Molecular Genetics - Frank

AP repair does not involve...

AP glycosylase

Which statement best explains why I- mutations in the lac system are normally recessive to I+ alleles?

In any I+/I- heterozygote, presence of one functional repressor gene is enough to make the operon function properly.

A small (one base pair) insertion in the middle of the coding region of a gene will cause a:

frameshift mutation

The lac repressor (LacI) binds to:

lactose and DNA

The spliceosome includes both protein and a functional type of RNA known as:

small nuclear RNAs (snRNAs).

The product of the regulatory gene of the lac operon is:

the repressor

Redundancy in the genetic code is best illustrated by:

threonine codons

By base-pair substitution, what are all the synonymous changes that can be made starting with the codon CGG?

CGU, CGA, CGC, AGG

The final covalent bond made in the completion of an Okazaki fragment, after primer removal and gap filling, is made by

DNA ligase

Site-specific recombination does not involve... RecBCD endonuclease, RecA, ligase, RuvC endonuclease (resolvase), none of these (all of these are involved)

RecBCD endonuclease

The nuclear genome of a mouse nerve cell is compared to that of a mouse skin cell. What differences can we expect to see between these two cells' nuclear genome?

The two cells have the same genome; there will be no differences.

Can a missense mutation of proline to serine be made with a mutagen that causes a GC to AT transition?

Yes, because the proline-to-serine conversion can be accomplished by a transition in the first position

You are studying an E.coli gene that specifies a protein. A part of its sequence is -Ala-Pro-Trp-Ser-Glu-Lys-Cys-His-. You recover a mutant for this gene that shows no enzymatic activity. By isolating the mutant enzyme product, you find the following sequences: -Ala-Pro-. What is the most likely molecular basis for this mutation?

a nucleotide substitution converting UGG to UGA

The attenuator region of the trp operon is located:

between the operator site and the first structural gene

The -10 and -35 boxes found in most bacterial promoter elements were discovered by:

comparing the DNA sequences in front of highly expressed genes and determining nucleic acids that were common (consensus).

E.coli cells that have mutations in the gene encoding mutH will be defective in:

mismatch repair

Methylated adenine residues at GATC are involved in...

mismatch repair

Which type of mutation alters the protein sequence with another amino acid that is functionally equivalent?

missense conservative mutation

If E. coli, grown for a period of time in N15, is transferred to N14 for one generation DNA replication, the resulting DNA should have N14 added to all "new DNA. If semiconservative replication is occurring, the n14-containing "new" DNA will compose:

one strand of all bacterial chromosomes.

Which of the following is an example of a cis-acting element?

operator site

In ribosomal protein gene regulation the regulator protein binds two sites. In order of higher affinity to lower affinity, they are...

ribosome, initiator region of one coding region of the polycistronic mRNA

The translation initiator for the replicase in MS2 phage is buried within tertiary structure of...

the coat protein coding region

If a polyribonucleotide contains equal amounts of randomly positioned adenine and uracil bases, what proportion of its triplets will encode isoleucine?

1/4

In the division of a somatic cell, DNA replication occurs

before mitosis

The translation initiator for the A-protein in MS2 phage is buried within tertiary structure of...

its own coding region

Consider the sequence, 5'...AGGUAAGU......A........UUUCCCAGG... Which site in this intron will the U2 snRNP recognize and bind to, thereby facilitating intron removal?

the A site in the "middle" of the intron

In a protein-synthesizing system in vitro, indicate the identities and . proportions of amino acids that will be incorporated into proteins when the ration of 1 UDP : 5 CDP is used to synthesize an artificial mRNA.

1 Phe : 25 Pro : 5 Ser : 5 Leu

In nonsense suppression...

1st mutation is nonsense, 2nd is base substitution in tRNA

The proofreading capability of DNA polymerase is equivalent to

3'-->5' exonuclease activity

If the DNA template 5'-ATGCATGC-3' were transcribed to RNA, the RNA would read:

3'UACGUACG5'

How many instances are there in which you would fail to know the first two nucleotides of the codon if you knew the amino acid specified by it?

3; Ser, Leu, and Arg

Consider the following segment of DNA, which is part of a longer molecule constituting a chromosome: 5ATTCGTACGATCGACTGACTGACAGTC3 3TAAGCATGCTAGCTGACTGACTGTCAG5

5'-ATTCGTACGATCGACTGACTGACAGTC-3'

Based on the information from the two figures, which of the following RNA sequences is most likely to form a bacterial transcription termination site resulting in the release of the RNA transcript? (33)

5'AAUUCGACAGGGCGCGAAUGGCUCGCCGGGUUUUUUUU3'

The following diagram shows a fragment of DNA, and the upper strand is the template strand: 5'ATTGCC3' 3'TAACGG5' The transcribed RNA can be represented by

5'GGCAAU3'

What is the anticodon of tRNA trp encoded in the vertebrate mitochondria?

ACU

During mutagenic treatment with nitrous acid, an adenine deaminates to form hypoxanthine, which bonds like guanine. The mutational event would be:

AT to GC

Which of the following is a FALSE statement about the figure? (32) arrows represent direction of transcription, genes 2&3 are transcribed in same direction but gene 1 is opposite, all three are transcribed in same direction, gene transcription is always 5'-3', genes transcribed in different directions use opposite strands of the DNA as templates

All three genes are transcribed on the same direction.

What codons are not part of the regular copolymer made from ACGU? GAU, CGU, ACG, GUA

GAU

A protein fragment has the following sequence NH2-his-met-leu-ile-lys-COOH. The strand sequence (3'-5') would be

GTATACAATTATTTT

Topoisomerase and helicase have distinct functions that include which of the following?

Helicase is responsible for unwinding the double helix (separating strands).

If DNA polymerase III could add bases in the 3'-->5' direction in E. coli, there would be no need for

Okazaki fragments

Short pieces of DNA replicated on the lagging strand are referred to as

Okazaki fragments

The transcribing enzyme is primarily

RNA polymerase

What enzyme unwinds the double helix during transcription?

RNA polymerase

Which of the following is true of tRNA processing in E. coli? RNaseP acts as an endonuclease, RNaseD creates the 3'CCA5' end, RNaseD acts as an endonuclease, more than one of the answers

RNaseD creates the 3'CCA5' end.

The switch from strain H2 to strain H1 in Salmonella does not require... RuvAB, Hin endonuclease, RecA equivalent, ligase, a resolvase (RuvC equivalent)

RuvAB

Which of the following is unnecessary for site-specific recombination? an initiating endonuclease, RecA, ligase, RuvAB, RuvC endonuclease (resolvase)

RuvAB

Referring to the figure, what is the DNA polymerase I enzyme doing?

The Pol I enzyme is removing primers in the lagging strand of DNA.

How does a nonsense suppressor mutation prevent amber mutants from terminating their polypeptides prematurely?

The mutation alters a tRNA so that it reads the amber codon and inserts an amino acid.

In mismatch repair in E.coli, only a mismatch in the newly synthesized strand is corrected. How is E.coli able to recognize the newly synthesized strand?

The newly synthesized strand is unmethylated, while the template strand is methylated.

The trp operon is controlled by:

Trp repressor and attenuation

What snRNP holds the exons in place so that they can be connected after the intron is removed?

U4, U5, U6

What is the anticodon of tRNA ile encoded in the vertebrate nucleus?

UAI

The 26th codon in the coding region for release factor 2 protein is ________ and the 26th amino acid in the full-length protein is _______.

UGA, aspartic acid (asp)

Primer removal during DNA synthesis involves a. 5'-3' exonuclease b. 3'-5' exonuclease c. 5'-3' polymerase d. a&b e. a&c

a&c

The sigma 37 protein binds... a. RNA polymerase core enzyme b. the -10 and -35 promoter sequences c. promoter sequences in front of high-temperature proteins d. two of these e. all three of these

a. RNA polymerase core enzyme b. the -10 and -35 promoter sequences c. promoter sequences in front of high-temperature proteins d. two of these e. all three of these

Which of the following is not true of E. coli Pol III? major replicating enzyme, acts as a dimer, only adds nucleotides to pre-existing polynucleotide, forms phosphodiester linkage 5'-3' only, none of the above

a. major replicating enzyme b. acts as a dimer c. only adds nucleotides to pre-existing polynucleotide d. forms phosphodiester linkage 5'-3' only e. none of the above

Initiation of replication occurs at an "origin of replication" site that typically includes an AT-rich region. Initiation benefits from these AT-rich regions because:

adenine-thymine pairs are held together by two H-bonds, making them easier to separate during unwinding.

The double-strand break model of recombination does not involve... endonuclease, exonuclease, Holiday criss-stranded intermediate, polymerase, all are involved

all are involved

DNA polymerase III a. has 5'-->3' polymerase activity b. has 3'-->5' exonuclease activity c. has 3'-->5' endonuclease activity d. two of these e. all of theses

all of these

The GO repair system does not involve... a. adenine glycosylase b. 8-oxo-dG glycosylase c. 8-oxodGTP pyrophosphatase d. AP exonuclease e. all of these are involved

all of these are involved

In the bacteriophage y, the N gene encodes:

an antiterminator

What is required for DNA polymerase to add new nucleotides to a growing new DNA strand?

an available 3' OH group

The "wobble" base is less important than the other two nucleotides in a codon and is found:

at the 5' end of the tRNA anticodon

If E. coli, grown for a period of time in N15, is transferred to N14 for one generation DNA replication, the resulting DNA should have N14 added to all "new DNA. If conservative replication is occurring, the n14-containing "new" DNA will compose:

both strands of DNA in half of all bacterial chromosomes.

What role does RuvAB play in Holiday recombination?

branch migration

The conserved adenine nucleotide in introns serves as the:

branch point for the formation of the intronic "lariat"

What enables the splicing of group I and II introns?

catalytic RNA

Which of the following is not true of DNA replication? begins at an origin, bidirectional, semiconservative, requires priming, conservative

conservative

When comparing the three key models of DNA replication, the model that included the synthesis of a completely brand new double-stranded DNA molecule from an original molecule was named:

conservative replication

Consider the following genotype in E. coli: I+OcZ+Y+/F'-O+Z+Y+. Is it....

constitutive

A super repressor mutation (I^s) results in:

constitutive transcription

The Meselson-Stahl experiment made clear predictions regarding experimental outcomes if dispersive, conservative, or semiconservative DNA replication was occurring in their E. coli cells. This experiment enables the detection of "new" and "old" DNA by assessing the ____ of DNA molecules in the cells.

density

Which of the following is(are) spontaneous lesions that can lead to mutations?

depurination and deamination of 5-methylcytosine to thymine

Akyltransferases are involved in...

direct lesion removal

A mutational event inserts an extra nucleotide pair into DNA. Which of the following outcomes do you expect in the resultant protein?

frameshift mutation

If an incorrect base is incorporated during DNA synthesis and is not corrected by DNA polymerase, it can be corrected by postreplication repair. Postreplication repair does NOT involve which of the following?

glycosylase

Consider the following genotype in E. coli: I-O+Z+Y+/F'-I+. Is it....

inducible (regulated)

What role does the lamda phage int gene product play in site-specific recombination?

initiating endonuclease

Which of the following is an example of a trans-acting factor?

lacI repressor protein

SOS (error-prone repair) does not involve... RecA, UmuD, UmuC, DNA polymerase, ligase

ligase

A mutation changes a codon from AAA (encoding lysine) to AGA (encoding arginine) in yeast, but no mutant phenotype is detected when the mutant strain is plated and grown on minimal or complete medium. This type of mutation is called:

missense conservative

The lexA repressor binds to operators in front of all of these genes except... lexA gene, uvrA gene, umuD gene, RecA gene, mutH gene

mutH gene

The fluctuation test of Luria and Delbruck showed that:

mutations can arise spontaneously before exposure to the selecting agent

Does transcription read-through to the trp operon structural genes occur (no termination) when stem-loop 3-4 forms?

no

Hydroxylamine (HA) causes only GC to AT transitions in DNA. Can HA treatment change nonsense mutations (UAG, UAA, and UGA) back into sense codons?

no

In the wild-type lac operon, are the structural genes expressed to high levels when lactose is present and glucose is present?

no

When replicating the end of a chromosome, the lagging strand cannot copy the last ~10 nucleotides at the end of the chromosome. As a result, chromosomes contain telomere sequences at their ends, which are defined as:

noncoding, repetitive sequences that are synthesized separate from DNA replication.

Which type of mutation causes premature termination of translation, resulting in a shortened protein?

nonsense mutation

The translation initiator for the coat protein in MS2 phage is buried within tertiary structure of...

not buried in tertiary structure at all

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?

nucleus

Following splicing, the conserved adenosine nucleotide within the intron displays an unusual array of bonds, including:

phosphodiester bonds attached at three places on the ribose (2',3',5').

RNA synthesis is similar to DNA synthesis in that...

polymerization is 5' to 3'

Referring to the figure, which of the following proteins is required for the DNA polymerase III to continue synthesizing the lagging strand of DNA?

primase and helicase

DNA-dependent RNA polymerase binds to the:

promoter

The antisense RNA for inhibiting translation of the transposase mRNA in Tn10 is synthesized from...

promoter-out (a promoter on the transposase mRNA non-template strand)

The spliceosome functions to:

remove noncoding introns from transcribed RNAs.

skipped

skipped

In a haploid fungus, a small in-frame deletion arises in the coding region of a gene necessary for the production of the amino acid leucine. The deletion removes the three base pairs corresponding to a UAC codon (encoding cysteine). This small deletion will most likely cause:

the production of a shorter mRNA and of a shorter protein

The Holiday model of recombination does not involve... endonuclease, exonuclease, polymerase, ligase, two of these

two of these