Bio 151 exam 2 review

the DNA template strand is read

3' to 5'

one of the codons for the amino acid cysteine is UGU. what is the sequence of the anticodon in the tRNA that carries cysteine to the ribosome?

3'-ACA-5'

What will be the product of 3'-AUCCGAGCUAAC-5' by reverse transcriptase?

3'-GTTAGCTCGGAT-5'

If a strand of DNA has the sequence 5'-ACCGCGAAT-3', then what is the sequence of the complementary DNA strand?

3'-TGGCGCTTA-5'

A strand of DNA has the sequence 5'-ACCGCGAAT-3', transcribe this sequence into mRNA.

3'-UGGCGCUUA-5'

If a particular DNA sequence has a cytosine content of 20%, what is its adenine content?

30%

An mRNA is 30 bases long and has the following sequence. 5' - AGUGGCAUGCCACGUGGGCAAUGAUGCCGA - 3' How many amino acids long would the protein be that is translated from this mRNA?

5

An RNA transcript is synthesized in which direction?

5' to 3'

RNA polymers are synthesized

5' to 3'

the codon for methionine is ________, the anticodon is_________ the DNA code (on the template strand) is_____

5'-AUG-3', 3'UAC-5', 3'-TAC-5'

A template DNA strand contains the sequence 5'-ATGCTGAC-3'. The corresponding RNA transcript is

5'-GUCAGCAU -3'

The picture below shows a piece of double-stranded DNA. The boxes with numbers are non-coding regions. If the promoter region is located at box 1, then what are the first 12 nucleotides in the RNA transcript?

5'-UAUGCCCAAUGC-3'

You are studying a bacterial plasmid that contains 7 operons and 28 genes. How many transcriptional promoters are on this plasmid and how many stop codons?

7 promoters and 28 stop codons

translate the following mRNA transcript. the start codon is present, but the stop codon is not. 5- ACAUGAUCGGAUCGAUCCAU-3'

NH2-Methionine-isoleucine-glycine-serine-isolecine-histidine-COOH

Which of the following best describes what would happen if hydrogen bonds did not form during transcription?

RNA polymerase would not add the correct nucleotide to the growing RNA molecule.

If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen?

RNA polymerase would not be able to bind to the DNA, so no DNA would be made.

SARS-CoV-2, the virus that causes COVID-19, is an RNA virus. Which of the following steps would occur in a lung epithelial cell infected with SARS-CoV-2?

Ribosomes in the lung epithelial cells translate viral RNA into viral proteins.

promoter

a sequence of DNA that is upstream right before the gene itself

gene expression

process by which a gene produces its product and the product carries out its function

a consecutive sequence of codons following a start codons following a start codon is called the:

reading frame

5'-TGAC-3' is a sequence of nucleotides on a single strand of DNA. In this strand, the phosphodiester bond between the guanine and the adenine connects

the 3' end of the guanine to the 5' end of the adenine

in the DNA sequence 5'-ATCC-3', the phosphodiester bond between the thymine and the cytosine connects:

the 3' end of the thymine to the 5' end of cytosine

in eukaryotes, the AUG codon that starts translation is

the AUG nearest the 5' cap on the mRNA

TATA box

-A promoter DNA sequence crucial in forming the transcription initiation complex. -not the same nucleotide sequence for all genes and not something you can ever find on a DNA sequence

RNA polymerases

-are enzymes that transcribe DNA into RNA - requires a single-stranded DNA template

Identify these statements as RNA only, DNA only, both RNA and DNA, or neither RNA nor DNA. - Phosphodiester covalent bonds link nucleotides together -Most stable as a double-stranded polymer. - Contains a 5-carbon sugar. - Is shown in this diagram

-both -DNA -both -DNA

initiation in eukaryotes

-promoter region includes TATA box in many (but not all) eukaryotes - general transcription factors bind to promoter region -then RNA polymerase

elongation

-second step in transcription -DNA is unwound -RNA polymerase adds complimentary nucleotide to the RNA transcript -DNA strands rejoin -smae for prokaryotes and eukaryotes

Initiation in Prokaryotes

-sigma factor: general transcription factor that helps RNA polymerase bind to the promoter -promoter:-35 and -10 regions

Initation

-start of transcription - starts at the promoter which is a region of the DNA

Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucleotide content of the bacterial DNA. If the cytosine content of DNA from the bacterial cells is 40%, then what is the adenine content?

10%

Occasionally, a double-stranded DNA molecule contains a uracil base (U) instead of a (T). If a U were present in the template strand of DNA, what base would be incorporated into the RNA transcript at that position?

A

You have a culture of E. coli (bacteria) and you induce a mutation in the CRISPR-Cas9 process. You then compare your cells with this mutation to control cells (no mutation). Your results are shown below. Which of the following mutations best explains the results? E. coli with mutation Control E. coli Guide RNA in cytoplasm No Yes Cas9 in cytoplasm Yes Yes Guide RNA bound to Cas9 No Yes DNA bound to guide-RNA No Yes DNA cut No Yes

A mutation in the promoter region of the guide RNA that prevents its transcription.

The picture below shows translation in a eukaryote. Which of the following labels on the diagram is NOT correct? a. Location of the guanine cap b. Direction of ribosome movement c. Anticodon d. 5' end of the tRNA molecule e. Carboxyl terminus of the growing polypeptide chain

Carboxyl terminus of the growing polypeptide chain

Bordetella pertussis (whooping cough) and influenza virus are examples of respiratory pathogens. Bordetella pertussis is bacterial and influenza is a virus. Both Bordetella pertussis and the influenza virus:

Cause inflammation and coughing

In transcription, hydrogen bonds form between

Complimentary bases in DNA and RNA

In translation, hydrogen bonds form between

Complimentary bases in mRNA and tRNA]

assuming that transcription and translation both proceed from left to right, which is the correct orientation of the DNA template, the RNA transcript, and the polypeptide?

DNA template 3'.....5' RNA transcript 5'......3' polypeptide N-terminus....C-terminus

Agrobacterium tumefaciens is a naturally occurring soil bacterium which is used to create genetically modified organisms. A. tumefaciens contains a Ti plasmid with Vir genes that are used when A. tumefaciens infects plants (in natural conditions) and when it is used to transfer genes into a plant's genome (to create GMOs).You may want to look at the diagrams from class to answer this question. Put the following events in the correct order, starting with acetosyringone binds to the receptor kinase in the plasma membrane of A. tumefaciens'. I. T-DNA is cut from the bacterial plasmid.II. mRNA splicing.III. Vir G initiates transcription of VirB-VirF.IV. The receptor phosphorylates Vir G.V. Transcription occurs in the nucleus of the plant cell.

IV, III, I, V, II

If the sequence of an mRNA is3' - GCGAGUGCAUGCGCAUUAUAACCCAGUGACGUAAAAAAA - 5' then what is the sequence of the polypeptide that would be translated from the mRNA?

Methionine-Glutamine

Which of the following describes where a poly-A sequence is added to the RNA transcript?

It is added 3'-end of a transcript. This occurs in the nucleus.

Human T- cell leukemia virus type 1 (HTLV-1) occurs when a person is infected by the human T-cell leukemia retrovirus. It was the first retrovirus to be shown to cause cancer. Which of the following proteins are likely to be coded by the viral genome? Reverse transcriptase

Likely to be coded by the viral genome

Use the double-stranded DNA molecule below to answer the following questions. the first pair of nucleotides (bolded) contains the start point of transcription (so the first nucleotide after the promoter this nucleotide is transcribed) 5'-ATGTCAGGTACGCCACAT-3' 3'-TACAGTCCATGCGGTGTA-'5 which of the following is the correct polypeptide assembled by the translation of the mRNA produced by the transcription of this DNA molecule

NH2-met-ser-gly-thr-pro-his-COOH

If you mutate the promoter sequence in the DNA so that RNA polymerase cannot bind, then what would happen to the RNA?

No RNA would be made.

Human T- cell leukemia virus type 1 (HTLV-1) occurs when a person is infected by the human T-cell leukemia retrovirus. It was the first retrovirus to be shown to cause cancer. Which of the following proteins are likely to be coded by the viral genome? Ribosomal RNA

Not likely to be coded by the viral genome

Since the two strands of the DNA molecule are complementary, for any given gene

Only one strand actually carries the genetic code for a particular gene.

Since the two strands of the DNA molecule are complementary, for any given gene:

Only one strand actually carries the genetic code for a particular gene.

____________________ link RNA nucleotides together in a molecule of mRNA.

Phosphodiester bonds

The CRISPR-Cas9 process occurs naturally in --------viruses and it works analogously to our -------- immune response. --------- of the guide RNA from the CRISPR locus of the genome leads to activation of the ---------which then cuts the viral DNA.

The CRISPR-Cas9 process occurs naturally in [prokaryotes] and it works analogously to our [adaptive] immune response. [Transcription] of the guide RNA from the CRISPR locus of the genome leads to activation of the [Cas9 enzyme] which then cuts the viral DNA.

Agrobacterium tumefaciens is a naturally occurring soil bacterium which is used to create genetically modified organisms. A. tumefaciens contains a Ti plasmid with Vir genes that are used when A. tumefaciens infects plants (in natural conditions) and when it is used to transfer genes into a plant's genome (to create GMOs). You may want to look at the diagrams from class to answer this question. What would happen if ubiquitin-dependent proteolysis acted on VirG before it was able to initiate transcription of Vir B-F?

The T-DNA would not be cut out from the plasmid.

You are studying the antiviral drug Remdesivir to determine how well it can be used to treat Ebola (a single stranded RNA virus) You have host cells infected with Ebola. You treat half of the cells with Remdesivir and the other half are control cells. You obtain the following results. Which step in the viral life cycle does Remdesivir inhibit? Remdesivir Control Viral RNA in host cells Yes Yes RNA-dependent RNA-polymerase present Yes Yes RNA polymerase active Yes Yes Ribosome active Yes Yes Viral RNA replicated No Yes Virus released from host cel lNo Yes

The activity of RNA-dependent RNA-polymerase

The coding regions of a gene for the enzyme amylase is 102 nucleotides long, including both start and stop codons. Which of the following would be the most likely effect of a single nucleotide deletion at position 76 in the coding region.

There would be changes in only the last 8 amino acids.

An intron contains the codon 5'-UAA-3'. What does this codon do?

This codon is not read because the intron is spliced out prior to translation.

Why does the promoter region of DNA consist of mostly adenines and thymines?

This is the region for initial separation of DNA strands and A-T base pairs are easier to separate than G-C base pairs.

Failure to remove an intron from the pre-mRNA transcript.

This would NOT prevent translation.

A mutation in amino-acyl tRNA synthase, the enzyme that attached amino acids to tRNAs, to charge tRNAs with amino acids.

This would prevent translation

Failure to transport the processed mRNA from the nucleus to the cytoplasm.

This would prevent translation.

You work as research assistant in a lab that studies molecular evolution. Your supervisor gave you 4 tubes to analyze. Unfortunately, you didn't label the tubes. But you know that you have one test tube each of mouse RNA, yeast DNA, cypovirus RNA (double-stranded RNA), and bidnaviruse DNA (single-stranded DNA). You measure the nucleic acid composition of each test tube and realize that you can use your results to figure out which sample is which. Identify the contents of each tube.

Tube 1 is [yeast DNA] Tube 2 is [cypovirus (double‑stranded RNA)] Tube 3 is [bidnavirus (single stranded DNA)] Tube 4 is [mouse RNA]

which of codons are capable of termination translation?

UAG,UAA,UGA

Which of the following statements best describes how vaccines work?

Vaccines generate a population of "memory cells" that have the specific antibody to the disease.

Human T- cell leukemia virus type 1 (HTLV-1) occurs when a person is infected by the human T-cell leukemia retrovirus. It was the first retrovirus to be shown to cause cancer. Which of the following proteins are likely to be coded by the viral genome? Cyclin-dependent kinase inhibitors

[Not likely to be coded by the viral genome

phosphodiester bond

a chemical bond of the kind joining successive sugar molecules in a ploynucleotide

transcription

controlled separately for each gene making RNA from a DNA template: 1. initiation 2. elongation 3. termination 4. RNA processing- eukaryotes only

in prokaryotes, transcription takes place in the

cytoplasm

5'GCGCGTCGGTACA'3 is a DNA template. GCAGCC is the RNA sequence that has been transcribed (notice that the 5' and 3' ends of the RNA have not been indicated). which base will be added next to the growing RNA molecule?

cytosine

Phagocytes use antibodies to detect pathogens.

false

RNA polymerase moves along the template DNA in the 5' to the 3' direction.

false

The 3' end of the RNA molecule is produced first

false

true or false:For both prokaryotes and eukaryotes, the ribosome recognizes the 5'cap of the mRNA.

false

a segment of DNA has two restriction sites-I and II. when incubated with restriction enzymes I and II, three fragments will be formed- a,b, and c. which of the following gels produced by electrophoresis would represent the separation and identity of these fragments?

gel b

5'-GGC-3' specifies amino acid

glycine

in a eukaryotic cell, where are transcription factors active (doing their job)?

in the nucleus

A mutation occurs in a gene that codes for a kinase. You do an experiment to determine whether the mutant kinase still has kinase activity and it does not. Which types of mutations could have caused this? (The correct answer should contain all of the possible mutations that could have caused this.)

missense, nonsense and frameshift mutations

is the promoter transcribed durning transcription?

no

List gene, genome and nucleotide in order from smallest to largest.

nucleotide, gene, genome

DNA and RNA are both formed from what?

nucleotides, but the nucleotide structures are not identical

in eukaryotes, transcription takes place in the

nucleus

During transcription of a particular gene, RNA polymerase will transcribe

only one of the DNA strands, moving in a 3' to 5' direction along the template.

5'-uuc-3' specifies amino acid

phenylalanine

making the __________ requires energy. this energy comes from breaking the of the two __________ on the incoming ______

phosphodister bonds, phosphate groups, nucleotide

A molecule of pre-mRNA has four exons and three introns. Which of the following are possible combinations of the exons? Assume that the order they are written is the order that they will be in the mRNA. Exon 1, Exon 2, Exon 3, Exon 4 Intron 1, Exon 1, Intron 2, Exon 2, Intron 3, Exon 3, Intron 4, Exon 4 Exon 1, Exon 3, Exon 4 Exon 4, Exon 1, Exon 2, Exon 3

possible, not possible, possible, not possible

antibiotic have been very useful in elucidation the steps of protein synthesis. if artificially produce the mRNA sequence: AUGUCCUCCUCCUCC..., it will produce the polypeptide: Met-see-ser-ser.... a ner antibiotic blocks protein synthesis. when you mix this antibiotic with your artificial mRNA, the polypeptide produced is just two amino acids long, met-see rather than met-ser-ser-ser..... which step of protein synthesis does this antibiotic block?

the antibiotic prevents the ribosome from moving along the mRNA/prevents the mRNA from moving through ribosome.

true statement about translation in eukaryotes is correct?

the ribosome recognizes the 5' cap and then begins scanning for the first AUG triplet

what occurs in the P site of the ribosome during translation?

the tRNA carrying the growing polypeptide moves to this site as the ribosome slides to the next codon

A typical antibody molecule is Y-shaped, with two identical antigen-binding sites at the tips of the Y.

true

An RNA polymerase must first bind to a promoter sequence before transcription can begin

true

true or false: Hydrogen bonds form between the anticodon of the tRNA and the codon of the mRNA

true

true or false: When the mRNA codon "UAA" reaches the A site in the ribosome, there is no tRNA to bind in the ribosome.

true