Bio 215 Final Exam Pre-Flight Questions

Pataasin ang iyong marka sa homework at exams ngayon gamit ang Quizwiz!

a(n) ________ is the contractile unit of skeletal muscle

sarcomere

the hydrocarbon chains of ________ are not kinked, & thus pack closely together, making animals fats solid at room temp.

saturated fatty acid

________ productivity of an ecosystem is the amount of chemical energy in food converted to new biomass in various consumers during a given period of time

secondary

what part of the immune system do vaccines help build?

secondary immune response

each different protein is unique due to its

sequence of amino acids

cells communicate w/ 1 another via ______

signal transduction pathways

if a strand of DNA has the sequence GACTTA, transcription will result in a(n) ______

single RNA strand w/ the sequence CUGAAU

gel electrophoresis separates pieces of DNA based on __________

size

which organ is the primary location for nutrient absorption?

small intestine

process that gives rise to new species is called

speciation

protein digestion begins in the

stomach

the branched structure in your lungs provides high surface area over which a very high volume of air may pass

structure and function

What name is given to the reactants in an enzymatically catalyzed reaction?

substrate

The ultimate energy source that supports most life on Earth is _____.

sunlight

Ecologists represent life table data graphically in a __________.

survivorship curve

which part of the peripheral system involuntarily prepares your body for intense energy consuming activities?

sympathetic

what part of a neuron relays signals from 1 neuron to another neuron or to an effector?

synaptic terminal

changing weather patterns and water levels has increased the range of several species of disease-causing mosquitos bringing illness to parts of the world not previously affected by disease

systems

what are the 2 common alleles for the TAS2R38 gene?

taster, non-taster

hypothesis

tentative answer to a question

Body's 1st line of defense against infection.

obstacles such as skin & mucous membranes

evolutionary adaptation may not save long-lived species, such as polar bears, from extinction b/c _____

of rapid habitat loss

the lac operon is usually in the _____ position & is activated by ______

off..... lactose

incomplete dominance is a condition in plants & ppl where _____

offspring have an appearance in b/t the phenotypes of 2 parents

the energy flow through the trophic levels of an ecosystem is represented as a pyramid b/c

only about 10% of the energy at each trophic level is available at the next level

in bacteria, what name is given to a cluster of genes w/ related functions, along w/ their DNA control sequences?

operon

consists of 2 or more specialized tissues working to perform a specific function

organ

which of the following levels of structure encompasses all the others?

organism (trumps tissue & organ)

which disease impairs the function of the skeletal system by making bones thinner & more porous?

osteoporosis

the final electron acceptor of aerobic respiration is ______

oxygen

which organ makes digestive enzymes for use in the small intestine?

pancreas

fungi are decomposers that breakdown waste & the remains of dead organisms, changing complex molecules into simple nutrients making nutrients available for plants to take up from the soil

pathways & transformation of energy and matter

what kinds of cells engulf whatever foreign cells & molecules they encounter & recognize?

phagocytic cells

__________ are a major component of cell membranes. they form a bilayer w/ their hydrophobic tails mingling together & their hydrophilic heads facing the watery environment on both sides of the membrane

phospholipids

___________ are the major lipids of plasma membranes

phospholipids

mitochondria, the sites of cellular respiration, are found in ______

plant & animal cells

if 1 strand of DNA double helix has the sequence ATCCGA, what's the sequence of the other strand?

TAGGCT

STR analysis is a DNA profiling technique that makes use of the fact that different people have

different #'s of repeats of short DNA sequences at certain sites in the genome

Although all of the cells in your body contain a complete set of DNA, different types of cells arise because

different genes are switched on & off in each type of cell

how do oxygen & carbon dioxide cross from the alveoli through the capillary walls & into the blood?

diffusion

if an organism has 2 non-identical versions of a gene, the 1 that's expressed in the organism is called the _______ allele

dominant

"sticky ends" are _____ that are produced by the action of ______

double-stranded DNA molecules w/ single-stranded ends; restriction enzymes

New molecules of DNA are synthesized by copying the genetic sequence of another molecule of DNA, which we call the template, so that __________.

during cell division daughter cells are genetically identical to the mother cell

after DNA replication, ________

each new DNA double helix consists of one old strand and one new strand

according to the principle of interspecific competition, 2 species can't continue to occupy the same _____

ecological niche

______ the science that studies the interactions b/t organisms & their environments

ecology

a(n) ______ consists of all the abiotic & biotic factors in an area

ecosystem

the plasma membrane forms a pocket that pinches inward, forming a vesicle that contains material from outside the cell. this describes the process of

endocytosis

which organelles comprise the endomembrane system of a cell?

endoplasmic reticulum, golgi apparatus, lysosome

negative feedback is a method of homeostatic control taht

ensures that conditions in an organism don't vary too much above or below their set pts

which of these human characteristics evolved 1st based on the fossil record?

erect posture

a major difference b/t prokaryotic & eukaryotic cells is that __________

eukaryotic cells have membrane-bound organelles; prokaryotic cells do not

all mammals have hair and produce milk through mammary glands. we would expect such similar characteristics in all mammals descended from a common ancestor

evolution

which is TRUE about evolution?

evolution explains how life has changed over time

to measure primary productivity

exclude consumers; periodically mow, collect, & weigh the plants; & calculate plant biomass production per unit time

when DNA copies are multiplied at a rapid rate, this is referred to as _________ amplification

exponential

a molecule moves down its concentration gradient using a transport protein in the plasma membrane

facilitated diffusion

what is the name of the process in which pyruvic acid is converted lactic acid?

fermentation

What does 2pq represent?

frequency of heterozygotes

where does most of a plant's biomass come from?

from CO2 from the air & H2O from the soil

most of the ATP production during cellular respiration occurs ______

from activity of the ATP synthase machine

which of the following is a monosaccharide?

fructose

which results from disruptive selection?

garter snakes w/ different coloration patterns behave differently when threatened

evolution that occurs by ______ results in a change in a population's gene pool due to the movement of individuals into & out of the population

gene flow

homeotic genes are best described as ______

genes that regulate groups of other genes, which, in turn, what body parts will develop in which locations

evolution that occurs by ______ results in a change in a population's gene pool due to chance

genetic drift

crossing over during meiosis I results in _____

genetic recombination

which method do you think would be best to test effectiveness of a vaccine intended for human use against avian influenza?

give the vaccine to a group of humans that have the virus & give a placebo to another group of humans who have the virus. assess whether influenza symptoms develop in either group.

which hormone signals the breakdown of glycogen in the liver increasing glucose in the blood?

glucagon

a fat molecule is composed of two types of smaller molecules: ______ and fatty acids

glycerol

________ measure of the total energy captured

gross productivity

A cell that completed the cell cycle without undergoing cytokinesis would ______.

have 2 nuclei

1 of the critical aspects of Watson & Crick's discovery of the structure of DNA was that it _____

helped explain how DNA molecules can be copied to produce identical DNA molecules

What acid is responsible for stomach acidity?

hydrochloric acid

unlike the citric acid cycle & electron transport, glycolysis occurs ______

in the cytoplasm

what did Jonas Salk's polio vaccine experiment find?

inactivated viruses can be used as vaccines

what is a response of our innate defense system?

inflammation

DNA in your cells is used to code for proteins that control cell processes such as hormone production

information flow, exchange, & storage

your DNA codes for the creation of insulin (protein) in pancreatic cells used to help regulate blood sugar in the body. you inherited this code from your parents and will pass the code on to your kids.

information flow, exchange, and storage

which of the following would be an example of paedomorphosis?

insects that can reproduce in larval stages w/out reaching mature development stages

which hormone signals the uptake of glucose reducing glucose in the blood?

insulin

A combination of biological, chemical, and cultural methods for sustainable control of agricultural pests is called

integrated pest management

as global climate changes, green sea turtles alter many aspects of their behavior

interactions with biological systems

During _____ the cell grows and replicates both its organelles and its chromosomes.

interphase

the cells that result from the mitotic cell cycle can be described as _______

2 cells, each w/ the same amount of genetic material & same genetic info

which of the following arguments pose a credible challenge to A.V. Hill's conclusions about the effect of lactic acid on muscle fatigue?

more recent experiments demonstrate that the Hill effect doesn't occur at human body temps.

where does carbohydrate digestion begin?

mouth

muscle structures in correct order from largest to smallest

muscle muscle fibers myofibrils sarcomeres thick & thin filaments

What kinds of (somatic) cell gene mutations can frequently lead to the first stages of cancer?

mutations in genes that regulate cell division

a thick filament is made up of

myosin

in gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel

negative..... positive

the fundamental cell type that conducts an action potential in the nervous system is a(n)

neuron

which of the following is used to define a phenotypic characteristic resulting from the expression of 2 or more genes?

polygenic inheritance

starch is a _______ and its function is _________

polymer; energy storage in plants

A group of snails (of the same species) lives in a garden that also includes beetles and tomato plants. What level(s) of ecological organization does the group of snails belong to?

population

a(n) ______ is a group of individuals of the same species living in a particular geographic area

population

chemical energy is a form of ______ energy

potential

what form of energy is ATP?

potential

A nerve poison that blocked neurotransmitter receptors on the dendrites would __________.

prevent transmission across the synaptic cleft

1 difference b/t mitosis & meiosis is that mitosis

produces cells genetically identical to the parent cell, but meiosis doesn't

a secondary immune response differs from a primary immune response in that the secondary response _______.

produces memory cells

most enzymes are _______

proteins

molecules of life

proteins lipids nucleic acids carbohydrates

transitional fossils support evolutionary theory by

providing evidence of how 2 structurally different species are connected on the phylogenetic tree

if an organism has 2 non-identical versions of a gene, the 1 that's not expressed in the organism is called the _______ allele

recessive

when 2 frog species, Rana pipiens & Rana sylvatica, mate, the offspring die early in embryonic development. this is an example of ______

reduced hybrid viability

Enzymes work by _____.

reducing activation energy

biodiversity hot spots are

regions with the potential for high levels of extinction

which of the following turns off transcription by binding to the operator?

repressor

To make restriction fragments, a DNA sample is treated with ______.

restriction enzymes

which of the kinds of proteins circulates in the blood & coats the surfaces of microbes to make them more susceptible to engulfment by phagocytic cells?

B cell receptor histamine ???????

a major function of natural killer cells is to _______.

attack virus-infected cells

which of the following is a characteristic of ONLY RNA?

uracil base

when the immune system improperly turns against the body's own molecules, the result is _____.

autoimmune disease

a change in allele frequencies in a population over a span of generations is _________

microevolution

in bacterium, where are proteins synthesized?

mitochondrion

which is an accurate statement regarding human evolution?

- 1st humans evolved in Africa - fossil record contains creatures w/ features that are intermediate b/t those of modern humans & quadrepedal apes - in the latest phase of human evolution, there has been a greater reliance on culture

single nucleotide polymorphisms (SNPs)

- SNPs in the TAS2R38 gene have been associated w/ impaired bitter taste perception - they're the most common type of genetic variation among ppl - each SNP represents a difference in a single DNA building block (nucleotide)

which traits can be used to differentiate humans from our closest living primate relatives?

- bipedality (ability to walk exclusively on 2 legs) - large brain size - extensive tool use

cellular respiration accomplishes two major processes:

1. breaks glucose down into smaller molecules 2. harvests the chemical energy released & stores it in ATP molecules

What are the 3 steps of PCR?

1. denature DNA 2. anneal primers 3. extend DNA

order of the general steps of digestion

1. ingestion 2. digestion 3. absorption 4. elimination

role of the lymphatic system

1. return tissue fluid to the circulatory system 2. fight infection

A young, growing calf kept in ideal conditions consumes 100 pounds of grain. As a result, you would expect the calf to put on about _____ pounds of biomass.

10-15

for a species w/ 4 pairs of chromosomes, ________ chromosome combos are possible during independent assortment

16

if guanine makes up 30% of the bases in a DNA double helix, what % of the bases is adenine?

20%

if the wet mass of 10 plants is 25 g & the dry mass of these plants is 5 g, what's the percent biomass?

20%

Hindlll is a restriction enzyme that cuts the DNA sequence AAGCTT b/t the 2 A bases. how many times would Hindlll cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

2x

How many nucleotides make up a codon?

3

what chromosomes belong to a typical human male?

44 autosomes, one X chromosome, and one Y chromosome

herd immunity fails when _____ percent of the population is NOT vaccinated?

5%

attached earlobes are recessive to free earlobes. what's the probability of having a child w/ attached earlobes when an individual w/ attached earlobes mates w/ an individual heterozygous for free earlobes?

50%

Which of these equations best summarizes photosynthesis?

6CO2 + 6H2O --> C6H12O6 + 6O2

what 2 molecules are produced by the light reactions & used to power the Calvin cycle?

ATP & NADPH

Which option properly summarizes the inputs and outputs of the Calvin cycle?

ATP + NADPH + 3CO2 --> G3P

which best describes an artery?

Arteries carry blood away from the heart.

the dominant greenhouse gas is _____

CO2

the tRNA anticodon, GAC, is complementary to the mRNA codon w/ the sequence _______

CUG

what evidence supports the hypothesis of interbreeding b/t Neanderthals & Homo sapiens?

DNA analysis shows that about 2% of the genomes of most modern humans came from Neanderthals

in humans, the presence or absence of dimples is a trait controlled by a single gene. what's the genotypes of an individual who's heterozygous for dimples?

Dd

a glucose molecule is completely broken down upon completion of glycolysis & the citric acid cycle. however, these 2 processes yield only a few ATPs. what other energy carrier(s) that can be used to synthesize more ATPs is/are also generated during these processes?

NADH & FADH2

which of the following enzymes is responsible for RNA synthesis?

RNA polymerase

Translation converts the information stored in ______ to ______.

RNA; a protein

chromosomes that don't determine the sex of an individual are called

autosomes

A nerve impulse moves away from a neuron's cell body along _____.

axons

which of the following would indicate a base pairing mutation in DNA?

a G paired w/ a T

Kudzu, an Asian vine introduced to the United States in the 1930s as a means to control erosion, is referred to as "the plant that ate the South" because it grows so fast and overtakes most plant species in its path. A recent and unusual way that some people are using to control kudzu growth is to allow goats to graze their land and eat the kudzu, roots and all. This is considered by some to be the most environment-friendly way to eliminate this invasive vine. How can we best describe the goats in this situation?

a biological control agent

which anatomical features of the 3.2 mil-yr-old Australopithecus fossil known as "Lucy" suggest she was a bipedal hominid?

a much shorter hip bone that's broader from the front to back & wraps around the side

which describes allopatric speciation?

a population of squirrels is separated by the Grand Canyon. the 2 subpopulations evolve into 2 distinct species

a reproductive barrier that prevents individuals from closely related species from interbreeding is an example of

a prezygotic barrier

maria has a nut allergy & accidentally ate some pine nuts in her salad. almost immediately, she went into anaphylactic shock, but was quickly & completely recovered. what treatment option was the best for Maria & why?

a treatment that would have decreased the amount of histamine in her blood so that her blood vessels could constrict & raise her blood pressure.

Older fossils usually __________.

are found in the deepest strata

what plays a role in the regulation of transcription in both prokaryotic & eukaryotic cells?

attachment of RNA polymerase to the promoter

a thin filament is made up of

actin

which is true about the respiratory system?

air sacs called alveoli provide a higher surface area for the exchange of gases

b/c of plate tectonics, about 250 million years ago _______

all the landmasses were united in 1 supercontinent

Most human genes come in alternate versions called

alleles

monomers from which large proteins are constructed

amino acids

the biological species concept can't be applied to fossils. which alternate approach to identifying species would be most useful for classifying fossil organisms?

an approach based on measurable physical traits

what's the best definition of a genetically modified organism?

an organism carrying a gene that was acquired by artificial means

The wing of a penguin is ______ the wing of a butterfly.

analogous to

which supports the conclusion that the common ancestor of modern chimps & modern humans lived around 7 mil. yrs ago?

analysis of modern human & modern chimp protein & DNA sequences suggests that their lineages diverged about 7 mil. yrs ago

a substance that can elicit an immune response from a lymphocyte is called a(n) ______

antigen

which is a biotic component of an environment?

bacteria on the surface of the skin

which is NOT a sensory receptor?

balancereceptor (out of thermoreceptor, photoreceptor, or chemoreceptor)

Horned lizards are desert animals that are active during the day. Their skin and kidneys are efficient at conserving water; when they get hot, they move to the shade so they can cool off. This describes _____ adaptation to the hot and dry desert.

behavioral & physiological

what type of reproductive isolating mechanism is described by a situation in which female fireflies mate only w/ males who emit light in a particular pattern?

behavioral isolation

a correct comparison b/t a benign & a malignant tumor is that ______

benign tumors don't metastasize; malignant tumors do

______ is secreted by the ________ & acts to emulsify ______ in the ___________

bile.... liver... fats...... small intestine

The intentional release of a natural enemy to attack a pest population is called ________.

biological control

The use of living organisms to detoxify and restore polluted and degraded ecosystems

bioremediation

when you go outside, it's common to hear a variety of bird songs. these songs vary among bird species as well as bird flocks. some bird species that are highly unrelated have very similar song qualities. what can you conclude from this?

bird songs are analogous traits

what do DNA & RNA have in common?

both are composed of nucleotides

in what ways are the internal structures of lungs & intestines similar?

both have a moist lining of cell surfaces & a surface w/ many branches or infoldings for high surface area

how do scientists know that the hominid called "Ardi" is about 4.4 mil yrs old?

by using radiometric dating techniques on the volcanic deposits found above & below the layer containing Ardi

the 2nd-leading cause of death in most developed countries is ______

cancer

an individual who is homozygous _______

carries 2 copies of the same allele for a gene

homologous chromosomes _______

carry genes controlling the same inherited characteristics

anaphylactic shock

causes blood pressure to drop dangerously

A neuron's nucleus is located in its _____.

cell body

which of the following is a function of the cell cycle that, in eukaryotes, involves mitosis?

cell replacement

what is the natural substrate of the enzyme used in the lab?

cellobiose

in your body, what process converts the chemical energy found in glucose into the chemical energy found in ATP?

cellular respiration

Maintaining biodiversity on Earth is important because __________.

changes that underlie a loss of biodiversity may also threaten the human population

Characid fishes are found naturally only in South America and Africa. Fossils of these fish are not found on any other continents. What is the most likely explanation of this distribution pattern?

characid fishes arose prior to the separation of the African & South American continents

what are the 3 organelles that plant cells have but animal cells don't?

chloroplast, central vacuole, cell wall

an approach to systematics in which organisms are grouped by common ancestry is called _______

cladistics

which taxonomic level is most inclusive?

class

The similarity of the embryos of fish, frogs, birds, and humans is evidence of ______.

common ancestry

all the organisms in a particular area make up a(n)

community

theory

comprehensive explanation of natural phenomena supported by abundant evidence

The study and protection of biological diversity is a field called __________.

conservation biology

analogous structures are evidence of _______

convergent evolution

restriction enzymes ___________

cut DNA at specific nucleotide sequences

which of the following is NOT a result of nondisjunction?

cystic fibrosis

A nerve impulse moves toward a neuron's cell body along _____.

dendrites

human activity, especially ______, significantly alters the amount of atmospheric water vapor available for the water cycle

destruction of tropical rain forests

a non-native species that has spread far beyond the original pt. of introduction & causes environmental or economic damage is called a(n)

invasive species

habitat destruction, & thus habitat fragmentation, is the major cause of declining biodiversity; the 2nd major cause is

invasive species

the founder effect differs from a population bottleneck in that the founder effect

involves the isolation of a small colony of individuals from a larger population

during cellular respiration, the energy in glucose _____

is used to manufacture ATP molecules

which of the following is NOT true about Taq DNA polymerase used in PCR?

it can act as an exonuclease to cut single-stranded DNA

which best describes the function of a human left ventricle?

it pumps oxygenated blood around the body via systemic circulation

which best describes "deoxygenated" blood?

it's lost some of its oxygen to the body's tissues

what makes the skeleton so versatile in function?

joints

Organisms from the same phylum all belong to the same __________.

kingdom

what would you assume if you found RNA transcripts of lactose-utilizing genes w/in E. coli?

lactose is present in the cell

A set of traits that affects a species' schedule of reproduction and survival is called its __________.

life history

which structure holds bones together at joints?

ligaments

If you have a population growth curve that shows a decrease in the growth rate as the population size approaches carrying capacity, you would say that population is exhibiting __________.

logistic population growth

transcription is the _______

manufacture of a strand of RNA complementary to a strand of DNA

estuaries are considered examples of ______

marine biomes

why's it incorrect to assume that mass extinctions carry only negative impact on the evolution of life on earth?

mass extinctions are sometimes followed by periods of evolutionary change when other organism groups can flourish & expand in diversity & size

how does mechanical digestion differ from chemical digestion?

mechanical breaks food into smaller pieces

which statement about skulls is true?

the 2nd skull represented a species more closely related to modern humans than the 1st skull's species

how will you be able to determine the amount of product that's produced at each time period?

the artificial substrate produces a product that turns yellow in a basic solution

_________ defines species as a group of populations whose members have the potential to interbreed w/ 1 another & produce fertile offspring

the biological species concept

Why do toxins accumulate at such high levels in carnivores?

the biomass at any given trophic level is accumulated from a much larger toxin-containing biomass ingested from the level below

which results from stabilizing selection?

the birth weight at which newborn humans are most likely to survive & the avg weight of newborn humans are about the same

the immune system is capable of mounting specific responses to particular microorganisms b/c _______.

the body contains an enormous diversity of B & T cells, each w/ a specific kind of antigen receptor

By the end of _____, the breakdown of glucose is complete; most ATP molecules are produced during _____.

the citric acid cycle; electron transport

which is an example of negative feedback?

the end product of a reaction sequence shuts down the reaction sequence

why is an enzyme's shape important to its function?

the enzyme's active site needs to be the right shape so the substrate can fit properly

genetic variation is accomplished by all but 1 of the following. choose the EXCEPTION

the events of meiosis II

homeostasis is the

the maintenance of a relatively constant internal environment

During _____ both the contents of the nucleus and the cytoplasm are divided.

the mitotic phase

The information carried by a DNA molecule is in _____.

the order of the nucleotides in the molecule

hemoglobin as an iron containing protein that binds to oxygen

true

According to the logistic growth model, the fastest growth rate of a population occurs when

the population size is at roughly half the carrying capacity of the habitat

which is a part of the pulmonary circuit?

the pulmonary artery carrying blood to the lungs

which results from directional selection?

there's an increase in antibiotic-resistant strains of bacteria

what best explains the observation that enzymes are selective in the reactions they catalyze?

there's precise compatibility b/t an enzyme's active site & the substrate molecule

Plants are photosynthetic autotrophs. What does this mean?

they use light energy to drive the synthesis of organic molecules

which correctly describes the sliding filament model of muscle contraction?

thick & thin filaments slide past each other w/out changing length

a fungal disease called wheat stem rust is devastating 75% of the wheat varieties planted worldwide. in what way might biodiversity help solve this problem?

through crossbreeding or genetic engineering, researchers might be able to incorporate fungal resistance genes from wild relatives of wheat into susceptible wheat varieties

the light reactions take place in the _______ & the Calvin cycle takes place in the ________

thylakoids; stroma

what's the main function of the CRISPR-Cas9 system?

to alter the nucleotide sequences of specific genes in a living cell

ATP drives work in cells by

transferring its phosphate group to other cell molecules

which about blood circulation in humans is true?

valves prevent the backflow of blood into the atria & ventricles

terrestrial ecosystems are grouped into biomes primarily on the basis of _____

vegetation type

_______ the source of the oxygen gas released as part of photosynthesis

water

the light reactions of photosynthesis use ______ & produce ______

water.... NADPH

An organism's "trophic level" refers to _____.

what it eats


Kaugnay na mga set ng pag-aaral

Claves CBVUSB: Vulcanos/Apolos II

View Set

Ch 5_NEW! Mini Sim_Consumer Behavior: Buyer Decision Process MARK3300

View Set

Exam 2 & 3 (38 and down) questions and answers

View Set

Chapter 12: Alcohol, Tobacco, and Other Drugs: A Community Concern

View Set