MolGen Final - Mod 2
Explain at least two reasons why the following definition of a gene is inadequate: "A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide."
1. When the DNA sequences are transcribed into mRNA, that pre-mRNA molecule must undergo splicing, or the removal of introns, before leaving the nucleus and being translated. Alternative splicing causes differenences in the final RNA molecule that will encode for the polypeptide, meaning that slightly different polypeptides will be made from the DNA sequence. 2. Depending on where a start codon is located in a DNA sequence, initiation of transcription can start at different locations, creating different mRNA molecules.
Name at least four structural predictions made by Watson/Crick's DNA model?
1. the diameter of DNA is 20 Angstroms 2.base pairs are perpendicular to the strands and lie flat 3. the strands are antiparallel where one runs from 3'-5' and the other 5'-3' 4. DNA winds in a right hand direction.
An organism has an A + T content of 61%. What is the percentage for C?
19.5%
An organism has a G content of 26%. What is the percentage for A?
24%
In transcription, nucleotides are always added to the _____end of the elongating strand.
3'
Which of the following DNA sequences could be the template for a piece of mRNA with the sequence: 5' UGC CGA CGU AGG 3'
3' ACG GCT GCA TCC 5'
When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing.
3' base
Which of these sequences, if paired with its complementary strand, would be a palindrome?
5' CCCGGG 3'
Which of these sequences could form a hairpin?
5' GGGGTTTTCCCC 3'
Which one of the following statements regarding eukaryotic transcriptions is not true?
A group of genes is transcribed into a polycistronic RNA.
What is a gene?
A sequence of DNA that encodes a protein
What is the initiator triplet in both prokaryotes and eukaryotes? What amino acid is recruited by this triplet?
AUG, methionine
3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of an RNA produced by using the DNA sequence shown as a template?
AUGGCACGCACUGUAAUUCGG
Below is a list of terms, each term relating to the replication of chromosomes. Describe the role (relationship) of each in (to) chromosome replication. (a) Okazaki fragment (b) Lagging strand (c) Bidirectional
B. In DNA synthesis, the lagging strand is the strand of original DNA in which DNA Polymerase III must move away from the replication fork, because it synthesizes new DNA only 5' to 3'. DNA synthesis is not continuous on the lagging strand. A. Because synthesis is not continuous and in order for DNA Polymerase III to synthesize in the correct 5' to 3' direction on the lagging strand, short strands of DNA called Okazaki fragments are synthesized. This will later be joined by DNA Ligase. C. There are two replication forks, each withs its own leading and lagging strand, that move away from one another in opposite directions, or bidirectionally.
When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences?
CAAT, TATA
Translation is directly dependent on all of the following associations except _______.
D) complementary base pairing between mRNA and DNA
In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts?
DNA contains phosphorus, but protein does not
Supercoiling caused by unwinding of the dsDNA molecule is relieved by what enzyme?
DNA gyrase OR topoisomerase
Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason for your choice. A: GCATTAGGGCATCCC CGTAATCCCGTAGGG B: TTAGCGTTATAGCAT AATCGCAATATCGTA
DNA molecule A, because it has a higher G-C content. Molecules B has a higher A-T content. DNA molecule A has a higher A-T content. However, G-C pairs are held together by three hydrogen bonds while A-T bonds are held together by 2 hydrogen bonds. Hence, a higher number of G-C pairs gives a double-stranded DNA a higher heat resistance.
Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction
DNA polymerase III
In biology, most information flows through which sequence?
DNA to RNA to Protein
How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?
Hersey and Chase labeled the outer protein coat of a bacteriophage with radioactive sulfur, and the inner DNA with radioactive phosphorous. After allowing the bacteriophage to infect E.coli bacterium and undergoing a heavy blender process, the empty "ghost" phages were separated from the bacteria. The infected E.coli were positive for radioactive phosphorous, indicated that DNA was the genetic material inserted from the bacteriophage. The radioactive sulfur was not present in the infected bacteria, indicating that protein was not the genetic material.
Describe the direction of information flow in living systems. Use appropriate, scientific terms in your description.
Information flow in living systems begins in DNA. DNA contains genes and these genes code for proteins. Through transcription a DNA template is encoded into an mRNA single strand. This mRNA strand is then translated into a sequnce of amino acids during translation. The sequence of amino acids then determines the specific proteins that are constructed. DNA -> RNA -> amino acids -> proteins
The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation?
It bends and partly unwinds DNA at a promoter.
Telomerase is composed of what two types of macromolecules? What is the name for such a combination?
It contains protein and RNA together, a ribonucleoprotein
Kornberg used the phage PhiX14 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Describe in sufficient detail the experimental methods that he used to draw the conclusions that DNA pol I could produce biologically active DNA.
Kornberg labled a positive (+) strand with 3H to designate it from new positive (+) strands. He then allowed the strand to replicate in heavy bromouracil with DNA polymerase I added. After replication he separated the heavy strand and the negative (-) strand and allowed replication to take place once again with the same conditions. The positive strand extracted this time was used to infect E. coli. The result of this was mature infectous phages showing the DNA pol I could prouduce active DNA.
Briefly discuss the experimental evidence for the semi-conservative replication of DNA determined by in vitro experiments in the bacteria E. coli.
Messelson and Stahl performed an experiment using 15N DNA of E.coli allowed to replicate in 14N. By performing gradient centrifugation, the different depths of the bands in the tube represented old 15N strands and new 14N strands. After one replication in the 14N medium, the tube showed one single intermediate band. This supported the semi-conservative theory in that each molecule included one old and new strand. If the conservative theory were to be supported, two bands would have been seen at either end of the tube, representing the old, heavy 15N molecule and the new, lighter 14N molecule.
The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of the following labeled components:
Phosphorous and sulfur
What are the two major components of the Tobacco Mosaic Virus?
RNA and protein
An intron is a section of
RNA that is removed during RNA processing
An intron is a section of
RNA that is removed during RNA processing.
DNA replication is semi-conservative in that
The two stands of the original helix are conserved, but they become part of separate progeny DNAs.
What experimental methods led Avery, McCarty, and Macleod to determine that DNA was the "transforming material" in their classic experiments?
This experiment started with a solution, to which a single enzyme that would degrade a component of the solution was added step by step. By process of elimination, protease eliminated protein and RNAase eliminated RNA as the possible "transformation material". This was indicated if transformation still occured after the enzyme degraded that particular component, meaning the solution was still able to transform without that material. When transformation finally did not occur after adding DNAse, the enzyme that degrades DNA, it was determined that DNA was the transforming material because without it, transformation was not observed.
During translation, chain termination is signaled by which triplets?
UGA, UAG, UAA
Transcription of the sequence AATGCGGTC would result in:
UUACGCCAG
Which is a characteristic of DNA sequences at the telomeres?
[ ] a) One strand protrudes beyond the other, creating some single-stranded DNA at the end. [x] b) all choices are correct [ ] c) They consist of cytosine and adenine nucleotides [ ] d) The consist of repeated sequences
DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide?
a ribose sugar
Which of the following statements about the genetic code are TRUE?
a) Most amino acids are encoded by more than one codon
Match with best letter choice: DNA gyrase
a. supercoil removal
In the DNA double helix,
b) a purine always pairs with a pyrimidine
Match with best letter choice: DNA primase
b. RNA primer synthesis
The basic structure of a nucleotide includes the following components:
base, sugar, and phosphate
The anticodon on the tRNA molecule:
binds to the mRNA in a complementary fashion.
In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts?
d) DNA contains phosphorus, but protein does not
In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction.
d) aminoacyl-tRNA; A; P; ribosome
Match with the best letter choice: Okazaki fragments
d. lagging strand
Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes?
double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0
Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
excision of introns
Match with the best letter choice: rolling circle replication a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication
f. unidirectional replication
Assume the following pathway: Precursor----> L ----->D------->C--------> Product Mutations for three genes (genes I, II, and III) have been isolated that interrupt this pathway. Addition of: L, D, C rescues mutations in gene III C rescues mutations in gene II D, C rescue mutations in gene I In what order do genes I, II, and III function in this pathway?
gene III, gene I, gene II
RNA differs from DNA in that it:
has uracil rather than thymine is usually single-stranded rather than double stranded has ribose sugars rather than deoxyribose sugars in its nucleotides
What chemical group is found at the 3' end of a DNA molecule?
hydroxyl group
Match with best letter choice: DNA Ligase
i. phosphodiester bonds at DNA nicks
DNA polymerase I is thought to add nucleotides
in the place of the primer RNA after it is removed
The spliceosome is a large enzyme that catalyzes removal of specific
introns in pre-mRNAs.
Which of the following two terms relates most closely to split genes?
introns, exons
This new strand of DNA has its 3' end oriented in the opposite direction as that in which the replication fork travels.
lagging strand
The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells.
less, temporarily
All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one?
mRNA
The relationship between a gene and a messenger RNA is that
mRNAs are made from genes
Short "bursts" of DNA synthesis on the lagging strand produce ___________.
okazaki fragments
What chemical group is found at the 5' end of a DNA molecule?
phosphate group
The bonds that connect nucleotides in a strand are called _________bonds.
phosphodiester
RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.
promoter
The ribosome is the primary site of:
protein synthesis
Uridine contains _____ as a sugar.
ribose
Translation of RNA into protein takes place on which cellular organelle?
ribosome
Hairpins are formed in DNA as a result of
sequences on the same strand that are inverted and complementary
Telomeres ____ the end of chromosomes.
stabilize
This term describes the sequence of nucleotides that direct the formation of a new nucleic acid strand.
template
What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli.
that protein was the genetic material in phage
Significant in the deciphering of the genetic code was the discovery of the enzyme polynucleotide phosphorylase. What was this enzyme used for?
the manufacture of synthetic RNA for cell-free systems
By their experimentation using the Neurospora fungus, Beadle and Tatum were able to propose the far-reaching hypothesis that:
the role of a specific gene is to produce a specific enzyme
The primary structure of a protein is determined by
the sequence of amino acids
DNA polymerase III adds nucleotides
to the 3' end of the RNA primer.
In prokaryotes, translation of an mRNA is coupled to
transcription
The secondary structure of a protein includes the following elements:
α-helix and β-pleated sheet.
