bio chapters 4-6

Based on what you know of ATP's chemistry, which of the substances is most likely to have similar functions in energy-management processes?

guanosine nucleotide triphosphate

ATP is a good energy currency for cells because it has a(n) _____ amount of Gibbs free energy.

intermediate

In a metabolic pathway, a series of enzymatic reactions catalyzes the conversion of molecule A to molecule E. Several intermediate steps are involved in which the product of one reaction becomes the substrate for the next. The graph illustrates the changes of free energy that occur at each step in the pathway. Overall, this _____, based on the changes in free energy that take place as A is converted to E.

is an anabolic pathway

A biologist working in a lab adds a compound to a solution that contains an enzyme and substrate. This particular compound binds reversibly to the enzyme at the active site. Once the compound is bound to the enzyme, the catalysis of substrate to product stops. Which of the statements is true of the compound?

The effect of the compound can be overcome by adding more substrate.

A cell has a mutation that prevents it from breaking down unwanted proteins present in vesicles. Which cellular structure is most likely to be disrupted by this mutation?

lysosomes

RNA molecules are transported from the nucleus to the cytoplasm in eukaryotes through:

nuclear pores.

Which choice is considered an integral membrane protein?

a protein with its amino-terminus in the cytoplasm and its carboxy-terminus in the extracellular space

Imagine you are following a particular tRNA, called tRNAQ, through the process of translation in a eukaryote. In what order does tRNAQ go through the steps listed? Note that some steps may be used more than once. 1. The polypeptide is transferred to tRNAQ. 2. tRNAQ binds the A site of the ribosome. 3. tRNAQ binds the P site of the ribosome. 4. The ribosome shifts, with tRNAQ still bound. 5. tRNAQ binds the E site of the ribosome.

2, 1, 4, 3, 4, 5 The first site with which tRNAQ binds is A. After the polypeptide is transferred to tRNAQ, the ribosome shifts, and this places tRNAQ in the P site. When the ribosome moves again, uncharged tRNAQ is transferred to the E site.

An mRNA molecule has a sequence 5'—CAGAUCUAAUGCUUAUCGGAU—3'. When translated in a laboratory setting where translation can be initiated anywhere along the molecule, how many reading frames are possible?

3

how many residues separate amino acids that are stabilized by hydrogen bonds in a helices

4

Which statement is true about the presence or absence of plasma membranes?

All cells have a plasma membrane.

Which statements are true of an inhibitor that binds the active site of an enzyme? Select all that apply.

1. Adding more substrate can reduce the effect of these inhibitors. 2. These inhibitors are structurally similar to the normal substrate of an enzyme. 3. These inhibitors compete with the substrate for the active site of the enzyme.

Which of the statements represent the laws of thermodynamics? Select all that apply.

1. The amount of energy in the universe is constant. 2. The energy available to do work decreases as energy is transformed from one form to another.

Which of the statements are true? Select all that apply.

1. The energy for a reaction equals the sum of the energy in the product plus energy released as heat and disorder. 2. The amount of usable energy resulting from a reaction is always less than the total energy available at the start of the reaction.

During translation, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal sequences. Which peptides would you expect to find in the polypeptide that will eventually fold to become an ion channel protein? Select all that apply.

1. an amino-terminal signal peptide 2. a signal-anchor peptide

Which actions would affect the secondary structure of a protein?

1. breaking the hydrogen bonds between amino acids 2. changing the sequence of amino acids

A polycistronic mRNA with six protein-coding genes has:

6 start codons and 6 stop codons

You are translating an mRNA in the lab and notice that the protein produced is only two amino acids long when you were expecting a length of forty amino acids. You have checked the sequence of the mRNA and everything appears to be correct. What could be happening in your reaction?

The E (exit) site of the ribosome is not functioning.

109 bacterial cells are spread evenly on an agar surface of medium containing an antibiotic. After a few days, a few of the cells grow into small clumps of cells. Isolation of individual bacterial cells and further testing reveals that the clumps consist of mutant bacteria that are resistant to the antibiotic. Which of the statements is true?

The mutations that are resistant to the antibiotic preexisted in the original population of bacteria and were selected by the antibiotic.

You are investigating a mutant eukaryotic cell line that makes all of its mRNAs much longer than the mRNAs from normal cells. Intrigued, you examine the proteins in these cells and note that many of them are either much longer or much shorter than the normal proteins from nonmutant cells. Assuming there is just one mutant defect in these cells, which of the possibilities is most likely?

The spliceosome is nonfunctional.

A beaker contains two solutions of salt dissolved in water. The two solutions have different concentrations of salt (measured by molarity, M) and are separated by a membrane that is permeable to both salt and water. The salt and water will move through the membrane by diffusion. Which statement is true about the diffusion of these solutions?

There will be a net movement of salt from side B to side A and net movement of water from side A to side B.

Of the choices, which can be a product of a catabolic reaction?

an amino acid like tryptophan

In order for phospholipids to form bilayers spontaneously in an aqueous environment, the pH should be:

approximately neutral.

Proteins that do not refold properly after being heated generally require the assistance of which type of molecules in cells?

chaperones

Animals such as cats, worms, and butterflies are classified as:

chemoheterotrophs.

What would be found in the cells of a blade of grass but not in the cells of an insect feeding on that grass?

chloroplasts

In intestinal epithelial cells, a transport protein moves the bulky, polar glucose molecules through the membrane into the cytoplasm, while simultaneously transporting Na+ through the membrane into the cell down its electrochemical gradient. Which example correctly describes this cotransport of glucose and sodium?

secondary active transport by a symporter

Reactions in which there is a negative change in free energy (-ΔG) are:

spontaneous and exergonic.

When a peptide bond is created between two amino acids:

the carboxyl group of the first amino acid is joined to the amino group of the second.

Which of the structures are part of the endomembrane system?

the nuclear envelope