module 2
A segment of DNA from Drosophila melanogaster has the sequence:5' TCA AGC TTA AGA AGG CAT TTT 3'(i) Assuming that this is the template strand, what is the sequence of the encoded mRNA (make sure to denote 5' and 3' ends of the transcript)? (ii) If, contrary to section (i), the sequence shown above is the coding strand, what is the sequence of the encoded mRNA? Again, be sure to denote 5' and 3' ends of the transcript
(i) 3' AGU UCG AAU UCU UCC GUA AAA 5'-or-5' AAA AUG CCU UCU UAA GCU UGA 3' (ii) 5' UCA AGC UUA AGA AGG CAU UUU 3
What does "proofreading" refer to with regard to DNA replication?
-errors made in base pairing during replication are detected and removed by DNA pol 1, which has 3' to 5' exonuclease activity-correct base then added in that spot
List the 4 requirements of any substance that may be considered a "genetic material."
1) Replication2) Storage3) Expression4) Variation by mutation
Name the three major modifications of mRNA of eukaryotes before it is transported to the cytoplasm. In addition, tell why each of the modifications is necessary.
1) add 5' cap - protect against degradation, is binding site for ribosome 2) add polyA tail - protect against degradation, helps transfer mRNA to cytoplasm 3) remove introns- forms message that can be translated into functional protein
What are the three classes of "functional" (non-mRNA) RNAs? Briefly describe the role of each class of functional RNA.
1) tRNA - brings correct amino acid to mRNA during translation2) rRNA - major component of ribosomes3) snRNA - helps process RNA transcripts (especially removing introns)
Explain at least two reasons why the following definition of a gene is inadequate: "A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide."
1. When the DNA sequences are transcribed into mRNA, that pre-mRNA molecule must undergo splicing, or the removal of introns, before leaving the nucleus and being translated. Alternative splicing causes differenences in the final RNA molecule that will encode for the polypeptide, meaning that slightly different polypeptides will be made from the DNA sequence.2. Depending on where a start codon is located in a DNA sequence, initiation of transcription can start at different locations, creating different mRNA molecules
Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?
12%
An organism has a G content of {G}%. What is the percentage for A? g-30%
20
Which of the following DNA sequences could be the template for a piece of mRNA with the sequence:5' UGC CGA CGU AGG 3'
3' ACG GCT GCA TCC 5'
Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.
3' AGC 5'
When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing.
3' base
If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?
30%
Which of the sequences could form a hairpin?
5' GGGGTTTTCCCC 3'
Which of the following best describes the addition of nucleotides to a growing DNA chain? A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.
A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate
What are the four nucleotides that make up RNA? Give full names, not abbreviations.
Adenine (A), guanine (G), cytosine (C), and uracil (U)
A number of scientists have become interested in telomerase as a drug target. Why would they be interested in telomerase? How might cancer drug therapies that target telomerase work?
After replication there is a gap at the end of the lagging strand because the synthesis of Okazaki fragments requires RNA primers. Telomerase fills this gap so that both strands are the same length. However, telomerase is not active in most somatic cells, but it is active in cancer cells. Because cancer cells replicate continuously they need telomerase to make sure that the DNA is degraded as they replicate. However, by targeting the telomerases in cells scientists could limit the number of times a cancer cell can divide. Telomerase is an enzyme that prevents the telomeres of a chromosome from shortening. When the telomeres shorten, the cell eventually dies. In cancer cells, telomerase is constantly working so the cells never die.
What is the function of the TATA binding protein?
Allows eukaryotic RNA polymerase II to bind to the promoter of genes
**Which different DNA polymerases are found in eukaryotic cells? What are their functions?
Alpha- initiates nuclear DNA synthesis and repair, primase activityBeta-DNA repair and recomb of nuclear DNAGamma-replication and repair of mitochondrial DNADelta-continues replication, leading and lagging strand synthesis, DNA repair, translesion DNA synthesisEpsilon- leading strand synthesis
Are Okazaki fragments formed on the leading strand during DNA replication? Explain your answer.
An Okazaki fragment is a discontinuous, short fragment of DNA sequence formed in the 5' to 3' direction during the DNA replication. Okazaki fragments are found in lagging strand.It is necessary to make these fragments because DNA-dependent DNA polymerase enzyme can catalyze the polymerization reaction only in one direction. This means that the replication of one strand i.e. the template with polarity 3′→5′, is continuous, but replication of the other strand i.e. the template with polarity 5′→3′, is discontinuous, resulting in a series of short fragments, known as Okazaki fragments. These discontinuous short DNA fragments are, later, joined by the DNA ligase enzyme. -No. DNA pol III can continuously add on to the free 3' terminus. Okazaki fragments are the product of DNA polymerase having to replicate the lagging strand in pieces. The leading strand has one primer added at the beginning of replication and then can be replicated continuously.
Which of the following traits exemplify plasmid DNA? Both B and C, above It often carries genes beneficial to its bacterial host. Both A and B, above It replicates independently of the genomic DNA. It is always larger than the genomic DNA.
B). It replicates independently of the genomic DNA.C) It is always larger than the
Describe two ways in which bacterial DNA differs from eukaryotic DNA
Bacterial DNA found in a large circular and not located with a nucleus. Eukaryotic DNA is organized into linear chromosomes within the nucleus. Eukaryotic DNA is also wrapped around histones. Bacterial gene contains no introns.
Which is true of the secondary structure of DNA?
Bases on complementary strands are held together by hydrogen bonds.
A major difference between eukaryotes and prokaryotes is that eukaryotes have a nucleus, whereas prokaryotes do not. Discuss the impact of having a nucleus on the creation of mature mRNA.
Because prokaryotes do not have a nucleus, the translational machinery is able to attach to the mRNA as it is being synthesized. Thus, there is no time to process the mRNA. In eukaryotes, the translational machinery is not present in the nucleus. Thus, there is time for the cell to process the mRNA before it is transported from the nucleus to the cytoplasm and translated into protein.
Kornberg in his experiment to demonstrate the function of DNA pol I sought to show that DNA pol I was capable of replicating biologically active DNA. What does biologically active DNA mean in this context?
Biologically active DNA is capable of supporting metabolic activities and directs reproduction of the original organism from which it is originally duplicated
Which of the following traits exemplify plasmid DNA?
Both A and B, above ) It replicates independently of the genomic DNA.It is always larger than the genomic DNA.
In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts?
DNA contains phosphorus, but protein does not
Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication
DNA gyrase - supercoil removalDNA ligase - phosphodiester bonds at DNA nickContinuous synthesis - leading strandTheta replication - bidirectional circular replicationOkazaki fragments - lagging strandrollin-circle replication - unidirectional replicationDNA primase - RNA primer synthesisDNA polymerase proofreading - 3' -> 5' exonuclease activity
Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason (or reasons) for your choice. A: GTAAAAGAACATCTC CATTTTCTTGTAGAG B: TGAGCGTTGGAGCAG ACTCGCAACCTCGTC
DNA molecule BDNA molecule B has a higher G-C contentDNA molecule A has a higher A-T content
Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction?
DNA pol 3
In biology, most information flows through which sequence?
DNA to RNA to protein
A coworker in your lab discovered a strain of E. coli that has a nonfunctional RNA polymerase. He felt sorry for the suffering E. coli and decided to add an RNA polymerase enzyme and gene from Drosophila to this mutant E. coli to allow the mutant strain to survive. You think that this is a foolish idea that will not work. Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mutant E. coli to survive.
E.Coli is a prokaryote and Drosophila is a eukaryote. Eukaryotes have a nucleus and separate transcription and translation. Prokaryotic and eukaryotic RNA polymerases are different. The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus will not be able to transcribe any of the E. coli genes.
A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will -encode unformylated methionine. -serve as the initiation codon. -encode methionine that will eventually be removed. -encode N-formylmethionine.
Encode unformylated methionine
Which of the following statements is NOT true about enhancers? -Enhancers contain sequences that are recognized by transcription factors. -Enhancers are recognized by and bind directly to RNA polymerase. -Enhancers can be located thousands of nucleotides upstream of downstream of the gene they affect. -Enhancers can differ for each gene in a eukaryotic cell (although overlap is possible). -Enhancers represent control elements located far away from the promoter.
Enhancers are recognized by and bind directly to RNA polymerase.
Which of the following statements is NOTtrue about enhancers?
Enhancers are recognized by and bind directly to RNA polymerase.
Why do eukaryotic chromosomes have multiple origins of replication, whereas prokaryotic chromosomes typically have only one origin?
Eukaryotes have a very large genome and it would take too long if there was only one origin. Prokaryotes have a smaller genome and can have only one.
Briefly discuss the evidence for the semi-conservative replication of DNA
Experiments by Matthew Meselson and Frank Stahl allowed E. coli to be labeled with 15N and 14N and then followed the density of the daughter cells using cesium chloride gradient centrifugation. They predicted that parental DNA molecules of one density which were allowed to replicate in another medium of a different density will show daughter DNA molecules of intermediate density because half will be old DNA and the other half will be new DNA. Their results proved that indeed half was old and other half was new indicating DNA of intermediate density.
**Two "naked" (without histones or other proteins) double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?
Fragment A likely has a low Gaunosine/Cytosine content than fragment B. Because Guanosine/Cytosine has 3 h-bonds and Adenine/Thymine only has 2 h-bonds, more energy (higher termperature) is required to break apart the G/C rich fragment
RNA differs from DNA in that it: (more than one answer may be correct)
Has uracil rather than thymine Has ribose sugars rather than deoxyribose sugars in its nucleotides Is usually single stranded rather than double stranded
How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?
Hersey and Chase labeled the outer protein coat of a bacteriophage with radioactive sulfur, and the inner DNA with radioactive phosphorous. After allowing the bacteriophage to infect E.coli bacterium and undergoing a heavy blender process, the empty "ghost" phages were separated from the bacteria. The infected E.coli were positive for radioactive phosphorous, indicated that DNA was the genetic material inserted from the bacteriophage. The radioactive sulfur was not present in the infected bacteria, indicating that protein was not the genetic material.
What chemical group is found at the 3' end of a DNA molecule?
Hydroxyl group
What is semiconservative replication?
In semiconservative replication, the original two strands of the double helix serve as templates for new strands of DNA. When replication is complete, two double-stranded DNA molecules will be present. Each will consist of one original template strand and one newly synthesized strand that is complementary to the template. The two stands of the original helix are conserved, but they become part of separate progeny DNAs.
Telomerase is a "special" enzyme because of what characteristic?
It contains both RNA and protein --> ribonucleoprotein
Kornberg used the phage PhiX14 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Briefly describe the experimental methods that he used to draw the conclusions that DNA pol I could produce biologically active DNA.
Kornberg labled a positive (+) strand with 3H to designate it from new positive (+) strands. He then allowed the strand to replicate in heavy bromouracil with DNA polymerase I added. After replication he separated the heavy strand and the negative (-) strand and allowed replication to take place once again with the same conditions. The positive strand extracted this time was used to infect E. coli. The result of this was mature infectous phages showing the DNA pol I could prouduce active DNA. -The initial + strand was labeled with 3H to discriminate the original + stand from the new + strand. He then added DNA pol I with heavy bromouracil and allowed replication to occur. After centrifuging, Kornberg removed the heavy strand, isolated the - strand and repeated the experiment, allowing replication to occur again. The new single + stand that was produced was then used to infect E. coli. The new + strand produced infectious mature phage particles, demonstrating that DNA pol I was capable of replicating DNA.
Which of the following statements about a mammalian messenger RNA are FALSE? -It is translated in the cytoplasm. -It usually contains a cap at the 5' end. -It is usually much smaller than the initial transcript (that is copied directly from the gene). -It is synthesized in the nucleus. -None of the above.
None of the above
Are Okazaki fragments formed on the leading strand during DNA replication? Explain your answer.
Okazaki fragments are short, newly synthesized DNA fragments that are formed on the lagging template strand during DNA replication. They are complementary to the lagging template strand, together forming short double-stranded DNA sections.
How many primase molecules are needed on the leading strand? The lagging strand?
One for leading. One for each oakazaki fragment on lagging
RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.
Promoter
Which of the following statements is not true concerning RNA and DNA?
RNA is more stable than DNA
Match the eukaryotic RNA pol with correct RNA:RNA pol I; RNA pol II; RNA poll IIImRNA, tRNA, rRNA, snRNA
RNA pol I - rRNA• RNA pol II - mRNA, snRNA• RNA pol III - tRNA, rRNA, snRNA
This short piece of RNA is present only transiently in a newly-synthesized DNA molecule.
RNA primer
5' ...GGAGCUCGUUGUAUU... 3' Reference: Ref 15-4 Is this sequence RNA or DNA? How can you tell?
RNA. RNA has uracil instead of thymine.
Translation of RNA into protein takes place on which cellular organelle?
Ribosome
You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicates its DNA. Based on the following equilibrium centrifugation results, what type of replication would you propose for this new bacterium?
Semiconservative --> one intermediate band after first replication; two bands after second (one intermediate, one 14N band) that persist for every subsequent replication, with the intermediate weight getting lighter in color while the 14N band gets darker• Dispersive --> mix of old (15N) and new (14N) strands, with each replication increasing the ratio of new:old so that the single band gets higher (i.e., lighter in weight) with each replication• Conservative --> two bands after first replication: one 14N for the completely new molecule, one 15N for the completely old molecule-----Because it is a single band that is getting darker and higher with each replication, the replication is dispersive
This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates.
Semiconservative replication.
Type the complementary strand to the following single-stranded DNA. 5' - ATAGCATGGGCCATACGATTACTGA - 3'
TATCGTACCCGGYAYGCTAATGACT
Telomeres regulate the replication of the ends of chromosomes in eukaryotes. Why is this structure implicated in human aging?
Telomeres are structures at the ends of eukaryotic chromosomes that contain tandem DNA sequences added to the 3′ ends by the enzyme telomerase. Telomeres stabilize chromosomes by preventing the loss of genomic information after each round of DNA replication. Human somatic cells contain little or no telomerase, and those that do get progressively shorter and enter premature senescence. People with diseases of premature aging such as Werner syndrome and dyskeratosis congenital have shorter telomeres than healthy people.
Which statement is true regarding negative supercoiled DNA? All of the above statements are true. Negative supercoiled DNA has 10 base pairs per turn of its helix That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription. Negative supercoiled DNA is not usually seen in cells. Negative supercoiled DNA carries more negative charges than positive supercoiled DNA does.
That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription.
Genetic material must replicate faithfully. Describe how the double-stranded structure of DNA gives it this property.
The double-stranded structure can be used as a template. Each strand is replicated so that the information is passed down correctly.
What three general characteristics must the genetic material possess?
The genetic material must contain complex information, replicate or be replicated faithfully, and encode the phenotype.
What is a spliceosome
The spliceosome is the RNA-protein complex that is responsible for intron-exon splicing in eukaryotes. Following the GU-AG rule, introns are excised and removed from mRNA and the exons are joined to form a mature mRNA molecule ready for translation. The spliceosome is made of five small nuclear ribonucleoproteins (snRNPs) which consists of proteins and one of five snRNAs (U1, U2, U4, U5 and U6) which together with over 100 proteins form the large biological machine used for splicing.
What is the spliceosome?
The spliceosome splices out the non-coding introns from the primary mRNA transcript, and stitches the exons back together into the mature mRNA transcript. ... It is an "expressed segments" of mRNA. It is shorter sequences than "introns" and it is spliced together after the removal of Introns to form functional mRNA.
DNA replication is semi-conservative in that The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved. DNA replication can only follow the replication fork on the leading strand. The two stands of the original helix are conserved, but they become part of separate progeny DNAs. The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication.
The two stands of the original helix are conserved, but they become part of separate progeny DNAs.
List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: • Attachment of snRNP U1 to the 5' splice site • Transesterification reaction at the branch point adenine • Transcription of the DNA template into the pre-mRNA molecule • Recognition and binding the 3' AAUAAA sequence by specific protein factors • Cleavage at the poly(A) site • Addition of the 5' cap • Export to the cytoplasm • Addition of the poly(A) tail • Release of lariat structure • Splicing together of exons
Transcription of the DNA template into the pre-mRNA molecule2. Addition of the 5' cap3. Recognition and binding the 3' AAUAAA sequence by specific protein factors4. Addition of poly(A) tail5. Attachment of snRNP U1 to the 5' splice site6. Transesterfication reaction at the branch point adenine7. Release of lariat structure8. Cleavage at poly(A) site9. splicing together of exons10. export to the cytoplasm
In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (15N) and then transferred them to a medium containing 14N. Which of the results in the above figure would be expected after one round of DNA replication in the presence of 14N?
Tube B - with two different lines
In a dna double helix: 1).the number of hydrogen bonds between the participating bases is always constant 2).a purine always pairs with a pyrimidine 3).None of the above 4)A pairs with G, and T pairs with C 5). disulfide bridges are formed between the two DNA strands
a purine always pairs with a prymidine
What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence?a) that RNA was the genetic materialb) that DNAse or protease, but not RNase, stimulates transformationc) that protein was the genetic materiald) that DNA was the genetic material
a) that RNA was the genetic material
What is the function of eukaryotic RNA pol I?a) transcription of rRNA genesb) transcription of mRNA genesc) transcription of tRNA genesd) transcription of snRNAse) initiation of transcription (but not elongation)
a) transcription of rRNA genes
An organism has an A + T content of {AT}%. What is the percentage for C?
a+g=t+c so c is ag/2
Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule? a.A + T = G + C b.A + G = T + C c.A + C = G + T d.(A + T)/ (C + G) = 1.0 e.(A + G)/ (C + T) = 1.0 f.(A/C) = (G/T) g.(A/G) = (T/C) h.(A/T) = (G/C)
a. A+T= 40 not equel to G+C =60 false b. A+G =50 =T+C True c. A+C =50 =G+T True d. (A+T=40)/(C+G=60) Is not equel to 1 so it is false e.(A+G)/(C+T)=1 True f. (A/C= 20/30) not equel to (G+T=30/20) So false. g. A/G = T/C =20/30 True h. A/T = G/C = 20/20 = 30/30 = 1
Name the three major modifications of mRNA of eukaryotes before it is transported to the cytoplasm. In addition, tell why each of the modifications is necessary.
add 5' cap (protect against degradation, acts as a binding site for the ribosome); add poly-A tail (possibly protect against degradation, possibly helps in the transfer of the mRNA to the cytoplasm); remove introns (forms a message that can be translated into a functional protein). Briefly discuss the evidence for 5' methylated cap - protects against degradation in the cytoplasm, acts as a binding site for ribosomes and eukaryotic translation initiation factors• Poly-A tail - also protects against degradation, acts as a binding site for poly-A binding protein to stabilize the mRNA during translation3) Removal of introns - spliced out by the spliceosome, leaving the exons to be ligated together to form a message ready for translation
Which is a characteristic of DNA sequences at the telomeres? all choices are correct The consist of repeated sequences One strand protrudes beyond the other, creating some single-stranded DNA at the end. They consist of cytosine and adenine nucleotides
all are correct
In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction. synthetase; P; A; ribosome mRNA; E; P; polymerase tRNA; P; A; peptidyl-tRNA aminoacyl-tRNA; A; P; ribosome
aminoacyl-tRNA; A; P; ribosome
You are producing a heteropolymer of synthetic mRNA using a 1:5 (C:G) ratio. In this synthetic mRNA, what is the proportion of codons with 2G and 1C?a) 25/216b) 75/216c) 1/216d) 125/216
b) 75/216CGG = (1/6)(5/6)(5/6) = 25/216GCG = (5/6)(1/6)(5/6) = 25/216GGC = (5/6)(5/6)(1/6) = 25/21625/216 + 25/216 + 25/216 = 75/216
The "RNA World" theory suggests that:a) RNA is the intermediate between DNA and proteins.b) RNA was the genetic material in the first living cells.c) many RNAs are capable of self-splicing.d) eventually RNA will become the genetic material of most living organisms.e) RNA viruses are more dangerous than DNA viruses.
b) RNA was the genetic material in the first living cells.
What enzyme is exploited to produce a synthetic mRNA?a) polynucleotide kinaseb) polynucleotide phosphorylasec) ligased) RNA pol II
b) polynucleotide phosphorylase
The anticodon on the tRNA molecule: contains amino-acyl-tRNA synthtase. is a catalytic part of protein synthesis. is the same for all tRNA molecules. is oriented and written in the 5'→ 3' direction. binds to the mRNA in a complementary fashion.
binds to the mRNA in a complementary fashion.
How do centromeres help control the cell cycle? by inhibiting anaphase until spindle fibers are attached to chromosomes by inhibiting the S phase until the cell is ready to double its DNA content by causing DNA not attached to centromeres to be lostby inhibiting anaphase until spindle fibers are attached to chromosomes by activating cell cycle control genes
by inhibiting anaphase until spindle fibers are attached to chromosomes
Which one of the following statements regarding eukaryotic transcriptions is not true?a) Eukaryotic transcription involves a core promoter and a regulatory promoter.b) There is no one generic promoter.c) A group of genes is transcribed into a polycistronic RNA.d) Chromatin remodeling is necessary before certain genes are transcribed.
c) A group of genes is transcribed into a polycistronic RNA.
This form of DNA replication was eliminated during the Meselson-Stahl experiment because the original double-helix did not appear to be preserved during cell division.
conservative replication
Heterochromatin is characterized by all of the following, EXCEPT that it s present on most of the Y chromosome. contains genes that require high levels of transcription. is present at centromeres and telomeres. is present all over the inactive X chromosomes in mammals. remains highly condensed throughout the cell cycle.
contains genes that require high levels of transcription
The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation?a) It blocks access of RNA polymerase to the promoter, until removed by general transcription factors.b) It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters.c) It modifies histones so that nucleosomes can be removed from DNA for transcription.d) It bends and partly unwinds DNA at a promoter.
d) It bends and partly unwinds DNA at a promoter.
Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon? 1)All of the above. 2).use of different transcriptional activators. 3).multiple random mutations within specific exons of the gene. 5).differential acetylation of specific histone proteins prior to transcription. 4).differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.
differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.
What is the function of peptide transferase activity?a) It charges tRNAs.b) It acetylates the end of a protein after translation.c) It cleaves the polypeptide from the last tRNA during termination.d) It moves ribosomes along during mRNA translation.e) It forms peptide bonds.
e) It forms peptide bonds (during translation)
In DNA replication, the lagging strand is:a) the strand which must be replicated in a direction toward the replication fork.b) the part of the DNA which is just about to be unwound.c) the portion of the helix that is not anti-parallel with its paired strand.d) the portion of the DNA that has been fully replicated.e) the strand which must be replicated in a direction away from the replication fork.
e) the strand which must be replicated in a direction away from the replication fork.
Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
excision of introns
Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes fusion into circular forms known as plasmids union with ribosomes excision of introns linkage to histone molecules
excision of introns
Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that
genetic material must be composed of many different units to account for the variability seen in nature.
The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___.a. mRNA stabilityb. translationc. intron splicingd. protein stability
intron splicing and protein stability
The spliceosome is a large enzyme that catalyzes removal of specific? junk sequences in the DNA by splicing different parts of a gene. introns in pre-mRNAs. sequences in either a DNA or an RNA None of the above. amino acid sequences in the protein by splicing different parts of a protein.
introns in premrna's
All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one?
mRNA
Which of the following statements best describes the messenger RNA?
mRNA is the only type of RNA that carries DNA's protein building instructions
Which of the following statements about the genetic code are true? Most amino acids are encoded by more than one codon There is only one codon for each amino acid Two consecutive bases specify an amino acid The code is ambiguous but not redundant None of the above
most amino acids are encoded by more than one codon
An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it? 5" ACU3' none 5'ATT3' 5'AUC3"
none
This organic subunit is the monomer from which nucleic acid is formed.
nucleotides
Short "bursts" of DNA synthesis on the lagging strand produce ___________.
okazaki fragments
What chemical group is found at the 5' end of a DNA molecule?
phosphate group
The bonds that connect nucleotides in a strand are called _________bonds.
phosphodiester
Hershey and chase labeled DNA using this radioactive atom.
phosphorus
The ribosome is the primary site of:
protein synthesis
DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide?
ribose sugar
a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA Reference: Ref 13-1 This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil.
rna only
Hairpins are formed in DNA as a result of
sequences on the same strand that are inverted and complementary
What are the three classes of "functional" (non-mRNA) RNAs? Briefly describe the role of each class of functional RNA.
tRNA (brings the correct amino acid to the mRNA during translation);rRNA (major component of ribosomes); help to catalyze the assembly of amino acids into protein chains.snRNA [helps process RNA transcripts (especially, helps remove introns)].
Eukaryotes have two of these per chromatid; prokaryotes have none.
telomeres
This term describes the sequence of nucleotides that direct the formation of a new nucleic acid strand.
template
The packaging of DNA into a confined space is what level of DNA structure?a) quaternaryb) secondaryc) tertiaryd) primary
tertiary
What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli.
that protein was the genetic material in phage
This Greek letter describes the shape of a bacterial chromosome mid-way through replication.
theta
The role of tRNA is:
to act as transporters bringing amino acids to the site of protein synthesis.
In eukaryotes, tRNAs are
transcribed in the nucleus, but function in the cytoplasm.
In prokaryotes, translation of an mRNA is coupled to
transcription
The nitrogenous base that is found in RNA but not in DNA is
uracil
Write the correct anticodon (with correct polarity) of all tRNAs that will bind to the mRNA codon 5' UCG 3' (include wobble-base pairing).
• Correct: 5' CGA 3'• Wobble: 5' AGA 3', 5' UGA 3', 5' GGA 3'