Microbio Exam 2

Sort the following events according to whether they occur in replicative transposition, nonreplicative transposition, or both:

- Replicative: Donor DNA retains a copy of insertion sequence., Recombination separates donor and target DNAs. - Nonreplicative: Hairpin structures form on each end of insertion sequence., Insertion sequence "jumps" into recipient DNA., Donor DNA loses insertion sequence. - Both: DNA polymerase fills in gaps, Transposase is required., Target sequence gets duplicated., DNA ligase seals nicks

A particular piece of double-stranded DNA is exactly 800 kb in length.The number of individual nucleotides in this piece of DNA is ________ bases.

1,600,000

E. coli DNA polymerase III has which of the following activities? A. 3′ to 5′ exonuclease B. 5′ to 3′ RNA synthesis C. DNA ligase D. 3′ to 5′ DNA synthesis

A. 3′ to 5′ exonuclease

Which of the following DNA molecules would most likely have the highest denaturation temperature (melting temperature, Tm)? Only a single strand of the double-stranded DNA is shown. A. ACGGTGACGGCGCGAGCGC B. ACATTCGTAGTATCGCTTTTT C. AACACTTAGTTATAATTGATT D. AGTTACAGTAACTAACAAAT

A. ACGGTGACGGCGCGAGCGC (highest GC content)

Which of the following elements may be present as part of the prokaryotic genome? A.plasmid B.prophage C.RNA D.chromosome

A. plasmid B. prophage D. chromosome

For the bacterial RNA polymerase holoenzyme, which of the following are the core subunits or factors needed for transcription? A.alpha subunits B.beta-prime subunit C.sigma factor D.beta subunit E.omega subunit

A.alpha subunits B.beta-prime subunit D.beta subunit

When intracellular levels of tryptophan are low, the _________ stem loop forms, which results in ___________ of transcription. A. 2:3 / termination B. 2:3 / progression C. 3:4 / progression D. 3:4 / termination

B. 2:3 / progression

When green plants are exposed bright sunlight & 14CO2, in what time-order will metabolites become 14C-radioactive? A. 3-phosphoglycerate, ribulose 1,5 bisphosphate, glyceraldehyde 3-phosphate B. 3-phosphoglycerate, glyceraldehyde 3-phosphate, ribulose 1,5 bisphosphate C. Ribulose 1,5 bisphosphate, 3-phosphoglycerate, glyceraldehyde 3-phosphate D. Ribulose 1,5 bisphosphate, glyceraldehyde 3-phosphate, 3-phosphoglycerate E. None of the given 14C-radioactive labeling orders are correct.

B. 3-phosphoglycerate, glyceraldehyde 3-phosphate, ribulose 1,5 bisphosphate

In the Calvin cycle, carbon dioxide is covalently incorporated into sugars.This is known as which of the following? A. CO2 oxidation B. CO2 fixation C. CO2 catabolism D. CO2 heterotrophy

B. CO2 fixation

Sigma factors are necessary in which phase of transcription? A. Activation B. Initiation C. Elongation D. Termination

B. Initiation

Which of the following statements is true? A. Viruses limit evolution. B. Viruses may limit host population density. C. Viruses do not jump from one species to another. D. Since viruses are so small, they have a negligible impact on the environment.

B. Viruses may limit host population density.

The covalent attachment of an acetyl group to a protein is an example of . . . A. Acetyl groups do not covalently attach to proteins. B. posttranslational modification. C. protein degradation. D. transcriptional regulation.

B. posttranslational modification.

In E. coli, the sigma S regulon is important for cellular responses to which of the following? A.chemotactic stimuli B.oxidative stress C.nutrient depletion D.excess glucose E.pH extremes

B.oxidative stress C.nutrient depletion E.pH extremes

Electron transport chains pump which of the following across membranes? A.electrons B.protons C.hydrogen atoms D.neutrons

B.protons

A bacterial cell is infected by a phage with an RNA genome. The bacteria has not encountered this phage before. Which of the following correctly describes host defense mechanisms that can help protect the bacterial cell? A. Only CRISPR can provide defense in this case. B. Only restriction endonucleases can provide defense in this case. C. Neither CRISPR nor restriction endonucleases can provide defense. D. Both CRISPR and restriction endonucleases can provide defense.

C. Neither CRISPR nor restriction endonucleases can provide defense.

A specific virus always infects . . . A. a wide range of species. B. a small number of closely related species in the same genus. C. The number of species depends on the virus. D. only a single species.

C. The number of species depends on the virus.

Which of the following is NOT true concerning all bacterial plasmids? A. They may exist in multiple copies in a single cell. B. They may be transmitted horizontally from one bacterium to another. C. They are always linear DNA. D. They may contain antibiotic resistance genes.

C. They are always linear DNA.

In the analogy of a computer virus to a biological virus, a personal computer is analogous to . . . A. the immune system. B. the viral nucleic acid. C. a cell. D. a virus protein coat.

C. a cell.

Which protein is necessary for extending the linear ends of eukaryotic chromosomes? A. Intronase B. Phosphodiesterase C. Histones D. Telomerase

D. Telomerase

The enzyme photolyase repairs DNA damage caused by . . . A. photolation B. alkylating agents. C. denaturation. D. UV radiation. E. deaminating agents.

D. UV radiation.

The start of bacterial replication depends on the increase in the concentration of active ________________, which accumulates during the growth phase of the microbe.

DnaA

Upon successful completion of conjugation, the donor cell is _________ & the recipient cell is .____________

F+, F+

Light absorption raises an electron to a higher energy state.

Photoexcitation

Light energy is used to separate an electron from a molecule.

Photoionization

Light energy is coupled to splitting of a molecule (e.g., water).

Photolysis

Light energy is converted to chemical energy and used to fix CO2.

Photosynthesis

Light-absorbing pigments coupled to an electron transport chain

Photosystem

Which phrase best describes the meaning of the term "genome"? a. all the genetic information possessed by a cell or virus. b. the dry weight of an organism's total nucleic acid c. any double-stranded DNA (dsDNA) molecule. d. the number of chromosomes present in a cell. e. the nucleotide sequence of a given gene

a. all the genetic information possessed by a cell or virus.

Uncoupling agents, such as dinitrophenol (DNP) lower intracellular ATP concentrations by... a. allowing protons to cross the membrane without flowing through ATP synthase. b. rapidly hydrolyzing ATP into ADP and Pi. c. preventing fermentation. d. preventing transport of electrons through the ETS.

a. allowing protons to cross the membrane without flowing through ATP synthase.

A secondary chromosome is distinguished from a plasmid because a secondary chromosome . . . a. carries one or more essential genes. b. is smaller than the primary chromosome. c. is a double-stranded DNA molecule. d. replicates independently of the primary chromosome.

a. carries one or more essential genes.

Cis-antisense RNA (asRNA) differs from regulatory small RNA (sRNA) in its ability to . . . a. block access to the promotor region of their target gene. b. cause premature transcription termination of mRNA. c. function as alternative sigma factors. d. effect post-translational control. e. be translated by ribosomes.

b. cause premature transcription termination of mRNA.

Unlike primary chromosomes, secondary chromosomes in bacteria have which quality? a. are usually linear. b. are acquired via conjugation. c. replication using plasmid-like molecular mechanisms. d. can occasionally be lost during cell division. e. consist of double-stranded RNA

c. replication using plasmid-like molecular mechanisms.

Increased synthesis of _________________ is a direct result of decreasing glucose levels.

cAMP

The amino acid tryptophan functions as a(n) _______________ in the control circuit of the trp operon.

corepressor

The retractable type IV pilus expressed by the marine bacterium Vibrio cholerae allows uptake of what material? a. conjugative plasmids b. species-specific DNA only c. membrane vesicles containing DNA d. any free double-stranded DNA e. any single-stranded DNA

d. any free double-stranded DNA

Paralogs arise within a genome by which process? a. acquisition of pseudogenes b. integration of prophages c. gain of genomic islands d. divergence of a duplicated gene

d. divergence of a duplicated gene

Compared to wild-type E. coli, a mutant with an overactive RelA would be expected to have . . . a. more ribosomes in stationary phase. b. increased levels of GTP & ATP. c. more uncharged tRNAs. d. fewer ribosomes in exponential phase. e. reduced numbers of rRNA genes.

d. fewer ribosomes in exponential phase.

Tetracycline binding is most similar to that of which of the following? a. inititation factor 2 (IF2) b. initiation factor 3 (IF3) c. EF-G-GTP d. initiation factor 1 (IF1) e. release factors (RF1/RF2)

d. initiation factor 1 (IF1)

Alternative sigma factors are important for controlling expression of . . . a. operons for biosynthetic genes that are not currently needed. b. regulons required for rapid exponential growth. c. genes that encode unique stress-specific RNA polymerases. d. regulons necessary for surviving adverse growth conditions. e. single, rarely used, catabolic genes.

d. regulons necessary for surviving adverse growth conditions.

Cholera autoinducer (CAI-1) allows the bioluminescent bacterium Vibrio harveyi to sense the presence of . . . a. unrelated bacteria. b. Vibrio cholerae (only). c. Vibrio fischeri (only). d. Vibrio harveyi (only). e. other Vibrio species.

e. other Vibrio species.

Lithotrophs oxidize ammonia present in fertilizers, releasing high levels of __________ into the environment.This substance is harmful at high levels because it can bind to hemoglobin & inhibit hemoglobin's ability to bind oxygen.

nitrate

Why is it incorrect to refer to conjugation as bacterial sex? A.The transferred DNA is not required for normal cellular function .B.The recipient is haploid for the transferred genes. C.The transferred DNA cannot replicate. D.It does not require physical contact. E.It does not involve gametes.

A.The transferred DNA is not required for normal cellular function .B.The recipient is haploid for the transferred genes. E.It does not involve gametes.

Listeria is a genus of Gram-positive Firmicutes closely related to Bacillus. There are six species, two of which are pathogenic and can cause listeriosis (L. monocytogenes and L. ivanovii) and four of which are non-pathogenic (L. innocua and others). The figure below shows a gene region alignment for the non-pathogenic species L. innocua compared to that of the pathogen L. monocytogenes.Based on this gene alignment, predict which of the following descriptions most likely apply to the genes in red. A.They were likely horizontally transferred. B.They likely encode housekeeping genes. C.They likely encode virulence factors. D.They are likely a stable part of the chromosome. E.They likely encode symbiosis genes.

A.They were likely horizontally transferred. C.They likely encode virulence factors.

Methanogenesis is performed by organisms in which domain? A.archaea B.bacteria C.eukaryotes D.all of the above.

A.archaea

What are the components common to all virions? A.capsid B.DNA and RNA genomes C.envelope D.DNA or RNA genome

A.capsid D.DNA or RNA genome

A single base-pair mutation occurs within a promoter sequence of a gene. As a result of this mutation, what are the possible effects on the transcription level of the gene? A.elimination B.change in reading frame C.reduction D.no effect E.use of a different sigma factor F.multiple sigma factor interactions G.increase

A.elimination C.reduction D.no effect G.increase

Which of the following forms of energy production does not use a proton gradient to synthesize ATP? A.fermentation B.oxidative respiration C.phototrophy D.All forms of energy production require a proton motive force.

A.fermentation

Which of the following mechanisms do prokaryotes use to generate phase variation? A.gene inversions B.transcriptional activators C.slipped-strand mispairing D.repressor-corepressor complexes E.post-translational modification

A.gene inversions C.slipped-strand mispairing

Which of the following is the most oxidized form of nitrogen? A.nitrate (NO3-) B.nitrite (NO2-) C.nitric oxide (NO) D.nitrogen gas (N2)

A.nitrate (NO3-)

A dehydrogenase is an enzyme that A.receives a pair of electrons from a particular reduced substrate. B.receives a pair of electrons from any reduced molecule. C.removes a water molecule from two monomers to form a polymer. D.transfers a phosphate group between two substrates.

A.receives a pair of electrons from a particular reduced substrate.

What is the correct order for electron transport among the three major components of electron transport chains? A.substrate oxidoreductase, quinone, terminal oxidase B.substrate oxidoreductase, terminal oxidase, quinone C.quinone, substrate oxidoreductase, terminal oxidase D.terminal oxidase, quinone, substrate oxidoreductase

A.substrate oxidoreductase, quinone, terminal oxidase

What are the basic parts of an insertion sequence? A.transposase coding region B.coding region for polymerase C.two flanking inverted repeats D.ligase gene E.random DNA of 100-200 bp F.target sequence

A.transposase coding region C.two flanking inverted repeats

It is possible to create a proton motive force without an electron transport system. A.true B.false

A.true

When dimolecular oxygen serves as the electron acceptor at the end of an electron transport chain, the product is A.water. B.NADH. C.carbon dioxide. D.a hydrogen ion.

A.water.

Which of the following conditions may lead to a switch from a lysogenic to a lytic life cycle? A. An abundance of leucine in the environment B. A dearth of glucose in the environment C. High cellular ATP levels D. A polarized bacterial cell membrane

B. A dearth of glucose in the environment

Alison Buchan and her team used transposon mutagenesis to create a large pool of mutant Phaeobacter.Three of these mutants are shown in the figure.Why did culture II not have a zone of clearance around it? A. A transposon in this culture interrupted a V. fischeri gene required for indigoidine synthesis, thereby allowing the Phaeobacter to grow close. B. A transposon in this culture interrupted a Phaeobacter gene required for indigoidine synthesis, thereby allowing the V. fischeri to grow close. C. A transposon in this culture interrupted a Phaeobacter gene required for growth in the lab. D. A transposon in this culture interrupted a V. fischeri gene required for growth in the lab.

B. A transposon in this culture interrupted a Phaeobacter gene required for indigoidine synthesis, thereby allowing the V. fischeri to grow close.

Arrange the following items in the order in which they receive electrons from glycolysis and TCA oxidations and harness the energy to establish a transmembrane proton gradient. Oxygen Quinone Oxido reductase Terminal oxidase NAD+

NAD+ => Oxidoreductase => Quinone => Terminal oxidase => Oxygen

The intracellular concentration of sodium ions in E. coli is about 10 mM. If an E. coli sample is placed into a solution with a sodium concentration of 100 mM and a sodium ionophore is added, what happens to the cells' ability to create ATP via ATP synthase? A. ATP synthesis capacity increases because the Δp becomes more negative due to a more negative Δψ. B. ATP synthesis capacity decreases because the Δp becomes less negative due to a less negative Δψ. C. ATP synthesis capacity decreases because the Δp becomes more negative due to an increased ΔpH. D. ATP synthesis capacity decreases because the Δp becomes less negative due to a decreased ΔpH.

B. ATP synthesis capacity decreases because the Δp becomes less negative due to a less negative Δψ.

Which process of DNA uptake is dependent on transferable plasmids? A. Recombination B. Conjugation C. Transformation D. Transduction

B. Conjugation

Which of the following is least likely to induce mutations? A. Chemical mutagens B. Exposure to antibiotics C. UV irradiation D. Spontaneous mutations during DNA replication

B. Exposure to antibiotics

If a mutant bacterium expressed a mutant form of NifA that could not bind to the NifA-binding site, then nitrogenase would do which of the following? A. It would be expressed constitutively. B. It would never be expressed. C. It would only be expressed in high oxygen conditions. D. It would only be expressed in low oxygen conditions.

B. It would never be expressed.

Which of the following atmospheric gases is produced from the reduction of an alternative terminal electron acceptor in microbial respiration? A. helium B. N2 C. water vapor D. CO2 E. O2

B. N2

What functional chemical group do kinases transfer to other molecules as signals of environmental change? A. Carboxyl B. Phosphoryl C. Methyl D. Sulfhydryl

B. Phosphoryl

How did Prochlorococcus now living in the upper euphotic zone acquire the ability to repair their UV-damaged DNA? A. Prochlorococcus directly acquired the photolyase enzyme by protein import from other nearby microbes. B. Prochlorococcus likely acquired the photolyase genes through horizontal gene transfer. C. Prochlorococcus themselves slowly evolved a unique ability to repair DNA over time. D. Prochlorococcus form symbiotic relationships with other microbes that can repair damaged DNA.

B. Prochlorococcus likely acquired the photolyase genes through horizontal gene transfer.

Which of the following is true of prion diseases? A. They are not transmissible. B. They lead to neurodegeneration. C. They can be treated with antiviral medications. D. They have been found to contain infectious nucleic acid.

B. They lead to neurodegeneration.

Which of the following statements regarding transcriptional attenuation is true? A. Transcriptional attenuation requires the presence of an operator sequence. B. Transcriptional attenuation allows the cell to respond rapidly to fluctuating levels of metabolites (e.g., amino acids). C. Transcriptional attenuation is important for the control of most catabolic operons. D. Transcriptional attenuation is a form of rho-dependent transcriptional termination. E. Transcriptional attenuation is used in place of, rather than in addition to, repressor control of an operon.

B. Transcriptional attenuation allows the cell to respond rapidly to fluctuating levels of metabolites (e.g., amino acids).

A protein destined for the extracellular space could be translocated there in which of the following ways? A. It is impossible to move proteins outside the cell. B. Type I secretion system. C. Use of hydrophilic sequences to move everything properly. D. Use of SRP to deliver to membrane followed by Sec system to move into periplasm.

B. Type I secretion system.

CRISPR is . . . A. used to make DNA from RNA. B. a set of short DNA sequences that allow the bacterium to "remember" past infections. C. a protein component of the capsid. D. an enzyme that cleaves DNA that is unmethylated.

B. a set of short DNA sequences that allow the bacterium to "remember" past infections.

Tropism can be defined as the . . . A. ability to infect a broad range of hosts. B. ability to infect a particular type of cell within the host. C. mechanism of entry into a host cell for bacteriophages. D. emergence of a new type of virus.

B. ability to infect a particular type of cell within the host.

An anaplerotic reaction . . . A. is a nitrogen fixation pathway. B. allows regeneration of intermediates in complex pathways. C. requires a special enzyme to be reversed. D. is a carbon fixation pathway.

B. allows regeneration of intermediates in complex pathways.

What subunits does the nitrogenase enzyme complex that fixes nitrogen consist of? A. two alpha subunits & two beta subunits B. an Fe-protein subunit & a FeMo-protein subunit C. an AccB subunit & an AccC subunit D. eight small subunits & eight large subunits

B. an Fe-protein subunit & a FeMo-protein subunit

The CRISPR system uses pieces of phage DNA incorporated into the genome . . . A. to direct restriction enzyme activity to cleave foreign DNA with homologous sequences. B. as the source of an RNA that will guide Cas proteins to cleave the foreign DNA. C. as a replicative transposon site. D. to direct specialized transduction.

B. as the source of an RNA that will guide Cas proteins to cleave the foreign DNA.

Sigma factors are responsible for . . . A. mRNA binding to promoter regions. B. binding of RNA polymerase to consensus sequences on DNA. C. helping replicate the DNA helix. D. nonselective binding of RNA polymerase to DNA.

B. binding of RNA polymerase to consensus sequences on DNA.

Various sigma factors play a role in gene expression by . . . A. using alternate nucleotides to promote different genes. B. binding to a variety of different promoter specificity sequences near the start site. C. allowing for binding of various enhancer proteins to aid initiation. D. bringing about an early termination due to hairpins in the message.

B. binding to a variety of different promoter specificity sequences near the start site.

A certain bacterial species contains carboxysomes; from this information, you can infer that the species is capable of . . . A. polyketide synthesis. B. carbon fixation. C. the reductive TCA cycle. D. nitrogen fixation.

B. carbon fixation.

Base excision repair is particularly useful for removing bases from DNA that have spontaneously . . . A. alkylated. B. deaminated. C. methylated. D. dimerized. E. phosphorylated.

B. deaminated.

The semiconservative nature of DNA replication indicates that . . . A. cells use a somewhat conservative amount of energy during DNA replication. B. each daughter cell receives one parental strand plus one newly synthesized strand. C. newly added nucleotides have been conserved from previous DNA degradation. D. the mechanism of DNA replication is mostly conserved among organisms.

B. each daughter cell receives one parental strand plus one newly synthesized strand.

Consider the data from a hypothetical Ames test below. Then match the following chemicals to the best description of their mutagenicity: mutagenic to bacteria only, mutagenic to both humans and bacteria, or not mutagenic at all

Non Mutagenic: monosodium glutamate (MSG)- Bacteria only: caffeine Humans and Bacteria: tobacco smoke, the fatty acid 4-hydroxyhexenal

Viruses are most commonly known for infectious diseases such as influenza or measles; however, not all viruses pose harm to the human host, and, in some cases, specific viruses can contribute to human survival.Which of the following is an example of the benefits conferred by endogenous viruses? A. acting as a component of the first line of immune defense educating immune cells B. encoding placental proteins that are essential for early development of human embryos C. producing enzymes necessary for human digestion D. encoding the enzyme glycoside hydrolase used to digest milk

B. encoding placental proteins that are essential for early development of human embryos

Which of the following is not a mechanism by which plasmids ensure their inheritance & maintenance during cell division? A. high-copy-number plasmids B. low-copy-number plasmids C. carrying self-preservation genes, known as addiction modules D. carrying partitioning system genes, parC, parM, and parR E. carrying antibiotic resistance genes

B. low-copy-number plasmids

Over time, the genome of a species . . . A. remains unchanged B. may change due to mutation or gene exchange. C. rapidly acquires harmful mutations. D. doubles or triples to produce polyploid genomes.

B. may change due to mutation or gene exchange.

Which of the following would be the best way to determine the effect of promoter mutations on transcription? A. use a mutated promoter in a different model organism B. measure specific mRNA expression C. use an enzyme reporter gene with mutated promoter to determine enzyme activity D. measure specific protein expression E. use a computer model to compare to other promoters

B. measure specific mRNA expression

In most bacterial species, the DNA is . . . A. positively supercoiled. B. negatively supercoiled. C. single-stranded. D. enclosed in a nuclear membrane called the nucleoid.

B. negatively supercoiled.

PPRP (5-phosphoribosyl-1-pyrophosphate) is a necessary intermediate for de novo __________ synthesis. A. amino acid B. nucleotide C. purine D. pyrimidine

B. nucleotide

A(n) __________ is composed of DNA. A. sensor kinase B. operator C. response regulator D. inducer

B. operator

Terrestrial plants cannot directly use atmospheric N2 because . . . A. oxygenic photosynthesis & nitrogen fixation are incompatible. B. plants lack the enzyme nitrogenase. C. only marine organisms can fix nitrogen. D. atmospheric nitrogen concentrations are very low.

B. plants lack the enzyme nitrogenase.

Virus phylogeny based on proteomics is . . . A. possible because viruses never swap proteins with other viruses. B. possible because viruses encode a small number of proteins. C. possible because all viruses possess a common core of proteins. D. not possible because phylogeny must be based on genomics, not proteomics.

B. possible because viruses encode a small number of proteins.

Which of the following modifications would likely cause constitutive expression of a gene that is normally regulated by an activator protein? A. deleting the operator sequence downstream of the promoter B. replacing the promoter with the consensus sequence for RpoD σ70 C. deleting the transcription terminator D. modifying the activator protein so that it cannot bind the cognate inducer E. deleting the regulatory region of DNA that binds the activator-inducer

B. replacing the promoter with the consensus sequence for RpoD σ70

Proteins destined for insertion into the bacterial cell membrane . . . A. can be inserted into the membrane without help from other proteins. B. require the activity of SRP. C. are targeted to the inner membrane by a signal sequence on their carboxyl terminus. D. are inserted posttranslationally.

B. require the activity of SRP.

Guanosine tetraphosphate (ppGpp) serves as a signal to the cell that . . . A. all tRNAs are charged with their cognate amino acid. B. ribosome synthesis should be curtailed. C. cellular ATP levels are high. D. the environment is high in lactose.

B. ribosome synthesis should be curtailed.

Which of the following transcriptional control elements covalently modifies its target? A. operators B. sensor kinases C. sigma factors D. inducers E. repressors

B. sensor kinases

The process of importing free DNA from the environment into cells is part of which process? A. transduction B. transformation C. conjugation D. transcription

B. transformation

Which mechanism of gene transfer among microbes was investigated by the team of Avery, MacLeod & McCarty? A. transduction B. transformation C. conjugation D. binary fission

B. transformation

One advantage to using sRNAs to control protein expression is that . . . A. sRNA is not specific, so many proteins can be downregulated at once. B. translation of the sRNA is not needed, thus saving amino acids. C. transcription of the sRNA is not needed, thus saving nucleotides. D. they cannot damage the DNA, being made of nucleotides as well.

B. translation of the sRNA is not needed, thus saving amino acids.

A bacterial cell that lacked the Rho protein would be . . . A. unable to carry out the elongation phase of transcription. B. unable to terminate transcription of some genes. C. unable to initiate transcription of some genes. D. resistant to several antibiotics.

B. unable to terminate transcription of some genes.

If the adjacent tryptophan codons in the trp operon leader sequence are mutated to alanine codons, what is the predicted effect on trp operon regulation? A.Attenuation may occur in response to low alanine levels. B.Attenuation may occur in response to high alanine levels. C.Attenuation will no longer occur in response to high tryptophan levels. D.Repression can no longer occur in response to low tryptophan levels. E.Repression can no longer occur in response to high tryptophan levels.

B.Attenuation may occur in response to high alanine levels. C.Attenuation will no longer occur in response to high tryptophan levels.

A particular organism converts Fe3+ to Fe2+ during anaerobic respiration. In this case, A.Fe3+ is an electron donor. B.Fe3+ is an electron acceptor. C.Fe2+ is an electron acceptor. D.none of the above

B.Fe3+ is an electron acceptor.

Some organisms can create a sodium motive force by pumping sodium ions across a membrane using the energy of an electron transport system. In order for this sodium motive force to create useful energy for the cell, the organism must contain A.an H+-driven F1F0 ATP synthase. B.an Na+-driven F1F0 ATP synthase. C.bacteriorhodopsin. D.a sodium oxidase enzyme complex.

B.an Na+-driven F1F0 ATP synthase.

Photoheterotrophic organisms A.can subsist solely on light and inorganic substrates. B.can use light to make ATP, but must still acquire reduced carbon from the environment. C.can use light to fix carbon dioxide, but must acquire reduced compounds from the environment as electron donors to power ATP synthesis. D.only existed on early Earth and are now all extinct.

B.can use light to make ATP, but must still acquire reduced carbon from the environment.

Compared to eukaryotic electron transport chains, the transport chains of E. coli A.create a proton motive force. B.have a wider diversity of alternative dehydrogenases and oxidases. C.are located in a membrane. D.generate energy that can power an ATP synthase.

B.have a wider diversity of alternative dehydrogenases and oxidases.

An organism obtains energy by the reaction of oxygen gas (O2) and hydrogen gas (H2) to produce water. This is an example of A.anaerobic respiration. B.hydrogenotrophy. C.phototrophy. D.dissimilatory water reduction.

B.hydrogenotrophy.

The purpose of electron transport systems is to conduct a stepwise release of energy from redox reactions that can be coupled to accomplish metabolic work (for example, the extrusion of protons).During electron transfer, a series of non-protein cofactors undergoes reversible reduction & oxidation with small redox energy difference to avoid substantial loss of free energy as heat.Which of the molecular features listed below facilitate the small-step energy transitions mediated by the redox centers? A. phosphoryl groups with high energy of hydrolysis (for example, ATP) B.metal ions (for example, Fe-S clusters) C.conjugated double-bond & heteroaromatic rings (for example, in FMN & NAD+) D.coenzyme A (for example, in Acetyl-CoA)

B.metal ions (for example, Fe-S clusters) C.conjugated double-bond & heteroaromatic rings (for example, in FMN & NAD+) E.heme groups

For a given electron donor, the most energy will be released when oxygen serves as the final electron acceptor because A.the concentration of oxygen gas is higher than concentrations of other possible electron acceptors. B.oxygen is a stronger oxidizing agent than most other electron acceptors. C.oxygen has a higher molecular weight than other electron acceptors. D.oxygen donates electrons more readily than other electron acceptors.

B.oxygen is a stronger oxidizing agent than most other electron acceptors.

In bacteria, a partially diploid strain may result from . . . A.acquisition of F factor. B.specialized transduction. C.natural transformation (not electroporation). D.acquisition of an F' factor. E.generalized transduction.

B.specialized transduction. D.acquisition of an F' factor.

The electrical potential in most cells is such that A.the inside of the membrane is positive relative to the outside of the membrane. B.the inside of the membrane is negative relative to the outside of the membrane. C.there is no charge separation across the membrane, and hence no voltage difference.

B.the inside of the membrane is negative relative to the outside of the membrane.

If the thylakoid ATP synthases are inhibited, one can expect that A.the pH of the thylakoid lumen will increase. B.the pH of the thylakoid lumen will decrease. C.there will be no change to the thylakoid pH. D.cellular ATP levels will increase.

B.the pH of the thylakoid lumen will decrease.

Dissimilatory reactions are so named A.because the enzymes performing these reactions are not similar to any other enzymes. B.to distinguish them from reactions that will assimilate molecules into organic biomass of the organism. C.because they occur in the bacterial genus Dissimilatum. D.because they cause the oxidation of nitrogen.

B.to distinguish them from reactions that will assimilate molecules into organic biomass of the organism.

New & emerging viruses come from . . . A. bacterial degeneration. B. multiple viruses fusing. C. "jumping" hosts. D. cancer cells.

C. "jumping" hosts.

If a segment of RNA reads 5′ GCCUUAA 3′, then the corresponding DNA template strand reads . . . A. 5′ CGGAATT 3′. B. 5′ GCCUUAA 3′. C. 5′ TTAAGGC 3′. D. 5′ GCCTTAA 3′.

C. 5′ TTAAGGC 3′.

Degradation of proteins in bacteria involves . . . A. movement of the labeled protein into a proteasome. B. ubiquitination of the protein. C. ATP-dependent endoproteases. D. GTP-dependent proteases.

C. ATP-dependent endoproteases.

DnaK, GroEL, & GroES are collectively referred to as which kind of proteins? A. Twin arginine translocase proteins B. Signal recognition particle proteins C. Chaperonins D. Ribosomal proteins

C. Chaperonins

Which of the following enzymes is the enzyme complex that catalyzes transcription in bacterial cells? A. protein-dependent RNA polymerase B. RNA-dependent RNA polymerase C. DNA-dependent RNA polymerase D. DNA-dependent DNA polymerase E. protein-dependent DNA polymerase F. RNA-dependent DNA polymerase

C. DNA-dependent RNA polymerase

All of the following statements describe the unique characteristics of eukaryotic chromosomes, except which statement? A. Eukaryotic chromosomes contain large amounts of noncoding DNA. B. Eukaryotic chromosomes are never circular. C. Eukaryotic chromosomes contain regulatory DNA sequences. D. Eukaryotic chromosomes associate with histones. E. Eukaryotic chromosomes are localized in the nucleus.

C. Eukaryotic chromosomes contain regulatory DNA sequences.

What controls the entrance to the chamber of chaperone protein GroEL? A. cycles of ATP binding & hydrolysis B. heat shock C. GroES D. clamp structure

C. GroES

Which of the following statements best describes microbiomes in nature? A. Microbiomes typically exist as single-species "pure cultures," but over 90% cannot be grown in the lab. B. Microbiomes are composed of multiple species, of which approximately 50% have been isolated in pure culture. C. Microbiomes are composed of multiple species, the vast majority of which remain uncultured. D. Microbiomes are composed of multiple species, but only those from extreme environments are difficult to culture. E. Microbiomes are composed of multiple species, over 90% of which can be cultured using selective media.

C. Microbiomes are composed of multiple species, the vast majority of which remain uncultured.

It is difficult for cells to store NH4+ because . . . A. in fact it is not difficult to store NH4+ & cells maintain large reserves of NH4+. B. at low pH, NH4+ deprotonates to NH3, which is actively pumped out of cells. C. NH4+is in equilibrium with membrane-permeable NH3. D. NH4+ can diffuse across the plasma membrane.

C. NH4+is in equilibrium with membrane-permeable NH3.

What is the correct order of events for experiments meant to produce RNA-seq data? A. RNA extraction, alignment to genome position, tabulation of number of fragments at each gene B. Removal of stable RNAs from cell, remaining RNA extraction, alignment to genome position, tabulation of number of fragments at each gene C. RNA extraction, removal of stable RNAs, fragmentation of remaining RNAs, conversion to cDNA, sequencing, alignment to genome position, tabulation of number of fragments at each gene D. RNA extraction, conversion to cDNA, alignment to genome position, tabulation of number of fragments at each gene

C. RNA extraction, removal of stable RNAs, fragmentation of remaining RNAs, conversion to cDNA, sequencing, alignment to genome position, tabulation of number of fragments at each gene

Which of the following is NOT a mechanism to prevent oxygen from entering the environment of nitrogenase? A. Separating oxygenic photosynthesis & nitrogen fixation temporally B. Protective proteins sequestering the nitrogenase C. Reduction of iron to prevent oxidation D. Using specialized cells to sequester nitrogenase

C. Reduction of iron to prevent oxidation

Why were marine viruses overlooked for so many years? A. Researchers tried to use standard molecular biology techniques that do not work well for marine viruses. B. Researchers could not sequence marine virus genomes. C. Researchers tried to isolate marine viruses using non-marine host cells. D. Researchers could not see marine viruses.

C. Researchers tried to isolate marine viruses using non-marine host cells.

What is the effect of rifamycin on bacterial transcription? A. Rifamycin binds to sigma factors to prevent initiation. B. Rifamycin inhibits translation but has no effect on transcription. C. Rifamycin binds to the beta subunit of RNA polymerase & blocks the exit channel. D. Rifamycin mimics a DNA base & intercalates between GC base pairs; it blocks transcription in all domains of life.

C. Rifamycin binds to the beta subunit of RNA polymerase & blocks the exit channel.

Which of the following DNA repair mechanisms is the most error prone? A. methyl-directed mismatch repair B. Nucleotide excision repair C. SOS repair D. Photoreactivation

C. SOS repair

Plaque assays are notoriously finicky assays & whether for a bacteriophage or for an animal virus, they require a soft agar overlay. Which of the following best explains the rationale for this approach? A. The soft agar overlay allows for detection of the burst size. B. The soft agar layer provides a tissue-like matrix mimicking an organ. C. The soft agar overlay prevents the free diffusion of progeny virions to cells. D. The soft agar overlay allows the clumping of infected cells to pull away from the culture flask.

C. The soft agar overlay prevents the free diffusion of progeny virions to cells.

How are Matthew Sullivan and his colleague able to link viruses to the hosts they infect? A. They analyze virus genome data to identify the exact host-cell receptor used. B. They analyze virion particles to identify the exact host-cell receptor used. C. They connect virus genome data with viral abundance data. D. They connect virus genome data with host-cell genome data.

C. They connect virus genome data with viral abundance data.

What is an intein? A. a self-splicing DNA B. a self-splicing RNA-protein complex C. a self-splicing protein D. a self-splicing RNA

C. a self-splicing protein

Viruses infect . . . A. only archaea. B. only eukaryotes. C. all three domains of life. D. only bacteria.

C. all three domains of life.

Culturing viruses in tissue culture . . . A. still involves the large scale use of animals. B. maintains virulence. C. allows for testing of a variety of chemical & biological agents against the virus. D. does not require any changes to the cells.

C. allows for testing of a variety of chemical & biological agents against the virus.

Most tRNAs become charged with . . . A. a codon. B. a ribosome. C. an amino acid. D. a carbohydrate.

C. an amino acid.

Which of the following organisms or structures does not conduct the Calvin cycle? A. cyanobacteria B. chloroplasts C. archaea D. lithoautotrophic bacteria E. algae

C. archaea

Polyketide molecules . . . A. cannot be made by microbes. B. are produced using the same pathways as fatty acid synthesis. C. are synthesized using modular enzymes. D. are produced using the same pathways as amino acid synthesis.

C. are synthesized using modular enzymes.

Which of the following biosynthetic pathways include(s) the intermediate 5-phosphoribosyl-1-pyrophosphate (PRPP)? A. both arginine & aromatic amino acid synthesis B. aromatic amino acid synthesis only C. both purine & pyrimidine synthesis D. purine synthesis only E. pyrimidine synthesis only F. None of the named pathways are correct. G. arginine synthesis only

C. both purine & pyrimidine synthesis

The AraC-like regulators differ from the LacI repressor in that only the AraC-like regulators . . . A. change conformation upon binding of their ligand. B. bind to specific DNA sequences. C. can activate transcription by direct interactions with RNA polymerase. D. There are no differences between the AraC-like regulators & the LacI repressor.

C. can activate transcription by direct interactions with RNA polymerase.

Your text describes circumstances that produce stem-loop structures involving regions 2 & 3 (a 2:3 stem-loop) & involving regions 3 & 4 (a 3:4 stem-loop) in the attenuator region of the trp operon.Alternatively, a 1:2 stem-loop would be expected to form only in which of the following circumstances? A. actively growing cells using a non-preferred carbon source (i.e., lactose) B. mutants in which the Trp aporepressor alone binds to the operator C. cells with decoupled transcription & translation D. cells growing in a defined medium lacking tryptophan, but with otherwise sufficient nutrients E. mutants that have non-functional operator sites

C. cells with decoupled transcription & translation

AraC is one of a large family of AraC-like proteins. All of these AraC-like proteins . . . A. are constitutively transcribed housekeeping proteins. B. contain a binding site for a sugar inducer. C. contain a high degree of homology to AraC & XylS. D. bind the same DNA consensus sequence.

C. contain a high degree of homology to AraC & XylS.

A DNA site that can be bound by a dimeric regulatory protein can be suggested where the DNA . . . A. contains a large proportion of guanine & cytosines. B. contains diauxic repeats. C. contains an inverted repeat. D. has high homology to the lacZ gene of E. coli.

C. contains an inverted repeat.

Viral genomes may comprise . . . A. double-stranded DNA. B. double-stranded RNA. C. double or single-stranded DNA or double or single-stranded RNA. D. single-stranded DNA.

C. double or single-stranded DNA or double or single-stranded RNA.

When could virions (such as T4 phage particles) be detected within an E. coli cell? A. during the initial infection when the phage particle enters the E. coli cell B. never, because we don't have microscopes powerful enough to detect phage particles C. during the end of the lytic cycle D. during lysogeny

C. during the end of the lytic cycle

Association of RecA with an incoming piece of foreign DNA is required for a cell to complete which of the following processes? A. degrade one strand of a dsDNA molecule B. metabolize the DNA as a food source C. exchange the incoming DNA with a homologous region on the chromosome D. maintain the DNA as a plasmid E. transcribe the DNA into mRNA

C. exchange the incoming DNA with a homologous region on the chromosome

All of the following types of metabolism use a membrane-associated electron transport system (ETS) EXCEPT for . . . A. phototrophy. B. lithotrophy. C. fermentation. D. mitochondrial respiration. E. organotrophy.

C. fermentation.

Another fundamental discovery provided by André Lwoff & Antoinette Gutman demonstrated that a bacteriophage could integrate itself within the bacterial genome.This was the first recognition that _______ could enter or exit a cellular genome. A. proteins B. RNA C. genes D. bacteriophages

C. genes

Initiation of DNA replication in a bacterial species . . . A. does not begin until the previous round of replication is complete. B. is a random event. C. is influenced by environmental factors. D. always occurs after a defined time period, like clockwork.

C. is influenced by environmental factors.

A _____ virus cycle leads only to cell lysis, while a _____ virus cycle involves phage genome integration into the host genome. A. temperate; lysogenic B. lysogenic; lytic C. lytic; lysogenic D. lysogenic; virulent

C. lytic; lysogenic

The International Committee on the Taxonomy of Viruses uses the following criteria to classify viruses EXCEPT . . . A. capside symmetry. B. the size of the viral particle. C. mRNA type. D. genome composition.

C. mRNA type.

Supercoiling of DNA . . . A. occurs only in prokaryotes. B. is unnecessary to fit the DNA into the cell. C. may be affected by antibiotics. D. is an energy-independent process that happens spontaneously.

C. may be affected by antibiotics.

The statement "codons are redundant" refers to the observation that . . . A. most codons are used more than once in a given mRNA molecule. B. most codons can specify more than one amino acid. C. most amino acids are specified by more than one codon. D. the same codon always appears twice in a row in an mRNA.

C. most amino acids are specified by more than one codon.

The transformed focus assay is used for ________ viruses. A. lytic B. virulent C. oncogenic D. slow-growth

C. oncogenic

The phylogenetic tree of Prochlorococcus suggests that early lineages lived deeper in the euphotic zone, below the limit of UV light penetration.What DNA repair adaptation currently allows Prochlorococcus cells to live in the upper photic zone? A. nucleotide excision B. methyl mismatch repair C. photolyases D. recombinational repair

C. photolyases

The plasmid encoded ParR & ParM proteins are involved in . . . A. bidirectional plasmid replication. B. maintaining plasmids at a high copy number. C. plasmid partitioning. D. antibiotic resistance.

C. plasmid partitioning.

Most known sRNAs are responsible for . . . A. forming part of the ribosome. B. forming complexes with the DNA to repress operons. C. regulating protein levels at the level of translation. D. being charged with amino acids & aiding protein synthesis.

C. regulating protein levels at the level of translation.

In a two-component signal transduction system, the __________ senses a change in the environment & the __________ changes gene expression. A. sensor; inhibitor B. sensor; inducer C. sensor, response regulator D. regulator, initiator

C. sensor, response regulator

The enzyme reverse transcriptase (RT) is found in . . . A. all viruses. B. some RNA viruses. C. some DNA and some RNA viruses. D. some DNA viruses.

C. some DNA and some RNA viruses.

Bacteria may donate DNA to other bacteria of the same . . . A. species only. B. species or of a different species & also some eukaryotic cells. C. species or of a different species, some eukaryotic cells & bacteriophages. D. species or of a different species.

C. species or of a different species, some eukaryotic cells & bacteriophages.

Which of the following criteria is not part of the International Committee on Taxonomy of Viruses (ICTV) classification system? A. particle size B. capsid symmetry C. spike proteins D. host range E. envelope F. genome composition

C. spike proteins

Pathogenicity islands (PAIs) are often found integrated near . . . A. mRNA genes. B. PAIs are not found integrated near rRNA, mRNA, or tRNA genes. C. tRNA genes. D. rRNA genes.

C. tRNA genes.

Choose the best definition of metagenome. A. only the complete genomes sequenced from a given microbiome B. all genes from a microbe or microbiome that have a metabolic function C. the collective genes from organisms within a given microbiome D. those genes that all members of a microbiome have in common E. any partial genome of at least one million base pairs from a given microbiome

C. the collective genes from organisms within a given microbiome

The Baltimore classification of viral genomes is based on . . . A. the shape of the viral capsid. B. the type of organism the virus infects. C. the composition of the genome. D. whether the virus is enveloped.

C. the composition of the genome.

The 30S & 50S ribosomal subunits found in bacteria are so designated to indicate . . . A. the molecular weight in kDa for each subunit. B. the years the subunits were first isolated, 1930 & 1950. C. their sedimentation rate in a centrifuge. D. the number of proteins in each subunit.

C. their sedimentation rate in a centrifuge.

When growing in cold environments, bacteria alter their membrane lipids to include increased numbers of . . . A. polyketides. B. longer-chain fatty acids. C. unsaturated fatty acids. D. saturated fatty acids.

C. unsaturated fatty acids.

Retroviruses universally use . . . A. restriction enzymes to replicate & transcribe their genome. B. viral RNA-dependent RNA polymerase to replicate their genome & to transcribe it. C. viral reverse transcriptase to make a DNA copy that is integrated into the host genome & then host RNA polymerase transcribes it. D. host DNA polymerase to replicate their genome & host RNA polymerase to transcribe it.

C. viral reverse transcriptase to make a DNA copy that is integrated into the host genome & then host RNA polymerase transcribes it.

Which of the following organisms are unable to fix nitrogen? A. soil & wetland bacteria, such as Azotobacter B. most phototrophic bacteria, such as cyanobacteria C. yeasts, such as Candida albicans D. endosymbionts of leguminous plants, such as Rhizobium

C. yeasts, such as Candida albicans

The products of oxygenic photosynthesis include A.ATP, NADP+ and water B.ATP, NADPH and quinone C.ATP, NADPH and O2 d. ATP, NADP+ and chlorophyll

C.ATP, NADPH and O2 d. ATP, NADP+ and chlorophyll

What is the relationship between the reduction potential, E, and the change in free energy, ΔG? A.If E is positive, then ΔG is also positive and the reaction is favorable. B.If E is negative, then ΔG is also negative and the reaction is unfavorable. C.If E is positive, then ΔG is negative and the reaction is favorable. D.If E is positive, then ΔG is negative and the reaction is unfavorable.

C.If E is positive, then ΔG is negative and the reaction is favorable.

The components of an ETS have what in common? A.They are all proteins. B.They all contain metal cofactors. C.They all can exist in different redox states. D.They are all located in the cytoplasm.

C.They all can exist in different redox states.

Uncoupling proteins such as DNP lower cellular ATP levels by A.preventing transport of electrons through the electron transport chain (ETC). B.rapidly hydrolyzing ATP into ADP and Pi. C.allowing protons to cross the membrane without flowing through ATP synthase. D.preventing fermentation.

C.allowing protons to cross the membrane without flowing through ATP synthase.

Generation of ATP in the cytoplasm via ATP synthase in the membrane requires A.an outward chemical gradient for protons. B.a potential gradient across the membrane; the inside more positive. C.an electrical or chemical gradient favoring proton entry into the cell. D.that oxygen be available to serve as a final electron acceptor.

C.an electrical or chemical gradient favoring proton entry into the cell.

For the methyl-directed mismatch repair system to work correctly, newly replicated DNA must . . . A.contain methyl groups at nontarget sequences. B.remain methylated until checked by the Mut proteins. C.become methylated before the subsequent round of replication. D.remain unmethylated long enough for mismatches to be repaired.

C.become methylated before the subsequent round of replication. D.remain unmethylated long enough for mismatches to be repaired.

Cyanobacteria contain A.photosystem I only. B.photosystem II only. C.both photosystems I and II. D.neither photosystem I nor photosystem II.

C.both photosystems I and II.

Which of the following would be appropriate for a metagenomics study? A.human brain B.filter-sterilized solution C.dental plaque D.pure culture of E. coli E.hydrothermal vent

C.dental plaque E.hydrothermal vent

Identify the function(s) of the viral capsid. A.is necessary for RNA virus attachment B.contains virulence factors that increase the severity of viral disease C.determines the shape of the virion D.protects the viral genome

C.determines the shape of the virion D.protects the viral genome

Metabolism using an electron transport system is classified based on the nature of the initial electron donors and terminal electron acceptors. Lithotrophy uses A.organic molecules as the initial electron donors. B.organic molecules as the final electron acceptors. C.inorganic molecules as the initial electron donors. D.inorganic molecules as the final electron acceptors.

C.inorganic molecules as the initial electron donors.

Chlorophylls in the antenna complex differ from chlorophylls in the reaction center in that A.only reaction-center chlorophylls absorb photons. B.only reaction-center chlorophylls are localized to membranes. C.only reaction-center chlorophylls donate electrons to electron transport systems. D.There is no difference between chlorophylls in the antenna complex or the reaction center.

C.only reaction-center chlorophylls donate electrons to electron transport systems.

Which of the following organisms are capable of lithotrophy? A.plants B.animals C.prokaryotes D.fungi

C.prokaryotes

The proton motive force is a source of energy that can directly power all of the following except A.the production of ATP. B.the rotation of bacterial flagella. C.the synthesis of proteins from amino acids. D.the import of other ions against their concentration gradients.

C.the synthesis of proteins from amino acids.

Which viral genome is likely to require an RNA-dependent RNA polymerase for transciption upon viral entry? A. double-stranded DNA B. (+) sense single-stranded RNA C. single-stranded DNA D. (-) sense single-stranded RNA

D. (-) sense single-stranded RNA

Amino-acyl-tRNA synthetases charge tRNAs with their respective amino acids.About ________ amino-acyl-tRNA synthetases are found in most microbial cells. A. 100 B. 5 C. 2 D. 20

D. 20

What is the correct temporal sequence for factors binding to an mRNA in bacterial translation initiation? A. 50S subunit, 30S subunit, N-formylmethionine-tRNA B. N-formylmethionine-tRNA, 30S ribosomal subunit, 50S subunit C. N-formylmethionine, 50S subunit, 30S subunit D. 30S ribosomal subunit, N-formylmethionine-tRNA, 50S subunit

D. 30S ribosomal subunit, N-formylmethionine-tRNA, 50S subunit

Analysis of the genome of a newly discovered bacterial strain reveals that it is composed of a double-stranded DNA molecule containing 16% thymine. Based on this information, what would you predict the percentage of cytosine to be? A. 16% B. 68% C. 32% D. 34%

D. 34%

During bacterial DNA replication, each new nucleotide adds to the hydroxyl group of the . . . A. 5′-C of the sugar. B. 5′-C of the nitrogenous base. C. 2′-C of the sugar. D. 3′-C of the sugar.

D. 3′-C of the sugar.

Cell culture methods provide a useful approach to study animal virus growth in a closed system.This approach is not without some limitations.Which of the following represents an obstacle for the propagation of animal virus strains in cell culture over time? A. The number of animal viruses in a sample cannot be quantified effectively in cell culture. B. Animal viruses will immediately lyse the cells in culture due to the absence of an immune response. C. The multiplicity of infection in tissue culture will not be physiologically similar to whole animal models. D. Animal virus strains can evolve to grow well in tissue culture & no longer be virulent during animal research.

D. Animal virus strains can evolve to grow well in tissue culture & no longer be virulent during animal research.

Gut bacteriophages, or "coliphages," are members of a microbial community that modulates human digestion, the immunesystem & mental health. Historically, bacteriophages have provided some of the most fundamental insights in molecular biology. In 1952, Alfred Hershey and Martha Chase demonstrated that the transmission of DNA by a bacteriophage to a host cell led to the production of progeny bacteriophages.The discovery by Hershey and Chase confirmed that . . . A. bacteriophages do not need host cells to reproduce. B. bacteriophages are specific to their host cells. C. phages can be produced from DNA. D. DNA is the hereditary material of life.

D. DNA is the hereditary material of life.

Reverse transcriptase catalyzes _____ production from a _____ template. A. RNA; protein B. Protein; RNA C. RNA; DNA D. DNA; RNA

D. DNA; RNA

Which of the following molecules do NOT include any nitrogen? A. Purines B. Pyrimidines C. Tryptophan D. Fatty acids

D. Fatty acids

Which of the following enzymes catalyzes a reaction to produce glutamine? A. Glutamate synthetase B. Glutamate dehydrogenase C. Glutamate synthase D. Glutamine synthetase

D. Glutamine synthetase

Which statement about DNA versus RNA is true? A. Only RNA has hydrogen bonding between base pairs. B. Only DNA contains phosphodiester bonds between the 3′-carbon of one sugar & the 5′-carbon of the next sugar. C. Only DNA contains purines. D. Only RNA contains a hydroxyl group on the 2′-carbon of the sugar. E. Only DNA contains a hydroxyl group on the 2′-carbon of the sugar.

D. Only RNA contains a hydroxyl group on the 2′-carbon of the sugar.

It is essential that both sister chromosomes physically avoid the site of septum formation at the midline of the cell during bacterial cell division in order to prevent septal "guillotining" of chromosomes.Which of the following is not directly involved in the mechanism to prevent septal guillotining of chromosomes? A. FtsZ B. SBS sequences C. SlmA D. ParC

D. ParC

How do Phaeobacter compete for limited resources in the coastal salt marshes? A. Phaeobacter secrete the compound penicillin that kills other bacteria. B. Phaeobacter degrade plant material, making it unavailable to other microbes. C. Phaeobacter can grow more quickly than other bacteria. D. Phaeobacter secrete the compound indigoidine that kills other bacteria.

D. Phaeobacter secrete the compound indigoidine that kills other bacteria.

CRISPR-Cas9 may be used as a gene-editing tool to repair mutant genes (such as the gene that causes Huntington's disease in humans). This technique has been used in bacteria, mice, and even human embryos. First, CRISPR-Cas9 is used to target and remove the mutant gene. Second, naturally occurring repair enzymes will add the wild-type gene into the gap left from the site where the mutant gene was removed. Which of these bacterial repair mechanisms would most likely be responsible for repairing the DNA when used to edit bacterial genes? A. nucleotide excision B. base excision C. methyl mismatch repair D. RecA recombination repair E. UmuDC translesion bypass synthesis in SOS

D. RecA recombination repair

Viruses express tissue tropism & host specificity. In particular, the avian influenza strain H5N1 has rare incidences in humans due to the reduced distribution of alpha-2,3 sialic acids in the lower respiratory tract. As a consequence, when the H5N1 strain does infect a human, the disease is very severe due to the risk of pneumonia. In contrast, human influenza strains (H1N1, among others) attach to alpha-2,6 sialic acids, which are readily expressed in the upper & lower respiratory tract. Which of the following would not be true if a mutation were to allow the H5N1 strain to attach to alpha-2,6 sialic acids? A. The avian influenza strain could be transmitted directly from birds to humans. B. The avian influenza strain could be transmitted easily from human to human. C. An epidemic would likely ensue due to the lack of immunity to the new avian influenza strain. D. The avian influenza strain would only infect the lower respiratory tract of humans.

D. The avian influenza strain would only infect the lower respiratory tract of humans.

Rubisco catalyzes the reaction that fixes a carbon dioxide molecule onto a ribulose 1,5-bisphosophate backbone, which immediately splits into two 3-carbon intermediates. As the cycle progresses, another 3-carbon product is formed, G3P. Only one out of six G3Ps will be used to make glucose or other biosynthetic products. Why is only one out of six G3Ps available for other processes? A. The G3P immediately splits into carbon dioxide and a 2-carbon product. B. The G3P serves as a catabolic substrate. C. Making glucose takes all six G3P. D. The ribulose 1,5-bisphosphate must be regenerated.

D. The ribulose 1,5-bisphosphate must be regenerated.

Why is the viral shunt so important in marine ecosystems? A. The viral shunt kills corals & thus leads to coral bleaching. B. The viral shunt generates dissolved organic & inorganic nutrients, which sink to the ocean bottom where they cannot be used by other organisms. C. The viral shunt is the process in which viruses kill large quantities of bacteria & eukaryotic plankton, which allows larger organisms to grow without infection. D. The viral shunt generates dissolved organic & inorganic nutrients that can be used by other organisms.

D. The viral shunt generates dissolved organic & inorganic nutrients that can be used by other organisms.

What key feature of marine viruses drives biodiversity in the oceans? A. Viruses are a good nutrient source for many other organisms. B. Virus host ranges are limited to pathogenic microbes that might otherwise lead to mass death of larger organisms. C. Viruses have very broad host ranges. D. Viruses have very limited host ranges.

D. Viruses have very limited host ranges.

One possible indicator of some earlier horizontal gene transfer event is . . . A. gene duplication. B. pathogenicity via gene loss. C. uniform codon usage throughout the genome. D. a GC base ratio different from flanking chromosomal DNA.

D. a GC base ratio different from flanking chromosomal DNA.

The protein product of the lacI gene is . . . A. sensor kinase. B. a corepressor. C. an activator. D. a regulatory protein.

D. a regulatory protein.

An inducer increases the level of gene expression by binding . . . A. directly to a consensus sequence on DNA. B. an activator protein to remove it from the DNA. C. a corepressor protein. D. a repressor protein to remove it from the DNA.

D. a repressor protein to remove it from the DNA.

V. cholerae is naturally capable of transformation, which means it can do what? A. transfer DNA through nanotubes to related bacteria B. acquire DNA through transduction by bacteriophages C. acquire DNA through conjugation by F-factor plasmids D. acquire naked DNA from their surroundings

D. acquire naked DNA from their surroundings

During Salmonella enterica phase variation, there is a . . . A. posttranslational change in an organism's proteins. B. posttranscription change increasing the number of RNases produced. C. posttranscriptional remodeling of an organism's RNA. D. alteration of an organism's DNA.

D. alteration of an organism's DNA.

Compared with cellular genomes, viral genomes . . . A. are larger, with more base pairs. B. are approximately the same size as the genome of the organisms they infect. C. also must have double-stranded DNA as their genome. D. are smaller, with fewer base pairs.

D. are smaller, with fewer base pairs.

De novo pyrimidine biosynthesis starts with . . . A. glutamate. B. ribose. C. arginine. D. aspartate.

D. aspartate.

A paralog is a __________ gene in __________ species, while an ortholog is a duplicated gene in a __________ species. A. duplicated; two; one B. mutated; one; two C. mutated; one; one D. duplicated; one; two

D. duplicated; one; two

During base excision repair, a specific glycosylase catalyses . . . A. a single-stranded nick in the DNA. B. chemical reversal of damage. C. a double-stranded break in the DNA. D. formation of an AP site. E. insertion of a replacement base.

D. formation of an AP site.

The early stages of genome reduction in bacteria are normally characterized by the proliferation of pseudogenes.These most likely arise as a result of . . . A. transforming DNA. B. conjugative plasmids. C. transduced DNA. D. frameshift & nonsense mutations. E. transposons.

D. frameshift & nonsense mutations.

Which of the following pairs make up a classic two-component signal transduction system? A. repressor & corepressor B. CRP & cAMP C. RNA polymerase & sigma factor D. histidine kinase & response regulator E. riboswitch & ligand

D. histidine kinase & response regulator

Many Japanese people consume a diet rich in seaweed, including the edible red alga Porphyra, which is used for preparing sushi. Although humans cannot digest the seaweed polysaccharides (porphyran & agarose), certain marine Bacteroidetes do possess the necessary CAZymes. Curiously, Japanese individuals frequently harbor seaweed-digesting Bacteroides plebeius in their gut microbiomes, while individuals from North America typically do not. Bacteroides plebeius is not a marine bacterium & its close relatives cannot digest seaweed. What is the mostly likely explanation for how B. plebeius acquired functional porphyranase & agarase genes? A. point mutations that eventually produced functional genes B. endosymbiosis with a seaweed-digesting archaeon C. random DNA inversions D. horizontal transfer of genes from a marine bacterium E. transfer of genes from the gut epithelial cells

D. horizontal transfer of genes from a marine bacterium

If the deoxyadenosine methylase (dam) enzyme is inhibited in E. coli, then the next generation time will . . . A. not be affected. B. decrease due to more persistent SeqA binding. C. increase due to hypermethylation. D. increase due to more persistent SeqA binding.

D. increase due to more persistent SeqA binding.

Which of the following bind regulatory proteins involved in transcriptional control? A. direct repeats B. hairpin loops C. Shine-Dalgarno D. inverted repeats E. riboswitches

D. inverted repeats

Genes can be lost during genomic evolution through . . . A. duplication & divergence. B. transposons leaving & taking the genes with them. C. mutation. D. lack of repair to the gene when it is no longer needed.

D. lack of repair to the gene when it is no longer needed.

Compared with cells that are surrounded by a lipid membrane, viruses . . . A. are never surrounded by a lipid membrane. B. may be surrounded by a membrane synthesized by viral proteins. C. are also always surrounded by a lipid membrane. D. may be surrounded by a membrane derived from the host cell.

D. may be surrounded by a membrane derived from the host cell.

Amino acid synthesis differs from fatty acid synthesis in that . . . A. only fatty acid synthesis requires reducing agents. B. only amino acid synthesis is an anabolic process. C. amino acid synthesis occurs only in autotrophs, whereas fatty acid synthesis occurs in both autotrophs & heterotrophs D. only fatty acid synthesis occurs via a cyclic process.

D. only fatty acid synthesis occurs via a cyclic process.

Nitrogen fixation is ecologically important because . . . A. diatomic nitrogen is toxic. B. it releases oxygen. C. nitrogen is directly necessary for carbohydrate catabolism. D. proteins & nucleic acids both require nitrogen as part of their structure.

D. proteins & nucleic acids both require nitrogen as part of their structure.

Viroids lack . . . A. nucleic acids. B. infectivity. C. catalytic activity. D. proteins.

D. proteins.

Anaplerotic reactions do which of the following? A. result in photorespiration B. produce CO2 C. break down glucose to produce energy D. regenerate TCA intermediates

D. regenerate TCA intermediates

Consider the complex transposon in the illustration above. Suppose you discover a derivative of this element that replicatively inserts into target DNA but then becomes "stuck" as part of a cointegrate. Your graduate student sequences the respective gene products & finds no change in the primary amino acid sequences of the encoded enzymes. In which locus must the defect lie? A. tnpR B. bla C. in one (or both) of the inverted repeats D. res E. tnpA

D. res

While horizontal gene transfer can be beneficial to microbes, DNA uptake also involves risks.Bacteria protect themselves from foreign DNA through . . . A. DNA repair mechanisms protecting the genome. B. transposable elements disrupting any transferred DNA. C. recombination. D. restriction endonucleases that cleave unmethylated DNA at specific sites.

D. restriction endonucleases that cleave unmethylated DNA at specific sites.

RNA comes in many forms in the cell & the structure & longevity of an RNA molecule is determined in part by its function.Which of the following RNA classes has the longest half-life? A. tmRNA—frees "stuck" ribosomes B. mRNA—used to encode a protein during translation C. Catalytic RNA—enzymatic function D. tRNA—shuttles amino acids during translation

D. tRNA—shuttles amino acids during translation

Fatty acid synthesis can be regulated by . . . A. CO2 activating the expression of the pathway genes. B. acetyl Co-A activating its own gene's expression. C. acetyl Co-A carboxylase activating its own gene's expression. D. the stringent response blocking the pathway genes' expression during starvation.

D. the stringent response blocking the pathway genes' expression during starvation.

What two conditions must be met to produce a heritable mutation? A.The change must result in a change in cellular phenotype. B.The change must occur within a particular gene. C.Some form of horizontal gene transfer is involved. D.There is a change in the DNA sequence. E.The mutation does not get repaired before the cell divides.

D.There is a change in the DNA sequence. E.The mutation does not get repaired before the cell divides.

Which of the following is true of the F1F0 ATP synthase? A.It is found in the bacterial cell membrane, the inner membrane of mitochondria, and the thylakoid membrane of chloroplasts. B.The movement of protons through the synthase causes the physical rotation of parts of the protein. C.Under conditions of high ATP and low proton motive force, the synthase can run "backward," hydrolyzing ATP to pump protons across a membrane. D.all of the above

D.all of the above

ATP production in halophilic archaea that contain bacteriorhodopsin differs from ATP production in cyanobacteria in that A.only cyanobacteria use light to excite electrons. B.only cyanobacteria create a proton motive force. C.only cyanobacteria are found in water. D.only cyanobacteria oxidize water.

D.only cyanobacteria oxidize water.

An organism contains photosystem II but not photosystem I. From this you can conclude that A.the organism uses water as an electron donor, liberating oxygen gas. B.the organism can produce both NADPH and ATP from light energy. C.the organism can produce NADPH from light energy, but not ATP. D.the organism can produce ATP from light energy, but not NADPH.

D.the organism can produce ATP from light energy, but not NADPH.

Carboxysomes are structures found in some cyanobacteria & chloroplasts.Carboxysomes consist of a protein shell that contains the enzyme Rubisco.The purpose of the carboxysome is to trap . . . A. glucose so that it does not damage other parts of the cell. B. PGA so that it is converted to G3P more rapidly. C. Rubisco so that it does not catalyze carboxylation. D. O2 so that it reaches concentrations necessary to activate Rubisco. E. CO2 so that it reaches concentrations necessary to drive Rubisco.

E. CO2 so that it reaches concentrations necessary to drive Rubisco.

Methyl-directed mismatch repair of DNA is the primary mechanism for correcting mismatched base pairs caused by . . . A. reactive oxygen species. B. RecA. C. RNA polymerase. D. UV irradiation. E. DNA polymerase.

E. DNA polymerase.

Which of the following is a major advantage of single-cell genomics (SCG) over metagenomic shotgun sequencing? A. SCG allows researchers to verify predicted gene functions. B. Unlike shotgun-sequencing, SCG does not require isolation of cells in culture. C. SCG can better identify the core functions of a community. D. SCG is more useful for surveys of microbial diversity within a microbiome. E. SCG requires less sample DNA.

E. SCG requires less sample DNA.

Select the true statement (below) regarding the relationship between genotype & phenotype. A. Only genes that produce proteins are considered part of an organism's genotype. B. The phenotype represents the entire genome of an organism. C. Any change in the genotype will be reflected in the phenotype. D. Some mutations will cause a change in the genotype, while others will not. E. The phenotype reflects only the portion of the genotype that is expressed.

E. The phenotype reflects only the portion of the genotype that is expressed.

Imagine you are investigating a mutant strain of EHEC that is no longer attracted to norepinephrine but still exhibits positive chemotaxis to nutrients such as aspartate, maltose & galactose. These results would be consistent with which of the following? A. a defect that decreases CheA activity in response to an attractant B. inability of CheY-P to interact with the flagellar motor C. underexpression of the demethylase (CheB) D. overexpression of the phosphatase (CheZ) E. a defect in one of the methyl-accepting chemotaxis proteins (MCPs)

E. a defect in one of the methyl-accepting chemotaxis proteins (MCPs)

Which of the following describes a change in an organism's genotype, rather than its phenotype? A. increased generation time of Salmonella at 4°C vs. 37°C B. loss of polar flagella by Vibrio cholerae during colonization of its host C. initiation of endospore formation by Bacillus subtilis during nutrient limitation D. lack of red pigmentation by Serratia marcescens colonies on nutrient agar E. acquisition by Corynebacterium of a prophage that encodes diphtheria toxin

E. acquisition by Corynebacterium of a prophage that encodes diphtheria toxin

Compared to bacteria, mitochondria are able to generate a greater Δp from their ETS because they possess which of the following? A. succinate deydrogenase B. an NADH oxidoreductase C. a quinone pool D. a terminal cytochrome oxidase E. an additional proton-pumping oxidoreductase

E. an additional proton-pumping oxidoreductase

Which of the following chemical pairs provides a metabolic strategy that is an example of both lithotrophy and anaerobic respiration? A. electron donor NH3; electron acceptor O2 B. electron donor glucose; electron acceptor O2 C. electron donor glucose; electron acceptor Fe3+ D. electron donor Fe2+; electron acceptor O2 E. electron donor H2; electron acceptor SO42-

E. electron donor H2; electron acceptor SO42-

Transposases are multifunctional enzymes.During nonreplicative transposition, the transposase does all of the following pocesses except . . . A. bind to donor DNA and bring the ends of the insertion element together. B. mediate attack of 3' OH ends of insertion element into new target DNA. C. nick donor DNA to produce free 3' OH on either side of insertion sequence. D. excise insertion element creating double-stranded break in donor strand. E. fill in single-stranded gaps that occur in the target region of the recipient DNA.

E. fill in single-stranded gaps that occur in the target region of the recipient DNA.

What type of mutation is most likely to occur as a result of nonhomologous end joining repair? A. single base-pair mismatches B. pyrimidine dimers C. transpositions D. large-scale inversions E. frameshift mutations

E. frameshift mutations

Cells are not able to store NH4+ since NH4+ spontaneously deprotonates to NH3, which diffuses across the cell membrane & is then lost.As a result, cells immediately assimilate NH4+ into organic molecules by deploying which of the following reactions? A. None of the listed reactions assimilate NH4+. B. Rubisco C. nitrogenase D. enoyl-ACP reductase E. glutamate synthetase

E. glutamate synthetase

The ATP synthase can be thought of as a type of molecular motor that is powered by the flow of ____________ through the subunits & __________ their concentration gradient.

H+ / down

Sort the following microbial processes to identify which will likely be impacted when a patient is treated with rifampicin and which will not. transcription translation lysogeny replication transduction

Impacted by rifamyacin: transcription translation replication NOT impacted by rifamyacin: lysogeny transduction

Match each genome with the first polymerase it uses to initiate viral synthesis. OPTIONS: Double-stranded DNA (+) sense single-stranded RNA Double-stranded RNA (+) strand RNA retroviruses Singe-stranded DNA (-) sense single-stranded RNA Double-stranded DNA pararetroviruses CATEGORIES: DNA Polymerase Host RNA Polymerase vRNA Polymerase Reverse Transcriptase

#1) DNA Polymerase: Double-stranded DNA Single-stranded DNA #2) Host RNA Polymerase: (+) sense single-stranded RNA #3) vRNA Polymerase: Double-Stranded RNA (-) sense single-stranded RNA #4) Reverse Transcriptase: (+) strand RNA retroviruses Double-stranded DNA pararetroviruses

You have a strain of ampicillin-resistant Escherichia coli and a strain of ampicillin-sensitive Enterobacter. You mix the strains together and leave them overnight. In the morning, you discover that the Enterobacter is now resistant to ampicillin as well. Now you must decide what experiments you could do to determine the mechanism of genetic exchange (transformation, conjugation, or transduction). Assume there was no experimental error overnight (i.e., no contamination), and keep in mind that only small particles (like DNA and viruses) will remain suspended in cell-free extract.Consider the descriptions of genetic exchange methods below and match each description to the proper type of exchange.

- Transformation: This method would be affected by DNase, an enzyme that can degrade naked DNA that is unprotected. - Conjugation: This method of DNA exchange cannot occur using the recipient cells mixed with cell-free extract only. - Transduction: This method can occur with cell-free extract only and is not affected by DNase.

Correctly order the following steps in bacterial conjugation from start to finish.

1. a sex pilus is formed that joins an F+ to an F- cell. 2. the sex pilus retracts, and a relaxosome forms 3. the F factor is nicked at oriT, and one strand starts to transfer into the recipient. 4. DNA polymerase III synthesizes a replacement strand in the donor 5. the transferred DNA strand circularizes and completes replication

How many ribulose 1,5-bisphosphate molecules could be regenerated by 18 turns of the Calvin cycle?

18

What is the minimum number of NADH molecules that must be oxidized for oxygen to be reduced to water?

2

How many 6-carbon glucose molecules could be produced by 18 turns of the Calvin cycle?

3

Without base excision repair, the presence of unnatural bases may cause mutations or more serious effects.For example, the presence of __________ interferes with DNA synthesis & thus is lethal to the cell.

3-methyladenine

How many glyceraldehyde 3-phosphate (G3P) molecules could be produced by 18 turns of the Calvin cycle?

36

Which viruses may enter cells via receptor-mediated endocytosis? A. Animal viruses B. Plant viruses C. Bacterial viruses D. Animal, bacterial, and plant viruses

A. Animal viruses

Which inorganic compound does the Calvin cycle incorporate into an organic molecule? A. Carbon dioxide B. Calcium sulfate C. Sodium phosphate D. Potassium nitrate

A. Carbon dioxide

Which enzyme helps pack DNA into the cell by negatively supercoiling DNA? A. DNA gyrase B. Topoisomerase I C. DNA polymerase III (Pol III) D. DNA helicase E. DNA ligase

A. DNA gyrase

Which of the following enzymes or proteins is used in methyl-directed mismatch repair, nucleotide excision repair & base excision repair? A. DNA polymerase I B. UvrA C. Photolyase D. MutS E. AP endonuclease

A. DNA polymerase I

Which of the following antibiotics contains a large lactone ring & binds to the L15 protein & 23S RNA at the peptidyltransferase cavity to prevent peptide bond formation? A. Erythromycin B. Tetracycline C. Actinomycin D. Streptomycin

A. Erythromycin

Which of the following processes is not a carbon fixation pathway? A. Fatty acid synthesis B. Reductive acetyl Co-A pathway C. Reverse TCA cycle D. 3-hydroxypropionate pathway

A. Fatty acid synthesis

The energy used directly for the elongation step of translation comes from . . . A. GTP hydrolysis. B. ATP hydrolysis. C. peptide bond formation. D. nucleotide condensation.

A. GTP hydrolysis.

After cytosine has been deaminated to become uracil, which enzyme will cleave uracil from the DNA backbone in the first step of a repair process? A. Glycosylase B. MutH C. AP endonuclease D. RecA

A. Glycosylase

What is the correct ordering of the phases of growth in a virus? A. Infection, eclipse, latent, rise B. Rise, eclipse, latent, infection C. Infection, eclipse, rise, latent D. Infection, latent, rise, eclipse

A. Infection, eclipse, latent, rise

Which of the following is an enzyme activity found in the fatty acid synthase (FAS) complex? A. Ketoacyl-ACP reductase B. ppGpp synrthetase C. Polyketide synthase D. Malonyl-ACP reductase

A. Ketoacyl-ACP reductase

As an ambitious young scientist, you decide to create mutant bacteriophages to better examine structural function. Your first mutant lacks a sheath motor protein, so you decide to call this MutShth. To determine the loss of function, you add MutShth at a multiplicity of infection (MOI) of 1 to Escherichia coli cells & examine the rate of infection. You're very surprised to find that none of the Escherichia coli cells are infected. What happened? A. MutShth prevented the sheath protein from contracting. B. MutShth damaged the bacteriophage tail fibers. C. You failed to add enough bacteriophages to infect the E. coli. D. MutShth created ghost bacteriophages.

A. MutShth prevented the sheath protein from contracting.

Which statement concerning the genomes of organisms is true? A. Organisms differ in their genome size. B. All organisms have roughly the same DNA content per cell. C. Archaeal genomes are larger than bacterial genomes. D. Organisms differ in DNA content but contain roughly the same number of genes.

A. Organisms differ in their genome size.

Which viruses enter cells via mechanical transmission, a nonspecific access through physical damage? A. Plant viruses B. Animal viruses C. Phages D. Bacterial viruses

A. Plant viruses

The enzyme DNA primase is a(n) . . . A. RNA polymerase. B. ligase. C. exonuclease. D. DNA polymerase.

A. RNA polymerase.

What are the advantages of using BMFC to power ocean-monitoring devices? A. The devices need a source of energy that is continuous & will last for many years. B. The devices need a source of energy that is intermittent but will last for many years. C. The devices need a source of energy that is intermittent & short lived. D. The devices need a source of energy that is continuous but short lived.

A. The devices need a source of energy that is continuous & will last for many years.

How would removing the operator region from the E. coli tryptophan operon affect transcription of the trp enzyme genes? A. Transcription of the operon would occur even if tryptophan were abundant. B. Transcription of the operon would begin normally but terminate prematurely. C. Transcription of the operon would be greater than normal in absence of tryptophan. D. Transcription of the aporepressor gene would decrease. E. Transcription of the operon could not occur, and the cells would require tryptophan in the growth media.

A. Transcription of the operon would occur even if tryptophan were abundant.

Which process of DNA transfer is dependent on viruses? A. Transduction B. Recombination C. Transformation D. Conjugation

A. Transduction

Which of the following is an example of horizontal gene transmission? A. Transformation B. PCR C. Mitosis D. Cell division

A. Transformation

Every active insertion sequence contains a gene for which type of enzyme? A. Transposase B. Kanamycin resistance C. RecA D. Ligase

A. Transposase

Nitrogen occurs in many forms once it has been fixed.Which of the following is NOT generally usable by microbes as a metabolic substrate? A. Trinitrotoluene B. Ammonium ion C. Nitrate D. Nitrite

A. Trinitrotoluene

A mutation always results in . . . A. a change in genotype. B. beneficial effects to the organism. C. a change in phenotype. D. harmful effects to the organism.

A. a change in genotype.

In a mutant E. coli strain, a protein that normally resides in the inner membrane is mis-localized to the cytoplasm.All other proteins show normal localization. The most probable defect in this mutant strain is that the . . . A. amino terminal signal sequence is missing. B. signal recognition particle is missing. C. sigma factor that helps transcribe this protein is missing. D. ribosomes in this cell are defective.

A. amino terminal signal sequence is missing.

The acyl-homoserine lactone produced by luxI of Allivibrio fischeri is an example of a(n) . . . A. autoinducer. B. inducer. C. bioluminescent molecule. D. repressor.

A. autoinducer.

Which of the following are extrachromosomal DNA molecules that commonly interact with bacterial genomes? A.bacteriophage genomes B.mitochondrial genomes C.horizontally transferred bacterial plasmids D.eukaryote-specific plasmids, such as 2µ in Saccharomyces cerevisiae

A. bacteriophage genomes C. horizontally transferred bacteria plasmids

Anti-anti-sigma factors . . . A. bind anti-sigma factors, releasing sigma factors to activate transcription. B. are only found in eukaryotic microbes. C. are housekeeping genes & are constitutively expressed. D. bind & block sigma factors twice as well as anti-sigma factors.

A. bind anti-sigma factors, releasing sigma factors to activate transcription.

A temperate phage is one that . . . A. can undergo lysogeny. B. is restricted to infecting a single species. C. is incapable of lysing the host cell. D. grows best at moderate temperatures.

A. can undergo lysogeny.

A gene for a __________ is likely to be encoded in the viral genome. A. capsid protein B. ribosomal protein C. restriction endonuclease D. ribosomal RNA

A. capsid protein

Nitrogenase . . . A. consumes many ATP molecules & reduced electron carriers to reduce N2 to 2NH4+. B. works well in any environment. C. requires oxygen as an electron acceptor. D. is a relatively small enzyme.

A. consumes many ATP molecules & reduced electron carriers to reduce N2 to 2NH4+.

Which enzyme is responsible for generating cis carbon-carbon double bonds in unsaturated fatty acids? A. dehydratase B. ATP citrate lyase C. acetyl-CoA carboxylase D. enoyl-ACP reductase

A. dehydratase

The final three-dimensional shape of a protein is . . . A. determined by the gene encoding that protein. B. not influenced by posttranslational modifications. C. not dependent of the linear sequence of amino acids. D. not important for the function of the protein.

A. determined by the gene encoding that protein.

Bacteria, archaea & eukaryotes all . . . A. have double-stranded DNA genomes. B. have protein-coding portions of genes interrupted by introns. C. contain circular DNA. D. have DNA condensed by histones.

A. have double-stranded DNA genomes.

Carbon dioxide levels control the activity of the Calvin cycle by . . . A. inducing expression of CO2 transporters when CO2 levels are low. B. inducing expression of CO2 transporters when CO2 levels are high. C. inducing expression of Rubisco. D. repressing expression of Rubisco.

A. inducing expression of CO2 transporters when CO2 levels are low.

Riboswitches are regions of some RNA molecules that can . . . A. inhibit translation by preventing access to the ribosomal binding site. B. act as enzymes. C. repress operator regions of the DNA. D. inhibit post-translation protein modifications.

A. inhibit translation by preventing access to the ribosomal binding site.

In the original Ames test for mutagenesis, a mutagen is tested to see if it can induce colonies on growth medium that ______ histidine, starting with a _____ strain of bacteria. A. lacks; hisG mutant B. includes; wild-type C. includes; hisG mutant D. lacks; wild-type

A. lacks; hisG mutant

The role of the DnaC protein in bacterial DNA replication is to . . . A. load helicase. B. recognize the oriC sequence & initiate replication. C. create an RNA primer. D. create phosphodiester bonds.

A. load helicase.

Nitrogen fixation genes are activated when the cell senses that there are . . . A. low levels of ammonia. B. high levels of nitrogen gas. C. nitrogen fixation genes that are constitutively active. D. high levels of ammonia.

A. low levels of ammonia.

Transposable elements differ from plasmids in that only plasmids . . . A. may exist autonomously, not integrated into host DNA. B. may be transmitted horizontally from one bacterium into another. C. consist of double-stranded DNA. D. may code for antibiotic resistance.

A. may exist autonomously, not integrated into host DNA.

Based on gel electrophoresis & antibody detection, a nonfunctional protein is found to have a significantly smaller molecular weight than its wild-type counterpart. The most likely explanation for this observation is a . . . A. nonsense mutation in the DNA encoding the protein. B. missense mutation in the DNA encoding the protein. C. silent mutation in the DNA encoding the protein. D. duplication of the region of the DNA encoding the protein.

A. nonsense mutation in the DNA encoding the protein.

The stringent response . . . A. occurs in response to low energy stores. B. ensures that the cell has a large number of ribosomes for translation. C. occurs in response to sugars other than glucose & ensures that the cell only transcribes catabolic operons when the appropriate sugar (such as lactose) is present. D. is a form of catabolite repression.

A. occurs in response to low energy stores.

The reverse TCA cycle differs from the Calvin cycle in that . . . A. only in the reverse TCA cycle are there several different substrates into which CO2 can be incorporated. B. only in the reverse TCA cycle is ATP hydrolyzed to ADP & inorganic phosphate. C. only the reverse TCA cycle includes oxidation-reduction reactions. D. in the reverse TCA cycle, Rubisco functions predominantly as an oxygenase.

A. only in the reverse TCA cycle are there several different substrates into which CO2 can be incorporated.

A prophage is a . . . A. phage genome integrated into a host genome. B. virus that promotes tumor growth in plants. C. circular phage genome that promotes cell lysis. D. bacterial virus particle that has not yet infected a cell.

A. phage genome integrated into a host genome.

The viral capsid is comprised of . . . A. proteins. B. lipopolysaccharides. C. carbohydrates. D. nucleic acids.

A. proteins.

The role of the DnaA protein in bacterial DNA replication is to . . . A. recognize the oriC sequence & initiate replication. B. load helicase. C. create an RNA primer. D. create phosphodiester bonds.

A. recognize the oriC sequence & initiate replication.

RNAi . . . A. recognizes viral mRNA & prevents further viral gene expression. B. allows host cells to remember infection by copying small sections of viral DNA into RNA. C. occurs at random leading to the prevention of some key steps in the viral replication cycle. D. destroys the infected cells & halts viral production.

A. recognizes viral mRNA & prevents further viral gene expression.

Why might regulation by sRNA be considered more energetically efficient than regulation by repressors? A. sRNAs do not need to be translated. B. sRNAs do not need to bind to targets. C. sRNAs do not need to be transcribed. D. Repressors require ATP to bind to operator sequences.

A. sRNAs do not need to be translated.

Tomato mosaic virus (ToMV) causes significant economic losses in agriculture & food crops. ToMV is not only a problem for tomatoes; it can also impact peppers, potatoes, apples & cherries. Upon infection, the virus causes the plants to yellow & have stunted growth & reduced yield. Fortunately, similar to humans, plants have adapted defenses to survive viral onslaughts.The discovery of ________ in plants has led to a deeper understanding of how cells protect themselves from stress responses and, of course, from viral infections. A. siRNA for RNA interference B. mutations to block viral entry C. antiviral antibodies D. antiviral interferons

A. siRNA for RNA interference

With respect to controlled protein degradation, . . . A. signals called degrons dictate the stability of a protein. B. enzymes are not required. C. all proteins have a similar half-life. D. proteolysis occurs in the periplasmic space.

A. signals called degrons dictate the stability of a protein.

In the plaque assay for bacteriophages, . . . A. the plaque is a clear zone caused by a zone of lysis. B. coculture with bacteria is not required. C. the plaque is an opaque area caused by a high concentration of virus. D. only temperate phages may be used.

A. the plaque is a clear zone caused by a zone of lysis.

All of the following may influence the use of a particular oxidant as a terminal electron acceptor, EXCEPT . . . A. the presence of an oxidant-specific quinone pool. B. oxygen availability. C. the presence of a corresponding oxidoreductase. D. the oxidant's concentration. E. the oxidant's reduction potential.

A. the presence of an oxidant-specific quinone pool.

The reductive acetyl-CoA pathway of carbon fixation differs from other known pathways in that ONLY . . . A. the reductive acetyl-CoA pathway is not a cycle that regenerates substrates. B. the reductive acetyl-CoA pathway requires heteroaromatic cofactors. C. the reductive acetyl-CoA pathway is exclusive to eukaryotes. D. carbon fixed via the reductive acetyl-CoA pathway can be used to synthesize amino acids.

A. the reductive acetyl-CoA pathway is not a cycle that regenerates substrates.

Denaturation of DNA refers to . . . A. the separation of the double helix into single strands. B. the double-stranded DNA supercoils. C. when the phosphodiester bonds between adjacent sugars break. D. the breaking of covalent bonds between the nitrogenous bases & the sugars.

A. the separation of the double helix into single strands.

The functional prokaryotic ribosome consists of . . . A. three RNAs & many proteins. B. two proteins & two RNAs. C. two RNAs & three proteins. D. three subunits & two RNAs.

A. three RNAs & many proteins.

Bacterial genomes . . . A. usually are a single circular chromosome. B. usually are several circular chromosomes. C. highly diverse in structure & their organization depends on the species. D. usually are several linear chromosomes.

A. usually are a single circular chromosome.

Viruses are capable of converting into a(n) . . . A. virion, an intracellular replication complex & an integrated part of the host genome. B. intracellular replication complex, a prophage & a prion. C. phage, a plaque & an oncogene. D. virion, a phage & a plaque.

A. virion, an intracellular replication complex & an integrated part of the host genome.

Which of the following may possess an RNA genome? A. viruses B. eukaryotes C. bacteria D. archaea E. prions

A. viruses

Culturing viruses in a laboratory is more complicated than culturing bacteria because . . . A. viruses must be cocultured with a host cell. B. all viruses are dangerous to humans. C. viruses must be cocultured with another virus. D. viruses are so small.

A. viruses must be cocultured with a host cell.

Compared with the number of antibiotics, the number of antiviral drugs is small because . . . A. viruses use host cell machinery to replicate. B. there are not many viruses that infect humans. C. viruses lack a genome and genomes are often the target for drugs. D. viruses are very similar in structure to human cells.

A. viruses use host cell machinery to replicate.

Scientists define a process as being under circadian control if which of the following criteria are met? A.After entrainment, the process is able to "free-run" in the absence of light cues. B.The process's clock is able to be "reset" by manipulation of the light/dark entrainment cycles. C.The process's periodicity is maintained despite slight variations in temperature. D.The process is essential so that any mutation that alters or disables its "clock" is lethal to the cell. E. The process's clock proteins share a common evolutionary origin with those described in other organisms.

A.After entrainment, the process is able to "free-run" in the absence of light cues. B.The process's clock is able to be "reset" by manipulation of the light/dark entrainment cycles. C.The process's periodicity is maintained despite slight variations in temperature.

The earliest life forms on our planet may have used which electron acceptor? A.Fe3+ B.Fe2+ C.oxygen gas D.water

A.Fe3+

What would most likely happen to a periplasmic protein in the general secretion pathway if the gene sequence is modified and the N-terminal sequence is significantly shortened? A.It will not be cleaved by LepB. B.It will be defective in binding SecB. C.It will not be able to fold. D.It will be defective in binding the signal-recognition particle.

A.It will not be cleaved by LepB. B.It will be defective in binding SecB.

Which of the following elements must be present for attenuation of the trp operon to occur? Select all that apply. A.RNA polymerase B.charged tRNATrp C.ribosomes D.holorepressor E.DNA polymerase F.sigma factors

A.RNA polymerase B.charged tRNATrp C.ribosomes

In what ways do virions resemble living cells? A.Some virions possess genes for tRNA. B.They possess genes that can direct their own replication. C.Their genomes can be larger than some cellular genomes. D.Some virions exhibit flagellar motility. E.They are capable of protein synthesis.

A.Some virions possess genes for tRNA. B.They possess genes that can direct their own replication. C.Their genomes can be larger than some cellular genomes.

What is the role of the first structural gene (lacZ) in the lac operon? A.The LacZ protein breaks down lactose into glucose & galactose. B.The LacZ protein binds to & inactivates the lac repressor. C.The LacZ protein causes cAMP levels to rise in the presence of increasing concentrations of lactose. D.The LacZ protein transports lactose into the cell. E.The LacZ protein isomerizes lactose into allolactose.

A.The LacZ protein breaks down lactose into glucose & galactose. E.The LacZ protein isomerizes lactose into allolactose.

A strain of Mycobacterium tuberculosis that is deficient in nonhomologous end joining repair should be more sensitive to damage by ________________.

X rays

What induces intein splicing in Pyrococcus horikoshii RadA? a. ssDNA b. RNA c. dNTPs d. dsDNA

a. ssDNA

Which of the following molecules can serve as an electron donor to fuel an electron transport chain? A.NADH B.water C.ammonia D.all of the above

all of the above

Rolling-circle replication of plasmids proceeds . . . a. in opposite directions from a single fixed origin. b. in one direction from a single fixed origin. c. in one direction from multiple origin sites. d. in opposite directions from multiple origin sites.

b. in one direction from a single fixed origin.

The "coding region" of a gene corresponds to what section? a. all nucleotides between the transcription start (+1) & terminator sites b. the nucleotides that specify the amino acid sequence of a protein c. the -35 to -10 positions upstream of the transcription start site d. the region between the origin of replication & terminator sequences e. the region on mRNA between where the ribosome binds & the end of the untranslated trailer

b. the nucleotides that specify the amino acid sequence of a protein

Secondary chromosomes most likely evolve in bacteria as a result of . . . a. gradual evolution (that is, through random mutation) of essential genes on a resident plasmid. b. translocation of one or more essential genes from the primary chromosome to a resident plasmid. c. acquisition of a second chromosome by horizontal gene transfer followed by reductive evolution. d. splitting of an original bacterial chromosome into two self-replicating elements.

b. translocation of one or more essential genes from the primary chromosome to a resident plasmid.

The electrical potential across the membranes in most cells is such that... a. there is no charge separation across the membrane and hence no voltage difference. b. the inside of the cell is positive relative to the outside of the cell. c. the inside of the cell is negative relative to the outside of the cell. d. the inside of the cell is negative, so all positive particles are expelled.

c. the inside of the cell is negative relative to the outside of the cell.

Further analyses revealed that a region downstream of the seaweed-digesting genes in Bacteroides plebeius contained sequences homologous to conserved relaxase/mobilization proteins. These data provide additional evidence that the genes were acquired by __________________.

conjugation

In metagenomics, a "core gene family" is one that is . . . a. involved in some aspect of central catabolism. b. found in every organism within a microbial community. c. constitutively expressed by most community members. d. present in at least some members of all communities examined. e. widely distributed but whose function is unknown.

d. present in at least some members of all communities examined.

The proton motive force is a source of energy that can directly power all of the following except the... a. rotation of bacterial flagella. b. production of ATP. c. import of other ions against their concentration gradient. d. synthesis of proteins from amino acids.

d. synthesis of proteins from amino acids.

Gene transfer agents, when viewed by electron microscopy, could easily be mistaken for . . . a. sex pili. b. naked DNA. c. membrane vesicles. d. viruses. e. nanotubes.

d. viruses.

Genes that share a common ancestry are broadly referred to as ____________.They are further classified as ____________________, if they exist within the same species but have distinct functions, while ________________ usually have similar functions but are found within different species.

homologs, paralogs, orthologs

Predicting relatedness of viruses is often very difficult if relying solely on genomic sequences, since viruses that share a host can exchange genetic components. This suggests that the _________________ plays a critical role in the evolution of viruses. Along this vein, examining ______________ can demonstrate functional relatedness of viruses that can be obscured in genomic sequences due to mutations & continual exchange of genetic information between co-infecting viruses.

host range / proteomics

In a typical Gram-negative bacterium such as E. coli, proteins known as cytochromes (which are sometimes part of larger complexes known as oxidoreductases) are localized to the _____________________________.

inner plasma membrane

The proteins of the electron transport chain are A.located in the cytoplasm. B.associated with DNA. C.located within a membrane. D.none of the above

located within a membrane.

Temperate bacteriophages can undergo two routes of infection. During _________________ the phage DNA is inserted into the bacterial genome & is replicated each time the bacterial cell divides.

lysogeny

Eukaryotic genomes comprise mostly __________, whereas prokaryotes have mostly __________.

noncoding DNA; coding DNA

An E. coli strain with a mutation rate of about 10-10 per base pair replicated would be considered a ___________ strain.

normal

One form of genome organization in a bacterial cell is the compartmentalization of chromosomes & plasmids. When bacterial chromosomes & plasmids are fluorescently labeled in vivo, chromosomes are consistently localized to the ___________________ while plasmids are consistently localized to the ___________________.

nucleoids; cell poles

Bacterial replication begins at a single, defined DNA sequence known as _____________.

origin

Extracellular electron shuttles generally accept electrons directly from which materials?

outer membrane cytochromes

For a Gram-negative bacterium such as Escherichia coli, the four major destinations for extracytoplasmic proteins (proteins not in the cytoplasm) are the plasma membrane, extracellular spaces, the outer membrane, & the _______________.

periplasm

Within the order of viruses called Caudovirales is a/an _____________________ that possesses a thin filamentous tail used to infect Staphylococcus aureus. Since Caudovirales viruses encode virulence factors such as Panton-Valentine leukocidin, which allows bacterial escape from leukocytes, this virus & bacteria have formed a/an __________________ relationship.

prophage / mutualistic

Some bacteria, such as Salmonella, use a _________________ to regulate the half-lives of sigma factors during different stages of growth.

protease

Before the scientific advances of the mid-20th century, most scientists believed that cellular genetic information was encoded by ____________.

protein

Hydrogenotrophy is A.the generation of hydrogen gas by methanogens. B.an award given to fuel companies that have the most fuel-efficient vehicles. C.the use of hydrogen gas as an electron donor. D.the oxidation of water during photosynthesis to liberate electrons, protons, and oxygen gas.

the use of hydrogen gas as an electron donor.