bio ch 18 mastering bio hw

The comparison between the number of human genes and those of other animal species has led to many conclusions, including the idea that

the number of proteins expressed by the human genome is far more than the number of its genes

bioinformatics does NOT include _____

using dna technology to combine dna from two different sources in a test tube

What are the steps in the shotgun approach to whole-genome sequencing?

1. multiple copies of the same chromosome are prepared 2. chromosome copies are broken into 1-kb fragments 3. 1-kb fragments are cloned into plasmids 4. the plasmids are sequenced 5. a computer combines the fragment sequences

Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

1. neo-X chromosome 2. ISY element 3. ISX element 4. domestication 5. chromatin entry sites 6. MSL recognition element (MRE)

Look at the pairs that are being compared in the cells with dashes. What percent identity is implied by the dashes?

100%

Drag the labels onto the table to indicate whether each patient is likely to have AML, ALL, or neither.

17: ALL 18: neither 19: ALL 20: AML

Which of the following percent identities is a good cut-off value separating within-family pairings from between-family pairings?

50%

When does exon shuffling occur?

during meiotic recombination

Which of the following statements correctly describes a multigene family?

It is made up of genes whose sequences are very similar and that probably arose by duplication.

In humans, the embryonic and fetal forms of hemoglobin have a higher affinity for oxygen than that of adults. Why is this the case?

Nonidentical genes produce different versions of globins during development

How do retrotransposons differ from other transposons?

Retrotransposons move via an RNA transcript, whereas other transposons do not.

How does the work described in this paper challenge the idea of "junk DNA"?

The authors provided multiple lines of evidence to support a model that explains how transposable elements can wire multiple genes together into a network, followed by fine tuning via mutations.

How do transposable elements contribute to genome evolution?

They carry entire genes or individual exons to new locations.

Which of the following statements correctly describes the manner in which transposons and retrotransposons are copied before they move around in a genome?

Transposons are copied as double stranded DNA first and then moved to a new location in the genome, while retrotransposons are copied first as RNA and then into DNA.

Does the order of pairs in the table above describe the same relative "closeness" of globin family members as shown in the model?

Yes. Pairs of globins at the top of the table are drawn with the closest connections in the model.

Which of the following statements most correctly describes the whole-genome shotgun approach for sequencing a genome?

cloning fragments from many copies of an entire chromosome, sequencing the fragments, and then ordering the sequences

select the correct statement(s) about genome size and density

eukaryotic genomes are larger than prokaryotic genomes

which of the following statements about genome sizes is true?

most eukaryotes have larger genomes than most prokaryotes

Which of the findings of the Human Genome Project were contrary to initial expectations? select all that apply

ninety-three percent of multi-exon human genes have alternatively spliced forms the human genome contains fewer than 21,000 genes

what is proteomics?

the study of the full protein set encoded by a genome

What was the main goal of the Human Genome Project (HGP)?

to map all the human genes and determine the nucleotide sequence of the entire human genome

What type of noncoding DNA composes the largest portion of multicellular eukaryotic genomes?

transposable elements

identify the correct statement(s) about transposable elements

transposable elements and related sequences make up 44% of the human genome

Drag the labels onto the table to identify which hypothesis is being tested in each comparison and what result you would predict.

1 v. 10: patients with high topoisomerase II expression will respond to etoposide. patient 1 6 v. 16: patients with low HOXA9 expression will survive better. patient 6 3 v. 10: patients with low HOXA9 expression will survive better. patient 10

What is the percent identity between the β (beta) and ε (epsilon) globin sequences?

76%

The figure above shows a diagram of blocks of genes on human chromosome 16 and the locations of blocks of similar genes on four chromosomes of the mouse. What does the movement of these blocks in the genomes suggest?

Chromosomal translocations have moved blocks of sequences to other chromosomes.

Which of the following genomic components can be duplicated in a genome?

DNA sequences, chromosomes, or sets of chromosomes

Notice that the cells in the lower left half of the table are blank. Why?

They represent duplicates of the comparisons in the upper right half of the table.

which of the following was a goal of the ENCODE project?

identify genes for noncoding RNAs characterize DNA and histone modifications and chromatin structure identify protein-coding genes identify sequences that regulate gene expression such as enhancers and promoters all of the answer choices are correct

In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?

GATGACATGGCGTCAGTCGATGCG

Compare and contrast the process of dosage compensation in humans and fruit flies by sorting each item to the appropriate bin.

Human (Homo sapiens): Random inactivation of one X chromosome in each cell of females, leaving one active X chromosome as in males, interaction of the X chromosome DNA with an RNA transcript from the XIST gene, formation of Barr bodies Fruit fly (Drosophila sp.): Twofold increase of gene expression on the X chromosome in males to match the level of gene expression in females, interaction of the X chromosome DNA with the male specific lethal (MSL) protein complex to alter gene expression Both: Coordinated regulation of many genes carried on one entire chromosome, epigenetic modification of histone proteins associated with X chromosomes, females have two X chromosomes; males have one X and one Y chromosome

If transposable elements like ISX can be replicated, generating multiple copies throughout the genome, why are there so few ISX elements found on the autosomes, and so many on the neo-X?

Individuals with ISX elements on autosomes would not survive because the up-regulation of gene expression by MRE elements is detrimental when it occurs on autosomes.

How has gene duplication played a critical role in evolution?

It produces redundant copies of existing genes, which are then free to mutate and adopt new functions.

The vertebrate Pax-6 gene product (the PAX-6 protein) triggers a complex program of gene expression resulting in formation of the vertebrate eye, which has a single lens. The fly Pax-6 gene leads to formation of the compound fly eye. When scientists cloned a mouse Pax-6 gene and introduced it into a fly embryo, it led to formation of the compound eye of a fly. What did scientists induce from this?

The Pax-6 genes of flies and mice arose from an ancestral gene in a common ancestor.

Humans have 23 pairs of chromosomes. By contrast, chimpanzees have 24 pairs of chromosomes and lack any pair resembling the long human chromosome 2 pair; instead, chimpanzees have two pairs of medium-sized chromosomes, each of which resembles parts of human chromosome pair 2. What is the most likely explanation for these differences and similarities in the human and chimpanzee genomes?

The common ancestor of humans and chimpanzees had 24 pairs of chromosomes, and at some point in the human lineage, two chromosomes fused end to end, providing some selective advantage.

Why is the outdated term "junk DNA" a misnomer for noncoding regions of the human genome?

The conservation of "junk DNA" sequences in diverse genomes suggests that they have important functions.

What characteristic of short tandem repeat DNA makes it useful for DNA fingerprinting?

The number of repeats varies widely from person to person or animal to animal.

Unequal crossing over during prophase I can result in one sister chromosome with a deletion and another with a duplication. A mutated form of hemoglobin, called hemoglobin Lepore, exists in the human population. Hemoglobin Lepore has a deleted series of amino acids. If this mutated form was caused by unequal crossing over, what would be an expected consequence?

There should also be persons whose hemoglobin contains two copies of the series of amino acids that is deleted in hemoglobin Lepore.

How did the authors test the hypothesis that the ISX element formed an MSL recognition element (MRE) with a strong recruitment signal for the MSL protein complex, thereby enabling ISX to function as a chromatin entry site in a living organism (in vivo)? Select all that apply

They mutated ISY to ISX by deleting the 10-basepair sequence, inserted it into an autosome of D. melanogaster, then used immunostaining to see if the MSL complex would bind. They inserted copies of ISX and ISY into an autosome of D. melanogaster and used immunostaining to see if the MSL complex would bind to them. They mutated ISX to ISY by inserting the missing 10-basepair sequence, inserted it into an autosome of D. melanogaster, then used immunostaining to see if the MSL complex would bind. They used chromatin immunoprecipitation-quantitative polymerase chain reaction to measure the affinity of the MSL complex for ISX and ISY.

What makes the work reported in this paper scientifically relevant and novel?

This paper provides evidence that a transposable element played a role in the evolution of dosage compensation in several species of Drosophila.

By what mechanism might transposons contribute to gene duplication?

Transposons may promote unequal crossing over during meiosis.

Multigene families include two or more nearly identical genes or genes sharing nearly identical sequences. A classical example is the set of genes for globin molecules, including genes on human chromosomes 11 and 16. How might identical and obviously duplicated gene sequences have gotten from one chromosome to another?

by chromosomal translocation

Which of the following procedures is required when the whole-genome shotgun approach to sequencing is carried out?

cloning randomly cut DNA fragments

Why might the cricket genome have 11 times as many base pairs as that of Drosophila melanogaster?

crickets must have more noncoding dna

A microarray known as a GeneChip, with most of the human protein-coding genetic sequences, has been developed to aid in the study of human cancer by comparing gene sequences and patterns of gene expression in cancer cells with those in normal cells. What kind of information might be gleaned from this GeneChip to aid in cancer prevention?

data that could alert patients to what kind of cancer they were likely to acquire

Several different globin genes are expressed in humans, but at different times in development. What mechanism could allow for this?

differential gene regulation over time

Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this similarity?

exon shuffling

In most eukaryotes, only about 1.5% of the genome codes for proteins. What types of sequences make up the rest of the genome?

gene-related regulatory sequences

Which of the following statements provides a correct representation of gene density?

humans have approximately 21,000 genes in 3,000 Mb

The data shown here were obtained from a DNA microarray study of gene expression patterns in 16 cancer patients. Although data for many more genes were obtained from the DNA microarray, only 12 specific genes of interest are shown. The data in the chart are color-coded as indicated by the key that appears below the chart. Red represents high relative gene expression and blue represents low relative gene expression. Which of the following conclusions do the data support? Select all that apply.

if you were given microarray data from the cells of a new patient belonging to either Group I or Group II, you would probably be able to tell which group the patient belongs to a different set of genes is transcribed in cells from patients in Group I compared to cells from patients in Group II for some genes, there is variation in the amount of mRNA present, even among patients in the same group

What is metagenomics?

sequencing DNA from a group of species from the same ecosystem

The figure above shows a diagram of blocks of genes on human chromosome 16 and the locations of blocks of similar genes on four chromosomes of the mouse. Which of the following descriptions represents another example of the same phenomenon that is responsible for the rearrangements depicted in the figure above?

the apparent fusion between two chromosome pairs of primates such as chimpanzees to form the ancestor of human chromosome 2

what is bioinformatics?

the application of computational methods to the storage and analysis of biological data

the number of genes correlates with ____

the size of the genome in prokaryotes

how do transposons differ from retrotransposons?

transposons move by means of a dna intermediate, whereas retrotransposons move by means of an rna intermediate transposons may or may not leave a copy behind at the original site, whereas retrotransposons always leave a coy behind at the original site

The more recently that two genes arose from a single duplicated gene, the more identical their nucleotides are, which results in few amino acid differences in the protein products. Based on that premise, identify which two globin genes are the most recently duplicated. What is the percent amino acid identity between them?

α1 and α2, with 100% amino acid identity

Which two globin genes are most divergent from each other? What is the percent amino acid identity between them?

β and ζ, with 38% amino acid identity