nearly identical density, so I will need to use their refractive indices to determine which bits of glass go with which item. Which tools could I use to perform this task

Becke line analysis, polarizing light microscope, and hot stage refractometer

Drugs primarily used to treat anxiety

Benzodiazepines

Ridges splits into two ridges

Bifurcation

Which of the following characteristics can be used to identify a substance with very high analytical certainly

Birefringence

A copy of the original disk with evidence should be created to avoid contaminating the original evidence. It should be copied as what

Bitstream data copy

Oxidizes heme-reactive blood tests, causing false positive

Bleach

Bacteria in the stomach and intestine multiply extraordinarily and release a gas that has nowhere to go so the abdomen expands

Bloat

You are admitted to the hospital with a low body temperature, shallow breathing, slow heart rate, and pin-prick pupils, Doctors assume that you have overdosed on heroin, but need to know how much you've taken in order to effectively treat you. Which material should they test

Blood

Shiny green or blue flies that are quickly attracted to carrion

Blow flies

A body is carried away from the scene of death in the trunk of a car. Which trace evidence found on the body would best link the vehicle

Blue carpet fibers

Reacts with the heme-group to produce light; does not require complete darkness; used with cleaned up scenes

Bluestar

Ethanol has the formula of CH3CH2OH. When it combusts, what are the products of combustion

CO2, H2O, heat and light

When discussing weapons with a rifled barrel, such as revolvers, pistols, and rifles, which term describes the approximate width of the ammunition that it fires

Caliber

Which are forms of electronic surveillance

Camera surveillance and camera surveillance

A Plant-derived drug with complex effects; primarily smoked

Cannabis

Large yellow/black or red/black beetles that are attracted to carrion to eat the tissue

Carrion beetles

What patterns have a linear directionality associated with them

Castoff

Intermediate or transition phase of hair or fur growth

Catagen stage

What is defined as the disease or injury that initiated the lethal chain of events that lead to death

Cause of death

Both layer comparison and physical match can be performed with which type(s) of paint evidence

Chips

What part of a shotgun is constriction in the muzzle that restricts how much the expelled shot spread out

Choke

Evidence based on logical inference, not direct observation

Circumstantial evidence

Highly addictive stimulant drug, natural plant product

Cocaine

How should we test the idea that some form of tool or other force was used to vandalize a monument

Collect several pieces of granite of similar shape and thickness and hit each one with a different tool

What instrument measures color by elimination the subjectivity of human observation

Colorimeter

Which of the following methods would be ideal for identifying the source of a footprint

Comparing a ESLA dust lift to an inked exemplar

During this phase of ACE-V, fingerprints are places side-by-side and the location and orientation of the minutia are established

Comparison

Which of the following is not an entry level requirement for DNA analysts

Completion of analytical, inorganic, and physical chemistry courses

Postmortem redistribution refers to

Concentration changes that occur after death as drugs are absorbed from one bodily region into another

Evidence that 100% stands as offered

Conclusive evidence

Place the 4 stages of blood drop collapse in order

Contact, displacement, dispersion, and retraction

What term is defined as an accumulation of blood in the tissues outside the blood vessels

Contusion

Common features of a manual strangulation include

Contusion of the strap muscles and fracture of the thyroid cornu

Which of the following are types of hair scale forms found in the cuticle

Coronal, imbricate, and spinal

Dr. Kermit Frogg attended WVU. He has a bachelor's degree and PhD in forensic and investigative science and did an internship in emergency medicine. Which of the following jobs does he seem qualified to hold.

Coroner and Medicolegal death investigator

Evidence which shows either guilt or innocence in conjunction with other evidence

Corroborating evidence

Mammal hair component containing pigment

Cortex

The layer of hair containing pigment and giving the hair strength

Cortex

Small air pockets trapped within the hair body

Cortical fusi

Tiny air pockets in human hairs are known as

Cortical fusi

You find a small dry bloodstain on a suspect's sweatshirt. How should it be collected for long term storage

Cut the stain out and package in paper to allow it to breathe

Outermost, scaly component of mammal hair

Cuticle

The outer layer of the hair

Cuticle

Which of the following are examples of individual characteristics in footwear impressions

Cuts and scratches and embedded objects

Loads that never seem to change in a building

Dead loads

A person who is accused of a criminal act

Defendant

Nitrocellulose is the primary propellant in modern firearms cartridges When it violently reacts with the air, it does so through subsonic heat transfer. We can describe this reaction as ___, which makes nitrocellulose a ___

Deflagration, low explosive

3D casts of footwear - either exemplars - are made with ___ because it doesn't shrink, it captures detail very well, and it is inexpensive

Dental stone

What should all three dimensional tire or footwear impressions be cast with

Dental stone

To use NIBIN, what do you actually submit

Detailed photos of breech face, firing pin, ejector, and land markings on a test fired bullet

Duties of a first responder

Detain the witnesses and secure the boundaries of the crime scene

Most fingerprints are invisible until they have been developed using fingerprint powder, superglue fuming, or other techniques. What stage of evidence analysis would these generally be identified with

Detection

Steps of evidence analysis in order

Detection, preservation, identification, association, and reconstruction

The presence of a ___ in the body and bone marrow are indicative of the time and location of drowning

Diatoms

You are filling out an application for an apartment, when you realize you made an error in your social security number. You use a stiff eraser to clear away the error and write the correct number down. If we were to look at the application under the VSC, what would it detect

Different IR and UV reflection from the paper around the corrected area

The peaks in UV and IR spectra are caused by

Different types of chemical bonds in the material

The first thing to do at a crime scene to protect electronic evidence is

Don't permit anyone to touch the electronic devices

Ridge is short in length

Dot

Bones, hair, nails, and teeth are left. Cartilage and insects are in early dry remains

Dry remains

What is the chemical color test to confirm the presence of cannabinoids and THC

Duquenois Levine test

When should documentary notes be taken

During the on-scene investigation

Loads on a building that change during a relatively short period of time

Dynamic loads

Linkage of persons, scenes or objects is based on what

Edmond Locard's exchange principle

Immobile, tiny form deposited by females

Egg

In the ____ stage, the insects are only a few millimeters long, motionless, and are deposited by their parents in moist, protected areas.

Egg

How do coroners obtain their positions

Elected directly by citizens

What type of photography should be used for footwear impressions that cannot be taken to the laboratory

Examination quality photography

The most common primary cause for fatal vehicular accidents in 2009 was

Excessive speed

If you determine that your exemplar print and your evidentiary print to not come from the same finger, what would your conclusion be

Exclusion

Evidence which tends to contradict the prosecution's hypothesis of guilt

Exculpatory evidence

You inflate a balloon until it ruptures. This release of energy would be classified as

Explosion

T/F: Heterozygosity is when an individual has the same number of copies of an allele at the same loci on a pair of chromosomes

False

T/F: Historical investigations using proxy data are by definition forensic

False

T/F: There area a maximum of 2 alleles that can be found at any given locus

False

We can tell that an individual's genetic make-up dictates fingerprint pattern development because identical twins from the same fertilized egg also have identical fingerprints

False

Toxicologist Darnell performs a test for anabolic steroids in a urine sample, and gets a negative result. Given that the urine sample came from a man with a very muscular body and small head, what's our most likely description of the results

False negative

Which of the following is the type of fracture that indicates that a part has been partially cracked or damaged prior to accident

Fatigue-type fracture

Other personal forensic evidence collected at the crime scene would include

Fingerprints

Large grey and black stripped flies that lay live young instead of eggs

Flesh flies

What are the first insects usually attracted to remains

Flies

Right after death, not breathing or moving, the blood starts to settle in livor mortis and rigor mortis begins to set in. There are no orders, distortion, or green on the body

Fresh

A lead core wrapped in a brass covering, over the nose and sides of the bullet and usually the base as well

Full metal jacket bullets

Which technique is a type of confirmatory analysis

GC-MS

I have a sample of street cocaine that I believe to be cut with a variety of other materials. Which would be the appropriate test to figure out what all is in my sample

Gas chromatography

A pound of lead is made into a group of identical spheres, which fit into a shotgun barrel. The number of spheres made from the pound of lead describes which aspect of the firearm

Gauge

Which of the following methods would be appropriate for developing fingerprints on a piece of clear packing tape

Gentian violet and sticky powder

A group of people who evaluate the preliminary evidence to determine if a full trial should proceed

Grand Jury

What was Alexander Lacassagne's main contribution to forensic science

He helped people understand how people died and decomposed

A self contained test pad on a plastic strip, used with visible stains

Hemastix

Who was the first credited European to recognize the value of fingerprints as a means of personal identification

Herschel

The ability of the body to maintain a constant temperature

Homeostasis

What determines how much residue of an accelerant will be left and for how long

How volatile the accelerant is

Which of the following reasons support the idea that bite mark evidence should not be admitted for identification purposes

Human skin is soft and elastic

Place the steps for COODIS use in the appropriate order

1. Amplify sample using PCR 2. Generate an STR profile 3. Verify that the profile has results at a minimum of 8 loci 4. Submit your data against the CODIS database 5. Have a DNA analyst compare the returned profile against the profile from the evidence 6. If the DNA analysts concludes that they were from the same source, obtain a warrant for the CODIS result's personal information

Why is it important for forensics that in double stranded DNA, we always see that specific pairs A-T and G-C stuck together

If we have one half of the double helix, we can reconstruct the other perfectly

Hair has a(n) ___ cuticle, a(n) ___ medulla and a cortex that is approximately ___ of the total width of the hair shaft

Imbricate, unstructured, 65%

The McNaughten Rule is one way to determine for a defendent

Insanity

Which method provides the fastest, easiest method of explosives residues identification, even if it is somewhat susceptible to false positives

Ion mobility spectronomy

Which of the following QDE tasks is the most subjective

Is the document written by the claimed author

Two bifurcations facing each other

Island

Which statements about the AFIS system are true

It compares the locations/positions of ending ridges between the unknown and exemplars in the database, high match scores are likely to be identifications, and it compares the locations/positions of bifurcations between the unknown and exemplars in the database

An ESDA film lift could show which of the following pieces of information

It could show that a suspect document came from a particular pad or notebook

A woman believes that she has been sexually assaulted after someone added to rohypnol (a benzodiazepine) to her drink. However, she has also been prescribed Xanax for anxiety. If a blood test comes back positive for benzodiazepines, what would you believe

It is impossible to determine with this test

Your evil roommate steals a diamond ring from you, then attempts to pawn it. The police collect it as evidence in her trial for theft. What is likely to be the final disposition of that ring

It will be returned to it's rightful owner

How a gas defuses in air depends on a what

Its vapor density relative to air

Which legal case sets a precedent for the defendant to be committed to a civil hospital

Jackson v. Indiana

Multijurisdictional issues when examining electronic data include

Judicial search warrants

Seared/burned wounds, powder deeply embedded, suicidal or very close range

Less than 6"

Where are drugs primarily metabolized

Liver

Discoloration of the body due to settling blood

Livor mortis

Which PMI estimate would be effective at showing a PMI of 6-10 hours under normal environmental conditions

Livor mortis

A particular location with the genome

Locus

Reacts with heme group to produce very short-lived light; used with clean up scenes

Luminol

When analyzing glass to determine refractive index, what do we call the point at which the glass is no longer visible

Match point

The core of the hair, which may be highly structured

Medulla

Hairs and furs are predominantly composed of a protein and a pigment. What are they

Melanin, pigments, and keratin

Guilty intent

Mens rea

At a crime scene, you find used syringes. What are likely candidates for drug use

Methamphetamine and heroin

What is the general term for the set of particular features found in friction ridge patterns

Minutiae

The method by which an act is committed

Modus Operandi

What mechanism of death generally associated with extensive thermal trauma

Multiple organ failure

A man comes into the emergency room with a spiral facture of the humerus. He claims he broke his arm during a boxing match. Should we believe him

No, because spiral fractures result from arms being twisted, not punched forward

"Free base" and "crack" cocaine differ in what manner

None of the above

Glass beer bottle

Nonporous

Plastic water bottle

Nonporous

Smartphone screen

Nonporous

Which forensic specialty would handle a potential bite mark

Odontologist

Natural or laboratory-produced drugs used physical or emotional pain

Opiates and opioids

Characterized by clear forethought regarding the approach to and conduct of an offense

Organized offender

A vet tech is violently assaulted by a colleague at work, Which presumptive test would be useful at identifying the potential culprit blood vs. animal blood on her clothing

Ouchterlony double-diffusion test

Which of the following would be considered ignitable liquids

Paint thinner, starting fluid, and nail polish remover

Select the locations where friction ridges are found on humans

Palms, toes, soles of feet, and fingertips

The determination of paper thickness generally requires the use of which tool

Paper micrometer

What general category of stains includes transfer, flow patterns, saturation stains, and stains from dripping blood

Passive

Print that needs no enhancement to be clearly recognizable as a fingerprint

Patent

Incisions, punctures, and penetration

Penetrating trauma

Which of the following cases were legal cases that changed the precedent for psychologists to testify in legal court

People v. Hawthorne

Which tests can be used to reliably identify saliva

Phadebas, starch iodine test, and RSID immunoassay

One method of reconstructing a digital image in 3D is ___, relying on many measurements of known objects in the scent to be accurate

Photogrammetry

What are some reagents used to enhance residue footwear impressions

Physical developer and potassium thiocyantate

The most conclusive means of identifying or individualizing a paint chip is

Physical match

What kind of change does a drug cause once ingested

Physiological

A citizen who initiates civil legal action against another

Plaintiff

The focus point where two loads converge

Point of impact

Paper envelope

Porous

Plain cardboard box

Porous

what should be written on the sidewall of suspect vehicle tires before they are removed from the vehicle

Position on the vehicle

Ninhydrin is specifically used on ___ substrates, which absorb the fingerprint components.

Pourous

In the ___ stage, the insects stop feeding. They crawl from the body, looking for a safe secure place to hide

Pre-pupa

On their own, either acid phosphatase or prostate-specific antigen test would be considered a ___ test for semen

Presumptive

Evidence that is accepted as true until proven otherwise

Prima Facie Evidence

Assessment of characteristics of an unknown perpetrator, based on the way previous acts were committed

Profiling

Picking a victim based on his/her characteristics is known as what

Profiling

What is the name for tests based on the notion that an individual's response to an ambiguous stimulus reveals aspects for his/her personality

Projective tests

Portion of the hair found near the skin

Proximal end

What is the most reliable and specific indicator of the age of an adult skeletal remains

Pubis symphysis

In the ____ stage, the insects are motionless, in a safe hiding place, usually underground. They are protected by an outer shell, and they do not feed and they change their shape

Pupa

Immobile, nonfeeding stage where metamorphosis is completed

Pupal stage

A rock is thrown through a window. You observe a crack that goes from the point of impact to the edge of the window pane. How should this crack be classified

Radial

What form of spectroscopy measures the shifts in energy when light is scattered by the electron cloud of a module

Raman spectroscopy

When do basic patterns of friction ridge skin form

Second trimester of fatal development

Here is some information about a set of seized drugs from various points along the distribution path from Mexico to West Virginia. Along the way, each dealer cuts the heroin with additional materials to maximize the dealers profit. Seizure 1: 6g heroin, 10mg fentanyl, 20g maltose, 5g baby powder Seizure 2: 6g heroin, 20g maltose Seizure 3: 6g heroin, 10mg fentanyl, 20g maltose, 5g baby powder, 5g lactose Seizure 4: 6g heroin, 10mg fentanyl, 20g maltose Use the principle of divisible matter to figure out which seizure was collected first

Seizure 2

A sliding mechanism is manually operated for the first shot; a portion of the energy of that shot is used to expel the empty cartridge case and bring a new cartridge into the chamber

Semi-automatic action

When analyzing shoe prints, there may be a gap between the front and back of the impression, due to a structure called the

Shank

When a human or animal is exposed to an explosion, it is not uncommon for the lungs and eardrum to rupture due to the sudden pressure changes. These harms are caused by which aspect of the explosion

Shock wave

What is the most commonly used projectile in a shotgun

Shot

Black beetles that are found on bodies late in decomposition to feed on skin and hair

Skin beetles

Bones are recovered from a grave, along with a gold club. If the decedent had been beaten to death, what features would we expect to see on the bones

Smooth, sharp cracks or splinters with well-defined edges

Videography of a crime scene should include:

Sn opening segment showing the general orientation of the scene and a focus on the potential entry/exit methods of the perpetrator

Which color test produces a bright red color when it reacts with the lead components gunshot residue

Sodium rhodizonate

Where are three dimensional shoe impressions generally made

Soft exterior surfaces, dirt

Bullets with soft metal plus in the nose of the bullet specifically designed to expand the nose when it strikes a target

Soft point bullets

Lucky you! You live in a house with a very large, fenced in backyard. One day, you find a kitten in the middle of your yard. Which strategy would be a good one to figure out how it got in/where it came from

Spiral

This type of search is usually only effective on crime scenes with no physical boundaries/obstacles or regular boundaries

Spiral

In the context of a crime and investigation, forensic psychologists/psychiatrists often evaluate someone's competency to do what

Stand trial

The basic weight of the building itself and its contents

Static loads

Which microscope is generally employed for rapid preliminary examination of trace evidence

Stereo light microscope

What term is used to described the pattern of unburned powder that penetrates the skin

Stippling

The term morphology relates to what

Structure

Defined as the force that pulls the surface molecules of a liquid toward its interior, decreasing the surface area and causing the liquid to resist penetration

Surface tension

Recently, most states have legalized cannabinoid consumption, so long as it does not contain more than 0.3% of the significantly psychotropic cannabinoid

THC

Evidence which cannot be presented to the court due to its method of collection

Tainted evidence

Which is an example of a test generally considered to be confirmatory

Teichman test

Dormant stage of hair or fur growth

Telogen stage

What is the major active chemical in Marijuana

Tetrahydrocannabinol (THC)

We are testing a decedent's blood to determine if they died of an ecstasy overdose. The person has been dead for two weeks. Due to the age of the corpse, postmortem redistribution will have what effect on the amount of ecstasy we detect in the blood

The amount in the blood will be lower than it was at the time of death

A person is found cut into little pieces. Blood from the victim is found on my chainsaw. What is logically the defensible conclusion

The chainsaw was the tool used to cut up the victim

To be logical and decrease the likelihood of analyst error, bloodstains should be categorized relative to what

The events that produced them, The reverse order in which they were produced, and the possible sources and movement of these sources

Let's say you want to play with fire, and set out containers of the following substances Unleaded gasoline, which has a flash point of -43°C. Diesel fuel, which has a flash point of 52° Highly refined kerosene, which has a flash point of 38°C The ambient temperature in the room is 25 degrees, and you use a striker to produce a spark in the air. What happens immediately

The gasoline will ignite

What is/are skeletal markers typically associated with female identity

U shaped subpubic angle and broad and shallow sciatic notch

The correct presumptive test for Percocet (an opiate pain medication) would be

Urine immunoassay

A good example of a fixed point for sketching a crime scene would be

Utility pole

A sequence that repeats many times. The number of repeats can be highly erratic

VNTR

You are processing a crime scene, and you need to cover a large area looking for loose hairs. What's your best choice of tool to do so

Vacuum with filter

Erratic, rapid heart beat due to electrical interference

Ventricular fibrillation

Massive sustained contraction of the heart

Ventricular tetany

What characteristic of different parts of a molecule does IR spectroscopy analyze when exposed to IR light

Vibrations

Which pioneering forensic scientists made significant contributions in the area of firearms evidence analysis

Victor Balthazard and Calvin Goddard

Which scientist or scientists are responsible for the first book on hair analysis

Victor Balthazard and Marcell Lambert

Which section would you only expect to find in a crime lab that served a large, urban population

Violent crime case review

Which is the appropriate choice for initial survey for and detection of semen stains

Visual detection with ALS

What is the name for patterns that display an absence of bloodstains in otherwise continuous patterns of staining

Void patterns

The portion of the trial where jury members or forensic experts are evaluated for their ability to participate in a trial

Voir dire

When taking notes for documentation, "scene description information" consists of which of the following

Weather information and major structures

Which type of blood cells are needed for DNA typing

White blood cells

What characteristic does an enzyme need to be useful for PCR

Withstand extreme heat

What type of testing can unambiguously determine what a male has contributed to a mixed sample

Y-STR typing

Which of the following would generally constitute "secure physical custody"

Your personal keyed filing cabinet

Which of the following individuals are most likely to become the victims of myiasis

a bedbound 87 year old woman with diabetes

If we want to use the method demonstrated in lecture to determine an insect's age, what 4 pieces of information do we need

a measurement of the length of the maggots, the species of insect that we are dealing with, scientific data relating the size of the maggot to the temperature it has been growing at, and temperature records from the scene before the body was discovered

Small particle reagent could be used on prints that

are/have been wet

When do dental features begin to be detectable in humans

during fetal development

The set of rules that governs the proper, acceptable, and honest behavior of a forensic scientist are called the

ethics

In normal gel electrophoresis, a DNA fragment with 6 repeats of a VNTR sequence will move ___ than a DNA fragment with 10 repeats, because ___

further, small DNA chunks can move through the gaps in the gel more easily

What are the drawbacks of the starch-iodine test

it does not efficiently or accurately locate stains on evidence and common proteins such as albumin can false positive results

Print that requires additional processing to be made visible and suitable for comparison

latent

A presumptive test for blood can result in a false positive from

materials of animal origin, plant material/vegetable peroxidases, and chemical oxidants

There is a stain that measures 7 mm x 18 mm. How would you calculate its angle of impact

sin^-1 7/18

I am analyzing glass from a break-in. I take a small fragment of glass from an ordinary window at the crime scene. I place it in a test tube with some liquid sodium polytungsten, making the glass float. I then slowly add ethanol. After 3.4 mL of ethanol, the glass chip sinks into the liquid, but not to the bottom of the tube. I perform the same task with a fragment of glass collected from a suspect. After adding just 2.8 mL of ethanol, the suspect glass sinks to the bottom of the test tube. Based on these results, what is the correct immediate conclusion

The glass from the suspect has a higher density than the window glass

We are using the OBT1 to determine is a blood sample is human or not. The control area of the test does not change color. Which of the following statements about this test is true

The mobile antibodies did not bind to the immobile antibodies in the control zone

Sherwin Williams makes water-based latex paint in a number of different finishes (levels of shininess) matte, satin, semi-gloss, and glossy. If you compare two paints of the same color, but different finishes, which paint component will me chemically different

The modifier

Which of the following people should definitely be excluded from a crime scene where a Simon Cruz reportedly shot his wife Angelina, then set the building on fire

The next door neighbor who just came home from work, the channel 5 news reporter, and highway state trooper Jablonsky who heard about it on the radio

A document has a large black redaction in the middle of it. Using the video spectral comparator at a wavelength of 1400 nm, we can determine that the document originally said " alien remains stored at Groom Lake". What do we know about the physical properties of the inks

The obliterating ink absorbed light better at 1400 nm than the original ink did

What do the peaks in Raman spectroscopy indicate

The peak locations identify the types of chemical bonds in the molecule

What would be the best area to secure in gas station where an armed robbery tool place

The perimeter of the gas station, including pumps and driveways

Maximum allowable BAC for a driver in West Virginia is 0.08%. A calibrated breathalyzer has an error rate of +/- of 0.003, meaning that the measurement displayed may be up to 0.003 above or below the actual BAC. This breathalyzer shows a value of 0.081. What is our conclusion

The person may have been over the limit

All of the following are issues with vaginal secretion detection except

The specific test for vaginal secretions is expensive and difficult to perform

What distinguishes an explosion from combustion

The speed at which the reaction occurs

What is the flash point

The temperature at which a liquid forms an ignitable mixture

Describe the relationship between videography, still photography, and sketching on a crime scene

The three are complimentary, each serving a slightly different purpose

Several long, light brown and white modacrylic fibers are found on an otherwise nude dead body. What do these fibers suggest about the death

The victim was likely wrapped in a fake fur blanket

What is a false statement about fuels

They can only be volatilized and consumed in the liquid state

A nude body is found on the ground. Livor mortis is strongly developed on the lower legs, hands, arms, and sides of the hips. The buttocks, back of thighs, and middle back are very pale, as are the soles of the feet. What does this tell us about the likely circumstances of death

They were seated in a chair

A man burns his hand on a hot stove on Monday. He dies in an automobile accident on Wednesday, and is autopsied on Thursday. What would the pathologists do in response to the burn

They would observe and photograph it during the external examination phase

What is the analysis technique used for inks in which a solvent separates the ink components as they migrate up a plate

Thin layer chromatography

Key elements to observe and document for a vehicular accident include all but

Time of day

When using the gas chromatograph (GC) to determine someone's BAC, then we must have a peak emerge at the correct ___ to demonstrate that ethanol was present, and the ___ demonstrates the amount of the drug present

Time, peak size

Tire analysis is different from footwear analysis in which way

Tires are frequently compared using a 2D exemplar to a 3D casting

What is the purpose of a scientific journal such as "Forensic Science International"

To keep practitioners up to date

Luminol is best used in what kind of environment

Totally darkened

Which of these statements is true

Toxicologists work with drugs or poisons after ingestion

What is the name for marks left on photocopies caused from foreign material on or inside the operating parts of a copy machine

Trash marks

The entity which evaluates evidence to determine the outcome of the trial

Trier of fact

If the process of chemical etching is allowed to go on for too long, the surrounding metal will also be dissolved and the serial number will be permanently obliterates

True

Some forms of computer communications can completely bypass storing information on the hard drive

True

T/F: Footwear examiners are more readily able to identify or exclude older footwear, as it has an abundance of wear characteristics

True

T/F: For a quarter, the diameter of the coin would be a class characteristic

True

T/F: Human bones over approximately 80 years old are generally considered to be of historical, not forensic interest

True

Stippling only (can't wash), pattern is a little larger because the powder spread

12-36"

Approximately what percentage of latent prints yield an identification when using AFIS

15%

Barbituates were a class of drug that used to be used as anti-anxiety medications. However, they were dangerous because the dosage leading to death was relatively close to the therapeutic dosage. The LD50 of amobarbital is .06 g/kg of body weight. Each pill contains .2g of amobarbital. If you weight 60 kg, how many pills could you take before hitting the LD 50

18

Damage to the epidermis and an irritated dermis, reddened skin

1st degree

These young maggots feed on liquid protein

1st instar larva

What is the dental formula for a normal human child

2.1.2.

One of the class characteristics of tires, printed on the sidewall is the width of the tread, in millimeters. At a crime scene, a partial tire impression is found, but it's at least 250 mm wide. Which vehicle or vehicles cannot be eliminated as possible sources

2018 Ford F150 XLT, 265 mm standard tire width and 2012 GMC Denali, 295 standard tire width

Approximately how many bones does the human skeleton have

206

A highly decomposed body is recovered wearing a knit hoodie. While no bullets or cartridges cases are recovered, there is an oblong hole with a minimum width of 9 mm and a maximum width of 10.5 mm in the upper chest area. Assuming this hole was made by a firearm, which calibers of firearms could reasonably have produced it

9 mm Luger, .38 SPL, .357 Mag, and .40 S&W

It is June 13, 2018. You are a CSI who has been dispatched To the home of suspected missing person Peter Shin, whom no one has been able to contact for the past 6 days. During your walkthrough, you observe the following features. Which would lead you to focus on that area as a good source of evidence

A framed photograph has fallen from the wall and shattered on the floor

What is an opiate

A large class of drugs able to cause euphoria as well as relieve pain

Which type of document would be best for recovering DNA from

A letter in an envelope

Which of the following conditions would tend to lead to eyewitness error by the victim

A man is carjacked at knifepoint by someone of a different race

For small police departments, which form of forensic education is currently the most common for crime scene investigators

A police officer with additional training

Someone has sprayed "Go Pitt" in grey paint all over Woodburn hall. Based on video footage from the night, Alice Trumbull is arrested. Police find flecks of grey paint on a pair of shoes in her car. Based on this scenario, choose the accurate descriptors for each component of the crime, given the hypothesis that Alice is our culprit. 1. The fact the there are grey flecks of paint on the shoes and grey paint was used at the scene 2. Alice is a fine arts major at WVU currently taking a painting class 3. Surveillance footage of the night of the act, showing Alice in the act

1. Incriminating, corroborating, and circumstantial 2. Exculpatory, conflicting, and circumstantial 3. Incriminating, corroborating, and prima facie

Place the steps of tire impression casting in the correct order

1. Photograph the impression, overlapping as necessary 2. prepare the mold an liquid dental stone 3. Pour the dental stone into the mold 4. Mark with caster's initials or ID # 5. Allow to harden completely

Place the following events in the history of fingerprinting from oldest to most recent

1. Rashid al-Din Hammadani observes that fingerprints are unique 2. William Herschel begins fingerprinting Indian workers as a means of identification 3. Henry Faulds published a paper on the uniqueness of the permanency of fingerprints in Nature 4. William Herschel publishes on the uniqueness of fingerprints 5. Francis Galton publishes a comprehensive book on fingerprints classifying them into categories and describing individualizing features

A stimulant has all the following characteristics except

Reduced respiration

Which is not a common form of heat transfer

Reduction

What is the most common organization form for handling digital evidence

Regional task forces

The time at which a compound emerges from the gas chromatography or liquid chromatography column is referred to as

Retention time

___ is a potent nerve poison that can be produced from the castor bean (aka castor oil) plant,

Ricin

Stiffening of the muscles due to a depletion of glycogen

Rigor mortis

A toxicologist would be involved in the identification and quantification of which of the following materials

Ritalin (a treatment for attention deficit disorder), furocoumarin (an alkaloid produced by some root vegetables), nicotine (a plant product found in tobacco)

Large beetles that are attracted to carrion because they are predators of maggots

Rove beetles

What is not true about seminal acid phosphatase

SAP is found exclusively in seminal fluid

A short sequence in a particular location in the genome which repeats itself

STR

What is the main difference between traditional genetic fingerprinting and STR analysis

STR analysis compares the exact size of DNA fragments at specific loci instead of chipping the entire genome into fragments

When collecting charred samples from the point of origin to help determine which type of accelerant used, what is also important to collect

Samples from unburnt areas

A new drug from China causes you to feel super energetic and happy. It makes it unsafe to drive or operate machines like a toaster oven, and is commonly taken by young people. Doctors don't know what to do with it. Given that information, how should this new drug be scheduled

Schedule 1

A conscious attempt to deliberately attempt to minimize or deny symptoms of a mental disorder is known as what

Dissimulation

Ridge ends abruptly

Ending ridge

T/F: Inks and pigments that are the same objective color must be made of the same materials

False

T/F: Insects colonize humans differently than they colonize dead animals

False

T/F: It is easy to get a job as a full time anthropologist as long as you have a bachelor's degree in anthropology or forensic science

False

T/F: Primers in ammunition and blasting caps contain low explosives

False

T/F: Stenography is a good way to associate two different digital images with the same camera

False

Vlad Taltos is found dead at home lying on his couch. which evidence would be most strongly associated with a homicidal manner of death

He had multiple stab wounds to the abdomen

$127 in cash is recovered from the pocket of a drug dealer (10 bills total). Which would be appropriate ways to package this evidence

In a paper evidence bag, paper envelope, or plastic evidence bag

T/F: Monozygotic identical twins will have identical VNTRs

True

In the movie Jurassic Park, a character is climbing an electric fence when it is activated. Assuming that the fence is set for 8,000V, and Time is holding on with bare hands (80,000 Ohm resistance), how many amps is Tim exposed to

.1

Extensively damaged dermis, blistering below the epidermis, epidermis is destroyed, scarring, deep damage to dermis, can lead to skin not being able to fight off infection

2nd degree

Only entry wound, everything else can wash off

3'+

In healthy individuals, how long does blood typically take to clot once it has exited the body

3-15 minutes

Destroys the dermis, leading to charring and charcoaling, skin keeps secondary infection at bar (if epidermis is charred infection can't be fought), low thermal regulation

3rd degree

Large, voracious feeder which eventually departs the body

3rd instar larva

A tire impression should be cast up to how large, if present

4 foot in length

What is the range of total volume of blood in healthy individuals

4.5-6.0 liters

In the following sequence what is the name of this VNTR allele )the repeating sequence is GTCG) ACTAATCGAGTCGGTCGGTCGGTCGGTCGAATG

5

Gas fouling (dark ring around entry wound), powder stippling (unburned powder), darkened cloud around wound that you can't wash off

6-12"

Contusions, abrasions, lacerations, fractures

Blunt force trauma

What type of object produces lacerations rather than incised wounds

Blunt objects

Forensic serology can be described as the examination and analysis of

Body fluids

All other things being equal, which environment condition would have little impact on the rate of insect development

Body position

What color is blood saturated with carboxymyoglobin and carboxyhemoglobin

Bright red

What are examples of cut rifling

Broaching, scrape cutting, and hook cutting

The most common DNA reference sample is a ___ swab

Buccal

Which specialist would be responsible for identifying the voice of someone who has left a threatening phone call on the governor's voice mail

Digital examiner

___ impressions are collected from victims, police officers, or medical personnel so that they can be accounted for if similar impressions are found at the scene

Elimination

The ____ in your teeth is the hardest material in your body, and therefore more likely to survive trauma

Enamel

One method of making illicit methamphetamine is called "shake and bake". During the process, bottles like the one shown become hot enough to start fires. What is our source of ignition energy

Exothermic chemical reaction

T/F: A bachelor's degree is sufficient to practice some kind of pathology

False

T/F: A crime scenes boundaries are set and cannot be changed once defined

False

T/F: A detonation is initiated by a match or a flame

False

T/F: A difference of opinion between two experts indicates that one of the experts is unethical

False

T/F: A trait that can be either described as a present or absent is a metric trait

False

T/F: An examiner compares and impression obtained from the crime scene directly to the shoe in question

False

T/F: Because of their superior experience with properly exposed and focused photographs, dedicated forensic examiners usually take preferable photographs to the pathologist who performs the autopsy

False

T/F: Chemiluminescence occurs when a chemical substance is exposed to a particular wavelength of light and light energy is emitted at long wavelengths

False

T/F: Cocaine usually appears in large quantities in urine for up for three days following use

False

T/F: Consider a soldier hugging a dog and holding a dog's paw. All things being equal, we would expect the soldier holding the dog's paw to cause more transfer between the soldier and the dog

False

T/F: Crime scene tampering is the act of distorting the crime scene in an attempt to throw off investigators

False

T/F: Ecstasy (MDMA) is in the psychoactives/hallucinogen family, but meth is in the amphetamine family

False

T/F: Electrostatic lifting is an abrasive technique that will not allow for other techniques to be used afterwards

False

T/F: Evidence with class characteristics can be associated with a particular suspect

False

T/F: Fingerprints developed in situ may be lifted prior to being photographed

False

T/F: Forensic serologists receive and deal only with liquid samples

False

T/F: From it's inception, Forensic science has moved more towards a generalist model in which individual forensic scientists work across a variety of disciplines

False

T/F: I look at an image and decide that it depicts the specific individual known as Superman. I have just performed the task of identification

False

T/F: If the contents need to air dry, evidence packing may only be partially sealed with tape, as long as the contents aren't accessible

False

T/F: If the culprit is still on the scene, we would expect him/her to be found by the CSI or investigator in charge

False

T/F: In addition to his work on human identification, Alphonse Bertillon's other major contribution to the development of forensic science was a method for identifying arsenic and strychnine

False

T/F: The component of Lophophora diffusa that produces hallucinogenic is psilocin

False

T/F: The light microscope is an appropriate tool to identify the chemical composition of fibers

False

T/F: The most severe bitemarks usually have the highest forensic significance

False

T/F: The presence of gasoline at a fire scene would automatically make it an incendiary fire

False

T/F: The purpose of shoe covers is to prevent investigators from leaving footprints at the scene

False

T/F: The scanning electron microscope allows the investigator to visually detect molecules of smokeless powder

False

T/F: When a crime scene impression and a shoe sole share at least some individual characteristics, a positive identification can be made

False

T/F: When comparing hand writing samples a printed questioned material may be accurately compared to a cursive sample

False

T/F: the important region of mitochondrial DNA for identification is HVIII

False

T/F: the number of ribs in an adult depends on whether the person is male or female

False

T/F: the raised portions of rifling are called grooves and the cut out channels are called lands

False

T/F: the scanning electron microscope can be used to determine, the birefringence or anisotropy of a fiber

False

T/F: the size of a sharp object can be precisely determined from examination of the characteristics of the wound

False

The AFIS system only contains known prints

False

The main significance of Sherlock Holmes to the history of forensics was that Holmes invented a new test for blood

False

Which body part is particularly good for determining age in children under the age of 5-6

Hands

Where are two dimensional shoe impressions generally made

Hard interior surface, tile

Which statement(s) is/are about the Daubert decision

The judge is the sole arbiter of whether or not scientific evidence is admissible, scientific data must be specifically relevant to the case at hand, and evidence that is admissible under Frye is also admissible under Daubert

T/F: An important ethical consideration for forensic scientists and crime scene investigators is being aware and open about possibility of error in our tools, techniques, and our interpretation thereof

True

T/F: A common method for coroners to preserve DNA for future DNA analysis is to pull head hairs with roots and place them in an envelope

True

T/F: A major advantage of LIMS evidence system is that it is very quick to process chain of custody

True

T/F: A negative control is a sample of material evidence is found upon. When analyzed, we expect it to give a negative result

True

T/F: A significant reason that the admissibility of all forensic evidence must be considered is to weed out "junk science"

True

T/F: A teenager is found dead after apparently shooting himself with his mother's Smith & Wesson 9 mm semiautomatic pistol. During investigation, the trigger pull is measured at 2.5 lbs. This information suggests a higher possibility that the shooting was accidental

True

T/F: An elastic collision obeys Hooke's Law when deformation of each body occurs

True

T/F: Anthropological facial reconstruction is an excellent tool for showing the shape of features such as cheeks, chins, foreheads, and eyes

True

T/F: Basic fingerprint development is an expected skill for crime scene investigators

True

T/F: Before a firearm can be test fired, the examiner must verify that the weapon's action and safety devices work properly

True

T/F: Class characteristics are more difficult to determine from sliding tool marks than other types

True

T/F: Cut rifling tends to leave more forensically useful markings inside the rifled barrel

True

T/F: Data storage within a device is highly dependent on its operating system

True

T/F: Dental stone has a higher compressive strength than that of plasters

True

T/F: Even though the computer systems have no cognitive biases a human examiner makes the actual identification when dealing with fingerprints

True

T/F: Eyewitness testimony is a form of admissible evidence

True

T/F: Hair examiners can often conclusively eliminate a person as a source of a hair, but can rarely absolutely associate a hair sample to a given individual

True

T/F: High quality photographs or scans of fingerprints are acceptable for forensic use if the original fingerprints are damaged during lifting because fingerprints are not subject to the principle of divisible matter

True

T/F: In a civil trial, the offense is called a "tort", whereas in criminal trials it is either a misdemeanor or a felony

True

T/F: Line and grid searches work best with more than one searcher

True

T/F: Most tire and tread impression evidence collected by investigators is partial prints

True

T/F: One of the advantages of digital imaging is that it enables many more photos to be taken of a given crime scene

True

T/F: Personality inventories are the most well-supported psychological tests for establishing a personality profile

True

T/F: Ritalin and Percocet are controlled substances, but people can use them legally as long as they have a prescription from a medical doctor

True

T/F: Shoes obtained from a suspect many hours or days after the crime should include all footwear that the suspect owns

True

T/F: Shotgun barrels do not leave identifiable markings on shot, wads, or shot columns

True

T/F: The main weakness of the crime scene technician model is that they lack a broad perspective on the crime

True

T/F: The primary means of detecting ignitable liquids at a fire scene is scent

True

T/F: True identity can be hidden in the forging of criminal acts/endeavors

True

T/F: When a crime scene impression corresponds in both design and physical size of that design with the suspect's shoe, the association has a high evidentiary value

True

T/F: because insects may only be active at particular times of the year, or in particular habitats, they can connect a victim or a perpetrator to that time or location

True

T/F: entomology can be used to estimate the minimum elapsed time since death from hours after death to up to a year or sometimes more

True

T/F: fingerprint patterns can change during a lifetime only there is damage to the dermal skin layer

True

T/F: investigation of identity theft is a major area of work for digital forensics

True

T/F: some forms of computer communications can completely bypass storing information on the hard drive

True

T/F: the area of origin is always oriented in a straight line 90 degrees from the area of convergence

True

A skeleton has a cranium with wide open cranial sutures, smooth sternal rib ends, and a regular well-defined pubic symphysis. What is an appropriate age classification for this skeleton

Under 20

If you believe you have a bloody fingerprint on a Post-it, one appropriate development reagent would be ___

Leucocrystal violet

An expended cartridge case is expelled from the firearm by dropping a small arm; a new cartridge is brought into the chamber by bringing the arm up

Lever action

The number one problem with surveillance videos is usually caused by what

Lighting

What does physical developer react with in fingerprint residue

Lipids and non-lipid water insoluble components

During the investigation of a homicide, army CID investigators find a blood sheet with dried red stains on it. Place the steps to collect and preserve the stains for DNA analysis

1. Allow the blood stains to air dry 2. Cut a small sample from the bedding, wearing gloves and using sterilized tools 3. Store the samples in a -40- -80 degrees freezer until ready to process 4. Lyse the cells open to release the DNA 5. Treat with proteinase to break down the remaining cellular debris, and filter 6. remove DNA for analysis

Which of the following types of evidence would be particularly useful for crime scene reconstruction

A palm print on a windowpane

Botulinum toxin paralyzes the diaphragm, leading to death. Titus Pullo contracts botulism after eating improperly canned green beans. Choose the correct combination of manner and cause of death

Accidental and asphyxia

When attempting to recover serial numbers, why do we use acids for recovers

Acids attack the denser metal under the serial number more slowly than the metal surrounding the number

Let's take a look at Janet Weiss' 15th pair of chromosomes: Chromosome 15A: At locus 1352, Janet has the sequence ATCGGG At locus 1785, Janet has the sequence ATCGGG Chromosome 15B: At locus 1352, Janet has the sequence ATCGGG At locus 1785, Janet has the sequence ATCGGA Which statement describes her situation correctly

At locus 1352 she is homozygous and at locus 1785 she is heterozygous

At an investigation, you find some white powder. You apply Scott Reagent, which immediately turns blue. What drug do you likely have

Cocaine

The proper chemical name for super glue used in fingerprint development is ___

Cyanoacrylate

What is determined by examining the orientation of tails, spines, and satellites from individual stains

Direction of travel

When analyzing bloodstains, analysts first determine the ___ by examining the narrow end of elongated blood stains, and the ___ by evaluating the relationship between the length and width of an individual stain. The ___ is then determined by noting where the paths of travel of several blood stains converge. Finally integrating impact and travel information, the ___ can be located in three dimensional spaces

Direction of travel, angle of impact, area of convergence, area of origin

Where should the camera be positioned when taking photographs of footwear impressions used for examintation

Directly above

Characterized by an impulsive and generally thoughtless approach to offending

Disorganized offender

Portion of the hair found far from the root

Distal end

Which group is the ultimate destination for physical evidence and forensic information

District attorneys

On sketches, the portion containing the case number, offense type, victim name, location, etc. is known as the

Documentation block

What force typically moves the slide or breechblock back to the cocked position after a semiautomatic pistol is fired

Energy produced by the fired cartridge

A cigarette butt is found at a crime scene. Which type of cells are likely to be recovered

Epithelial cells

Most of the tests used at crime scenes are presumptive tests, which have a certain likelihood of false positives. Why is this ok

Even if we accidentally collect non-blood related material, confirmatory tests conducted at the lab will collect it

A picture of some evidence is collected. The scale is closer to the camera than the evidence. What is the consequence for pattern analysis

Evidence measured using the photo scale will turn out too small

What is one way that insects can indicate that an animal was killed by a hunter as opposed to disease or illness

Finding many larger, older maggots in locations far from natural orifices

Tissue and living cells forming the proximal tip of a hair strand

Follicular tag

Drugs which are used to alter perception or consciousness

Hallucinogens

How does the general or idealized scientific method differ from the way it is typically implemented by forensic scientists

Forensic scientists usually start from observations before developing a hypothesis

William Shakespeare's grave is located under the tiled floor of Holy Trinity Church in Stratford-upon-Avon. Over the gravestone is a curse for anyone disturbing the grave, supposedly written by Shakespeare himself. If you wanted to confirm that the grave was occupied, but avoid the curse, which remains location technique would be best

Ground penetrating radar

Which of the following items should be analyzed using the comparison microscope

Hairs

A small chip of glass is collected from the cuff of a suspect's pants. A quick check with a stereomicroscope shows the chip to be laminated glass. The suspect claims he broke the glass of a picture frame

He is definitely lying, since picture frames would not be made of laminated glass

Cancer survivor Wade Wilson runs a marathon and celebrates by eating 18 chimichangas. He then has a heart attack and dies. What is his cause of death

Heart attack

Which members of the following list are schedule I drugs

Heroin and LSD

Small grey and flack flies that are attracted to all kinds of decaying garbage

House flies

Pharmacokinetics is described as

How drugs and other complex molecules move through the body

Which stage of crime scene reconstruction is this: "After scene examination and observation, physical evidence such as fingerprints or impression pattern evidence is used to create a working idea of how the crime happened

Hypothesis formation

A fire that is purposefully ignited by a human would be classified as

Incendiary

What is the most common means of consuming cannabis products

Inhalation

What are key reasons that PCR amplification is routinely performed on all samples for modern DNA analysis

It generates a lot of identical copies for our sample, making electrophoresis results much easier to read, it only copies loci that we care about, cleaning up a lot of background noise, and it can help compensate for damaged or degraded DNA samples by making copies of intact segments

What is the purpose of headspace analysis in fire evidence

It separates chemicals from burned debris

A stain is approximately twice as long as it is wide. What can we say about the angle of impact

It was close to 30 degrees

Post-blast analysis of explosives residues shows large quantities of urea and nitrate. What do these results suggest about the explosive device

It was probably homemade

Reacts with the iron in the hemoglobin to turn a suspected visible or faint blood stain pink

Kastle-meyer

In the ____ stage the insects are actively feeding. They have no legs, wings, or eyes and wormlike bodies

Larva

Contain elements such as antimony or tin, used in weapons with a higher muzzle velocity, ductile, and malleable, easily marking by rifling

Lead alloy bullets

Soft and readily deformable, used in low velocity firearms, easily marked by rifling

Lead bullet

The compensation for wear, design flaw, or ordinary abuse and neglect that can be reasonably anticipated when construction is taking place

Margin of safety

Reacts with the iron in the hemoglobin to turn a suspected visible or faint blood stain green

McPhail's reagent

What trauma occurs when applied physical force exceeds tensile strength of the tissue to which the force is applied

Mechanical

Central structure of a mammal hair

Medulla

All of the following are typically used to identify the printer/creator of a document except

Microprinting

Which single aspect of dentistry makes teeth good for individualizing unknown persons

Most people have dental x-rays made on regular basis while they are alive

Assuming ordinary sexual reproduction, you inherited your mitochondrial DNA from your

Mother

Assume that after determining that the glass from a suspect has a higher density than the window glass, both chips were suspended after 3.4 mL of alcohol. Could I then conclude that the suspect chip had definitely come from the broken window (individualization)

No

Why do tire manufacturers design tires with different side tread blocks

Noise treatment

What type of forgery is where an individual does not attempt to copy the victim's signature or writing

Normal hand forgeries

What would be the best way of identifying an unknown substance made of small crystals

Perform a chemical analysis on any kind of sucrose sugar as the standard, the same analysis of the unknown, and compare the results

When fantasies are used to organize a collection of deviant thinking into a criminal thought, it is known as what

Premeditation

Nitroguanidine detonates when heated to 165 degrees Fahrenheit, when slid across rough surfaces, or when dropped from a height of approximately 10 feet. How should it be classified

Primary high explosive

A sliding mechanism is moved backwards to expel a cartridge and forwards to pull a cartridge into the chamber typically from a tubular magazine

Pump action

The size, quantity, and distribution of blood spatters vary depending on what

Quantity of blood subjected to impact, quality of blood subjected to impact, and force of the impact

The main information used for identifying minerals in soils are

RI and birefringence

Which piece of evidence generated during an arson would we expect to have the longest persistence at the scene

Scorch marks on cement foundation

What is the usual name of the area where material from the grave and surrounding area is sifted through to reveal human remains, artifacts, fibers, and associated insects

Screening area

Extremely small flies, poor fliers, that are attracted to bodies later in decomposition

Scuttle flies

A woman is stabbed after a confrontation with her business partner. Investigators find a cotton rag in the culprits car, apparently used to wipe off the knife. The blood on the rag would be properly described as

Secondary transfer

A lead core partially wrapped in crass or aluminum, leaving either the nose or the base exposed

Semi-jacketed bullets

Unsealed plywood

Semiporous

Identify the common secondary explosives

Semtex, ANFO, TNT,

Which of the following is an example of irreversible work during an automobile accident

Skidding

You have found a suspicious round role in an article of clothing, and you want to know if it is a bullet hole. Which test should you use

Sodium rhodizonate test

For a quantity of blood in the air, ___ created by the mutual attraction of blood cells holds the blood together. ___ resists flow, causing the blood to slosh slowly rather than run. Once it strikes a surface, these two forces are balanced by the ___ imparted by the speed of travel at impact

Surface tension, viscosity, kinetic energy

Confirmatory test which produces hemochromogen crystals

Takayama test

A man is found dead of an apparent fentanyl overdose, with a blood concentration of 22.7 ng/mL of blood. What would a toxicologist need to know about fentanyl to determine when the dosage was taken

The absorption rate of fentanyl

The primary challenge of explosives analysis is

The device and its residues are often very difficult to locate

What features associated with a quarter would be individualizing

The number and position of scratches

When using the hot oil method, what do we compare between our suspect and our known

The temperature at which the outline of the glass disappears

Why do we wear colored glasses when using the ALS system

They filter out background wavelengths that would obscure evidence and the light wavelengths being used can damage the eye

With a gas or liquid chromatograph, the location of the peak on the X axis is measured in ___, and indicates the ___. the size of the peak indicates ___. With a mass spectrometer, the location of the peak on the X axis tells us the ___ and indicates ___. The size of the peak tells us ___

Time, identity of a chemical, the amount of the chemical, ion size, part of the molecular structure, how common that fragment is

T/F: A command post should be at the crime scene, but outside the secured zone

True

A ___ is a design pressed into paper pulp during the manufacturing process that leave behind a semi-translucent area

Watermark

When the dandy roll presses a pattern into wet pulp, a ___ is formed

Watermark

Most of the time, when we identify evidence, we test the hypothesis that the evidence from the crime scene is from the same source as a bit of reference evidence. We can easily disprove that hypothesis by finding any differences between the two items. In footwear analysis that rule is a bit more relaxed

We accept that shoes may acquire or lose characteristics between when the crime was committed and when they were collected


Conjuntos de estudio relacionados

Voting and Political Participation (17) - American Government

View Set

Developmental Psych Chapter 2: Biological Beginnings

View Set

CompTIA A+ 802 Practice Questions

View Set

Chapter 3: Evaluating a Company's External Environment

View Set

Guía de Estudio para el examen de conocimientos

View Set

BSAD 181 Midterm Exam (Chapter 14)

View Set

Chapter 6: Attitudes and Persuasion

View Set