Mastering Genetics - Chapter 9 HW

[35a] Which region of a tRNA molecule binds to amino acids? a) Anticodon loop b) 3′ end c) Variable loop d) Codon loop

3′ end

A tRNA in the P site of the ribosome will enter the ________ site after translocation of the ribosome. a) initiation b) E c) A d) 3' e) 5'

E

Ribosomal subunits are large complexes composed of numerous polypeptides and at least one rRNA molecule. Which subunits include three rRNA molecules? (See Section 9.1, p. 316) a) Eukaryotic large subunits b) Eukaryotic small subunits c) Bacterial large subunits d) Prokaryotic small subunits

Eukaryotic large subunits

________ helps control ribosome formation and binding of the initiator tRNA. a) Initiation factor protein b) Peptidyl transferase c) Kozak sequence d) GTP

Initiation factor protein

[35b] Which of the following statements best describes the function of aminoacyl tRNA synthetase? a) It attaches a specific amino acid to a tRNA molecule. b) It helps tRNA synthesize proteins. c) It synthesizes tRNA molecules. d) It provides the energy required to attach a specific amino acid to a tRNA molecule.

It attaches a specific amino acid to a tRNA molecule.

How does the eukaryotic ribosomal small subunit recognize the start codon on the mRNA? a) It undergoes a conformational charge that recruits other proteins when it hydrogens bonds to the correct tri-nucleotide sequence. b) It binds an Met-tRNA to the first AUG codon it encounters. c) It performs an ATP hydrolysis within the small subunit once it encounters a Met-tRNA already bound to the AUG. d) It wraps the mRNA strand to bring initiation enhancer proteins into the vicinity of the start codon. e) It binds an Met-tRNA to the first AUG codon after the Kozak sequence.

It binds an Met-tRNA to the first AUG codon after the Kozak sequence.

If the first nucleotide in a codon is mutated to a different nucleotide, what would be the effect on the encoded protein? a) No effect as the problem nucleotide would be corrected by RNA editing mechanisms. b) A missense mutation from one encoded amino acid changing to another. c) A silent mutation and no change in the encoded amino acid. d) It depends on what the changed nucleotide is. e) A frameshift mutation for all of the subsequent amino acids in the protein.

It depends on what the changed nucleotide is.

The preinitiation complex forms in bacteria when the start codon is recognized through binding of 16srRNA and what region of mRNA? a) Kozak sequence b) Shine-Dalgarno sequence c) Pribnow box d) Goldberg-Hogness box

Shine-Dalgarno sequence

Which units that describe the speed of sedimentation of a substance during centrifugation are ribosomal subunits measured in? a) Svedberg units (S) b) alternative sigma subunits (σ) c) map units (m.u.) d) centiMorgans (cM)

Svedberg units (S)

How might a single base INSERTION into the second codon of the coding sequence of a gene affect the amino acid sequence of a protein encoded by the gene? a) The amino acid sequence would be altered. b) A single amino acid could change. c) The mutation may have no effect on amino acid sequence. d) A single extra amino acid would be present in the protein. e) All of the above are possible outcomes.

The amino acid sequence would be altered.

How does the eukaryotic initiation complex locate the correct start codon? a)The correct start codon is the first ATG encountered downstream of the Kozak sequence. b) The true start codon is the first ATG encountered downstream of the Shine-Dalgarno sequence. c) The initiation complex moves the small ribosomal subunit through the 5' UTR, scanning for the start AUG. d) The correct start codon is the formyl-ATG, which will encode for fMet in the protein. e) The pre-initiation complex moves the ribosome through the 3' UTR, scanning for the Kozak sequence.

The initiation complex moves the small ribosomal subunit through the 5' UTR, scanning for the start AUG.

What does it mean for two codons to be synonymous? a) They are adjacent on the mRNA. b) They share two of the same nucleotides in their codon sequence. c) They encode the same amino acid. d) They occur in equal abundance in an mRNA sequence. e) They share one of the same nucleotides in their codon sequence.

They encode the same amino acid.

In the process of translational initiation in bacteria, where does the initiator tRNA first bind to the ribosome? (See Section 9.2, p. 321) a) To the partial P site on the small ribosomal subunit b) To the partial P site on the large ribosomal subunit c) To the partial A site on the small ribosomal subunit d) To the partial A site on the large ribosomal subunit

To the partial P site on the small ribosomal subunit

[35c] Each aminoacyl tRNA synthetase is specific for one amino acid and a small number of tRNAs. a) True b) False

True

What is the final step of translational initiation in both bacteria and eukaryotes? (See Section 9.2, p. 321) a) Binding of the initiator tRNA to the AUG start codon b) Union of the large subunit with the small subunit to form the intact ribosome c) Binding of the intact ribosome to the 5' cap on the mRNA d) Binding of GTP to the intact ribosome

Union of the large subunit with the small subunit to form the intact ribosome

VOID 41

VOID 41

In bacteria, the methionine that initiates the formation of a polypeptide chain differs from subsequently added methionines in that _______. a) incorporation of the initial methionine does not require a tRNA b) a formyl group is attached to the initiating methionine c) its tRNA anticodon is not complementary to the AUG codon d) the initiating methionine is not an amino acid

a formyl group is attached to the initiating methionine

What would you expect to find bound to the stop codon at the A site? a) an uncharged tRNA b) a translation release factor c) a charged tRNA with the anticodon ATC d) a charged tRNA with the anticodon TAG e) Nothing binds to a stop codon, which is why the peptide is released.

a translation release factor

A portion of an mRNA attached to a ribosome reads: 5' GACCAUUUUUGA 3' If a tRNA with a Phenylalanine amino acid attached is in the P site of the ribosome, an empty tRNA will be present in the E site that delivered which amino acid? a) tyrosine b) aspartic acid c) serine d) histidine e) proline

histidine

What are the three phases of translation? Select the three correct answers. a) elongation b) termination c) initiation d) preinitiation e) dissociation f) processing

initiation, elongation, termination

Thanks to flexible base pairing, the wobble nucleotides in anticodons can be one or more of the standard RNA nucleotides or which modified nucleotide? a) methyladenosine (mA) b) pseudouridine (ψ) c) deoxycytidine (dC) d) inosine (I)

inosine (I)

The Shine-Dalgarno sequence in bacteria ________. a) is a consensus sequence involved in the termination of translation b) is a purine-rich consensus sequence found in the 16S rRNA subunit c) is a pyrimidine-rich consensus sequence found in the 3' UTR of the mRNA d) is a purine-rich consensus sequence found in the 5' UTR of the mRNA e) is a region of the tRNA molecule involved in formation of charged tRNAs

is a purine-rich consensus sequence found in the 5' UTR of the mRNA

[23b] When a peptide bond is formed between two amino acids, one is attached to the tRNA occupying the P site and the other _______. a) is attached through hydrogen bonds to the mRNA b) is free in the cytoplasm c) is attached to the tRNA occupying the E site d) is attached to the tRNA occupying the A site

is attached to the tRNA occupying the A site

Binding of what protein initiates translation-termination events that result in polypeptide release and dissociation of ribosomal subunits? a) scanning factor (SF) b) release factor (RF) c) initiation factor (IF) d) elongation factor (EF)

release factor (RF)

During elongation, which location on the ribosome is the charged tRNA recruited to? a) A site b) E site c) small subunit d) P site

A site

What is a charged tRNA? (See Section 9.2, p. 321) a) A tRNA that is bound to an initiation factor (IF) b) A tRNA that carries a specific amino acid c) An ionic form of a tRNA d) A tRNA that is bound to the small ribosomal subunit

A tRNA that carries a specific amino acid

What normally binds to an open A site on the ribosome? (See Section 9.1, p. 316) a) A tRNA that carries the next amino acid to be added to the polypeptide chain b) The 3' UTR (untranslated region) of the mRNA c) An empty tRNA after its amino acid has been added to the polypeptide chain d) The initiator tRNA that carries the first amino acid in the polypeptide chain

A tRNA that carries the next amino acid to be added to the polypeptide chain

What is the cellular location of the stages of translation in bacteria and eukaryotes? a) membrane for bacteria and cytosol and rough ER for eukaryotes b) cytosol for bacteria and cytosol, mitochondrion, and plastid for eukaryotes c) cytosol for bacteria and eukaryotes d) cytosol for bacteria and nucleus for eukaryotes e) nucleoid for bacteria and rough ER for eukaryotes

cytosol for bacteria and cytosol, mitochondrion, and plastid for eukaryotes

Many antibiotics cause mispairing between codons and anticodons. What fatal effect would this mispairing have on the cell? a) abnormalities in vesicular transport b) defective pre-mRNA synthesis c) abnormalities in membrane transport d) defective protein synthesis

defective protein synthesis

A mutagen has introduced a frame-shift mutation by adding one nucleotide base. Which of the following could be a reversion mutation for this particular mutant? a) deleting 1 base or adding 3 bases b) deleting 1 base or adding 2 bases c) deleting 1 base or adding 1 base d) deleting 2 bases only e) adding 1 base only

deleting 1 base or adding 2 bases

Sidney Brenner demonstrated that the triplet code is, in fact, nonoverlapping. Assuming a nonoverlapping code, how many complete codons would the following sequence encode before encountering a stop codon? 5' - AUGCGAUUAUAGUGC - 3' a) 3 b) 5 c) 2 d) 4

3

Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' a) 5' - AUG CGA UUU GGG UGC - 3' b) 5' - CTA GCA CCC AAA TCG CAT TAG - 3' c) 5' - ATG CGA TTT GGG TGC TAG - 3' d) 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5' e) 5' - AUG CGA UUU GGG UGC UAG - 3'

5' - AUG CGA UUU GGG UGC UAG - 3'

[23a] Once elongation is underway, tRNAs involved in the process occupy a series of sites on the complexed ribosome. The occupation of sites occurs in the following order. a) P Site, E Site, A Site b) A Site, P Site, E Site c) A Site, P Site, E Site, S Site d) A Site, S Site, E Site

A Site, P Site, E Site

How many different aminoacyl-tRNA synthetases can be found in a given organism's cells? a) At least 20, or more depending on the organism b) 61 c) 20 d) 16 e) The number varies greatly depending on the organisms type.

At least 20, or more depending on the organism

Which of the following steps in translation is NOT facilitated by elongation factors? (See Section 9.2, p. 321) a) Recruitment of charged tRNAs to the A site b) Translocation of the ribosome along the mRNA c) Formation of peptide bonds between sequential amino acids d) Binding of initiator tRNA to the AUG start codon

Binding of initiator tRNA to the AUG start codon

In eukaryotes, the initiation factor proteins eIF1A and eIF3 join with ________ to form the preinitiation complex. a) charged tRNA(Met) b) the P site of a ribosome c) elongation factors d) peptidyl transferase

charged tRNA(Met)

Eighteen of the amino acids have two or more synonymous codons. Which two amino acids are the exceptions? a) Cys and Tyr b) Cys and Trp c) Met and Tyr d) Met and Trp

Met and Trp

Given the following mRNA sequence, what is the amino acid sequence for the corresponding polypeptide? 5' - AUG CGA UUU GGG UGC UAG - 3' a) N-Met-Asp-Phe-Gly-Trp-C b) N-Arg-Phe-Gly-Stop-C c) N-Met-Arg-Phe-Gly-Cys-C d) C-Met-Arg-Leu-Glu-N e) 5'-Met-Arg-Phe-Gly-Stop-3'

N-Met-Arg-Phe-Gly-Cys-C

During translation initiation in bacteria, the amino acid on the initiator tRNA is ________. a) IF-1 b) added using ATP as the energy source c) methionine (Met) d) N-formylmethionine (fMet) e) acetylated

N-formylmethionine (fMet)

In the unlikely event that a tRNA has been charged with the wrong amino acid, which high-fidelity enzyme most likely caused the incorrect charging? a) aminoacyl peptidase b) aminoacyl synthetase c) DNA polymerase III d) peptidyl transferase e) DNA polymerase I

aminoacyl synthetase

A portion of mRNA attached to a ribosome reads: 5'-GACCAUUUUUGA-3' In the polypeptide produced, what amino acid will be attached to the amino group of the histidine encoded by this mRNA? a) serine b) aspartic acid c) phenylalanine d) proline e) tyrosine

aspartic acid

Elongation factors translocate the ribosome in the 3' direction by a distance of __________. a) one nucleotide b) one codon c) two nucleotides d) three codons e) two codons

one codon

If you were designing an antibiotic that inhibits peptide bond formation, what enzyme would you target? a) glycoside hydrolase b) 8-oxo-dGDP phosphatase c) tRNA synthetase d) peptidyl transferase

peptidyl transferase

Bacteria group their genes such that they share a single promoter and the mRNA transcript synthesizes several different polypeptides. Collectively, these are referred to as ________ mRNAs, which are part of the operon system. a) processed b) polycistronic c) monocistronic d) polyadenylated

polycistronic

A polycistronic mRNA contains multiple ________. a) Shine-Dalgarno sequences b) promoters mRNAs c) Kozak sequences d) polypeptide-producing sequences

polypeptide-producing sequences