Quiz 3

What is the difference between a genome, chromatin, chromosomes, and chromatids?

A genome is all of the genetic information in a cell, usually stored as DNA. Chromatin is the mixture of DNA and associated protein found in the nucleus of Eukaryotic cells. The genome is stored as chromatin. Chromosomes are large segments of the genome chromatin containing a centromere, which is a region of the chromosome necessary for mitosis or meiosis. Chromatids are duplicated chromosomes that are held together by their centromeres during mitosis; sister chromatids separate into two chromosomes during anaphase of mitosis.

If you were told that the human genome contained 21% guanine nucleotides, what percentage of human nucleotides would be adenine?

If 21% is G, then C must be 21% according to Chargaff's rule. Therefore 42% is GC and the remaining 58% must be AT base pairs. Therefore adenine would be 29%.

Translate the following mRNA into a polypeptide. You may assume that the first three bases are a codon that is translated. 5' AUGGGGCGAGGAUACUAG 3'

Single letter amino acid code: MGRGYX Three letter amino acid code: Met Gly Arg Gly Tyr Stop

RNA synthesis is always 5' to 3' because:

nucleotides can only be added to an available 3'-OH group on the transcript terminus.

The spliceosome functions to:

remove non-coding introns from transcribed RNAs.

If the following template DNA sequence is transcribed by RNA polymerase, what will the RNA sequence be from 5' to 3'? DNA Template: 5' ATGCATCATGGATCT 3'

5'AGAUCCAUGAUGCAU3'

When do chromosomes with two sister chromatids become chromosomes with just one chromatid in mitosis and in meiosis?

Anaphase of mitosis and Anaphase II of mitosis

How do cell cycle check-points operate and why are they necessary during the cell cycle?

Cell cycle checkpoints are regulated by controlling the concentration of proteins called cyclins. The checkpoints ensure that a cell only divides if it has signals (growth factors) from other cells, and that it does not continue towards mitosis if the DNA is not replicated properly in S phase or is damaged.

List five of the molecules, including enzymes and other proteins, necessary for prokaryotic DNA replication.

DNA polymerase I, DNA polymerase III, DNA helicase, Topoisomerase (gyrase), single-stranded DNA binding proteins, Primase, Ligase, an RNA primer, a template, and nucleotides.

What is the Central Dogma of molecular biology, and provide an example where it is violated.

DNA à RNA à Protein It is violated with retroviruses which have a reverse transcription step RNA à DNA, retrotransposons, prions, miRNA and siRNAs.

After which checkpoint is the cell first committed to continue the cell cycle through M?

G1

A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead of the normal phenylalanine. The consequence of this for the cell will be that...

In every gene, the UUU codon will now insert a lysine into the protein into a phenylalanine. This will probably be lethal to the bacteria, since most genes will have missense mutations.

When does the number of alleles (genetic complexity) get halved in meiosis?

Meiosis I

Which type of mutations are most likely to cause a change in the phenotype of an organism and why? Choose silent, missense, and nonsense, and mutations such as insertions and deletions (indel mutations).

Most likely to change phenotype: insertions/deletions, nonsense mutation Least likely to change phenotype: silent, missense mutation

Describe why PCR does not require all the same proteins and enzymes as an E. coli cell requires to replicate a molecule of DNA.

PCR does not require DNA helicase or Topoisomerase because the high temperature of 95 ̊C will denature and separate the DNA strands. DNA primers are added to the reaction, so no Primase is needed. There is no lagging strand synthesis, so only one DNA polymerase is needed and there is no need for ligase.

What are the reasons one might have though protein rather than DNA was the hereditary molecule of the cells and what type of evidence showed that genetic information is stored in DNA, not protein?

Protein has 20 amino acids, which would be a more complex language for heredity information compared to 4 nucleotides for DNA. A bacterial transformation experiment was performed that showed killed smooth bacterial cells could kill a mouse when combined with rough living cells, unless the DNA was eliminated from the killed cells first.

How does RNA polymerase differ from DNA polymerase?

RNA polymerase creates a ribonucleic acid copy of one strand of a DNA molecule during transcription while DNA polymerase makes a deoxynucleic acid copy of a DNA molecule. In addition, DNA polymerase needs a primer made by primase, and helicase and topoisomerase to function. In contrast, RNA polymerase can make an new RNA molecule without a primer.

Use the following DNA molecule: 5' ... ATTCGTACGATCGACTGACTGACAGTC ... 3' 3' ... TAAGCATGCTAGCTGACTGACTGTCAG ... 5' If the DNA polymerase starts replicating this segment from the left side of this figure: Which will be the template for the leading strand?

bottom strand

For a new mutation to be inherited by the next generation, it must be present in what type of cell(s)?

eggs or sperm

What is Chargaff's rule? What does it tell us about DNA molecules?

in any species the number of A and T bases are equal and the number of G and C bases are equal. (SNPs don't change percentage that much, hardly at all).

Encodes the information necessary to make polypeptide chains (proteins)

mRNA

These have a role in regulating the amount of protein produced by many eukaryotic genes

miRNA

A mutation that changes a codon that specifies glycine into a codon that specifies glutamic acid is a

missense mutation

What are some of the changes associated with senescent cells?

o Damaged protein levels increase. o Protein turnover declines. o DNA damage (both somatic and mitochondrial). o Telomere shortening. o Lipofuscin deposits in cells. o Gene expression changes.

These are the major components of ribosomes, which are large macromolecular machines that guide the assembly of the amino acid chain by the mRNAs and tRNAs

rRNA

When a ribosome encounters a stop codon, what happens to terminate transcription?

special proteins recognize the stop codon and release the polypeptide from the ribosome

These are responsible for bringing the correct amino acid to the mRNA in the process of translation.

tRNA

What type of mutation occurs when DNA polymerase slips and adds repeating codons to the newly synthesized DNA strand?

tri-nucleotide expansion