Bio MCQs past paper
The diagram shows the relationship between phloem sieve tube elements, xylem vessel elements and companion cells. Which row is correct?
A
A number of processes contribute to maintaining a water potential gradient in plants allowing water to reach the highest parts of a plant. Which processes are responsible for maintaining this water potential gradient? 1 capillarity 2 osmosis 3 transpiration A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
A solution of amylase was added to a suspension of starch. After 30 seconds, three samples of the mixture were tested with iodine solution, Benedict's solution or with biuret reagent. Which are the expected results?
A
Plant cells were put into one of three different concentrations of sugar solution, 10%, 5% and 2.5%. The cells were left for 50 minutes and then observed using a light microscope. Which statements are correct? 1 Cell Y had a lower water potential than the sugar solution it was put into. 2 Cell Z was put into the 10% sugar solution. 3 Cell Z had a less negative water potential than the sugar solution it was put into. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT How will the mutation in the allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.
A
Some fungi cause wilting in crop plants by growing within the xylem vessel elements. Which process will be directly affected by these fungi? A cohesion between water molecules B development of root pressure C mass flow during movement of assimilates D uptake of water by root hair cells
A
The antibiotic chloramphenicol inhibits protein synthesis in mitochondria and in some prokaryotes. Chloramphenicol does not inhibit protein synthesis in the cytoplasm of eukaryotic cells. What would be the effect on the cells of a person being treated with chloramphenicol?
A
The diagram shows a graduated slide, with divisions of 0.1mm viewed using an eyepiece graticule. Pollen grains were grown in a sugar solution and viewed using the eyepiece graticule. Diagram 1 shows the pollen grains at the start. Diagram 2 shows the pollen grains after four hours. What is the growth rate of the pollen tubes? A 5μmh-1 B 10μmh-1 C 5mmh-1 D 10mmh-1
A
The diagram shows a protein molecule. Two long polypeptides each form α-helices for much of their length and these twist together into a fibre. At one end, each of these polypeptides coils into a globular head. Two short polypeptides bind to each globular head. What describes the protein structure of this molecule? A quaternary structure because each molecule consists of six polypeptides B secondary structure because the long polypeptides form α-helices C tertiary structure because the α-helices form a fibre D tertiary structure because the heads form globular proteins
A
The diagram shows the pressure changes in some structures of the right side of the heart during the cardiac cycle. Which structure is represented by X? A pulmonary artery B right atrium C right ventricle D vena cava
A
The diagram shows the pressure changes in various structures of the left side of the heart during the cardiac cycle. At the end of which period is the ventricle full of blood?
A
The diagram shows the transport of ions across the cell surface membrane. Inside the cell there is a low concentration of sodium ions (Na+) and a high concentration of potassium ions (K+). Outside the cell there is a low concentration of K+ and a high concentration of Na+. The carrier molecule is a pump which exchanges Na+ for K+. Which ionic movements are represented by the arrows?
A
What can increase the fluidity of the cell surface membrane at low temperatures? 1 double bonds between carbon atoms in the fatty acid chains 2 cholesterol 3 fatty acids having shorter chains A 1, 2 and 3 B 1 and 3 only C 1 only D 2 and 3 only
A
What contributes to the upward movement of water in a xylem vessel of a plant? 1 cohesion of water molecules by hydrogen bonding 2 adhesion of water molecules to the cellulose walls of xylem vessels by hydrogen bonding 3 removal of water from xylem vessels in a leaf reduces the hydrostatic pressure in the xylem A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
Where are antibodies found during an immune response?
A
Which are functions of microtubules? 1 allowing movement of cilia in a bronchus 2 attachment of centromeres during metaphase 3 moving secretory vesicles around a cell A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
Which cell structures have ribosomal RNA (rRNA)? 1 chloroplast 2 mitochondrion 3 nucleus 4 rough endoplasmic reticulum A 1, 2, 3 and 4 B 1, 2 and 3 only C 1, 2 and 4 only D 2, 3 and 4 only
A
Which description of multiple drug resistance in bacteria is correct? A Bacteria have DNA with resistant genes for several different types of antibiotic. B Different species of bacteria have DNA with resistant genes for one type of antibiotic. C Large numbers of one species of bacteria are immune to several different types of antibiotic. D Many different species of bacteria are immune to one type of antibiotic.
A
Which graph shows the effect of carbon monoxide on the percentage saturation of haemoglobin with oxygen?
A
Which molecules contain at least two double bonds? 1 unsaturated fatty acid 2 collagen 3 haemoglobin A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
Which properties of phospholipids explain why single layers of phospholipids added to water immediately form bilayers? 1 The hydrophobic fatty acid chains repel water molecules so the tails pack together. 2 The non-polar fatty acid chains are attracted to each other by hydrophobic interactions. 3 Hydrogen bonds form between the phosphate groups and water. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
Which row correctly matches the function with the structural features of cellulose, collagen, glycogen or triglyceride?
A
Which row is correct for guanine?
A
Which row is correct for the mean blood pressure in different parts of the human circulatory system?
A
Which statements correctly describe transport pathways in dicotyledonous plants? 1 In the apoplast pathway, water does not move through plasmodesmata. 2 In the symplast pathway, water does not move through intercellular spaces. 3 The apoplast pathway may be blocked by the Casparian strip. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
A
The contraction of the heart is coordinated through electrical impulses passing through the cardiac muscle. Which is the correct order of part of the sequence of these impulses? A right and left atria → sinoatrial node → atrioventricular node → ventricular walls B sinoatrial node → right and left atria → atrioventricular node → Purkyne tissue C sinoatrial node → right and left atria → Purkyne tissue → atrioventricular node D sinoatrial node → right and left atria → Purkyne tissue → ventricular walls
B
The diagram shows a stage micrometer scale viewed through an eyepiece containing a graticule. The small divisions of the stage micrometer scale are 0.1 mm. The stage micrometer scale is replaced by a slide of a plant cell. What is the actual length of the nucleus in the plant cell? A 8um B 25um C 200um D 0.8mm
B
The diagram shows a xerophytic leaf in different conditions, P and Q. Which statements describe the difference between the cells in layer Y in conditions P and Q? 1 more negative water potential in P than Q 2 more cells plasmolysed in P 3 cells less turgid in Q 4 water potential becomes zero in Q A 1, 2 and 3 B 1 and 2 only C 2 and 4 D 3 and 4
B
The diagram shows the mitotic cell cycle. During which phase is DNA replicated?
B
The graph shows the affinity of haemoglobin for oxygen at two different concentrations of carbon dioxide. Which point on the graph shows the percentage saturation of haemoglobin entering the pulmonary artery?
B
What are the products when a DNA molecule replicates? A two molecules of DNA each made of a paired sequence of bases B two molecules of DNA each made of a paired sequence of nucleotides C two strands of DNA each made of a paired sequence of bases D two strands of DNA each made of a paired sequence of nucleotides
B
What is correct about the transport of carbon dioxide by blood? 1 The enzyme carbonic anhydrase catalyses the formation of carbonic acid in red blood cells. 2 Carbon dioxide diffuses from active cells to red blood cells and reacts with water. 3 Carbonic acid dissociates forming hydrogen ions that combine with haemoglobin to form carbaminohaemoglobin. A 1, 2 and 3 B 1 and 2 only C 2 and 3 only D 3 only
B
Which colour indicates the lowest concentration of reducing sugar present in a solution after testing with Benedict's solution? A brown B green C red D yellow
B
Which description of a T-lymphocyte is correct? A They are only found in blood and secrete cytokines in response to infection. B They can leave the blood and accumulate at sites of inflammation. C They can leave the blood and secrete cytotoxins when exposed to bacteria. D They circulate in the blood and always present antigens in response to infection.
B
Which structures are found in bronchi?
B
A scientist carried out an experiment to separate cell structures in animal cells. The cells were broken open to release the cell structures. This extract was filtered into a centrifuge tube and then spun in a centrifuge. The heaviest cell structure sank to the bottom forming pellet 1, as shown in the diagram. The liquid above pellet 1 was poured into a clean centrifuge tube and spun in the centrifuge at a higher speed to separate the next heaviest cell structure. This cell structure sank to the bottom, forming pellet 2. This procedure was repeated twice more to obtain pellet 3 and pellet 4, each containing a single type of cell structure. Which row shows the order in which the cell structures were collected?
B
A student observed the cells in the growing region (meristem) of an onion root and obtained the data shown. Which percentage of cells contains chromosomes that appear as two chromatids?
B
Equal sized potato pieces were placed into test-tubes containing equal volumes of different concentrations of sucrose solution and left for 30 minutes. All other variables were controlled. After 30 minutes, the potato piece in one of the concentrations of sucrose solution had not changed in size. What can be concluded from this result? 1 There is no net movement of water into or out of the potato. 2 The water potential of the potato is the same as the water potential of the sucrose solution. 3 The concentration of sucrose in the potato is the same as the concentration of the sucrose solution. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 only
B
How many copies of each DNA molecule will be found in a cell at each stage of the mitotic cell cycle?
B
How many statements are true for semi-conservative replication of DNA in a prokaryotic cell? 1 the process takes place in the cytoplasm 2 an adenine nucleotide will line up against a uracil on the template strand 3 each new DNA molecule will contain one strand from the parent molecule 4 if the parent molecule contained 40% guanine nucleotides each new DNA molecule will contain 20% guanine nucleotides A 1 B 2 C 3 D 4
B
The diagram shows a xerophytic leaf in different conditions, P and Q. Which statements describe the difference between the cells in layer X in conditions P and Q? 1 more negative water potential in P than Q 2 more cells plasmolysed in P 3 cells less turgid in Q 4 water potential becomes zero in Q A 1, 2 and 3 B 1 and 2 only C 2 and 4 D 3 and 4
B 1 and 2 only
How many phospholipid bilayers does oxygen pass through in diffusing from an alveolar air space to form oxyhaemoglobin in a red blood cell in a mammalian lung? A 3 B 5 C 6 D 9
B 5
Which carbohydrate gives a brick red colour when boiled with Benedict's solution? A cellulose B fructose C glycogen D sucrose
B fructose (it's a reducing sugar)
Colchicine is a chemical that stops chromatids from separating during mitosis. A cell is treated with colchicine.Which stage of mitosis will this cell reach but not complete? A anaphase B metaphase C prophase D telophase
B metaphase
A mutation occurred within the DNA sequence coding for an enzyme, causing a decrease in the rate of a reaction catalysed by this enzyme. Which statements could explain the decrease in the rate of reaction? 1 An inhibitor for this enzyme has an increased affinity for the enzyme and forms an enzyme-inhibitor complex more easily. 2 The active site of the enzyme might have changed shape and so is no longer complementary. 3 The activation energy for the reaction with the mutated enzyme is greater than with the non-mutated enzyme. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
C
A sample of food was heated with Benedict's solution which changed colour to green. A second sample of the same food was boiled with dilute hydrochloric acid and neutralised using sodium hydrogencarbonate. It was then heated with Benedict's solution which changed colour to red. What did these results show?
C
A student carried out the Benedict's test on two different types of milk, X and Y. A sample of each type of milk was heated to 100'C in a water-bath with Benedict's solution and the time taken for the first appearance of a colour change was recorded. Which row shows the biological molecule the student detected in each sample of milk and the sample of milk with the highest concentration of this biological molecule?
C
Monoclonal antibodies are used in the diagnosis and treatment of disease. They are produced using a technique known as cell fusion. Which two structures are fused together in this technique? A antigens and hybridoma cells B T-lymphocytes and cancer cells C cancer cells and plasma cells D hybridoma cells and antibodies
C
Radioactively-labelled nucleotides are introduced into a cell. In which cell structures will the radioactivity first become concentrated? A 1 and 2 B 1 and 4 C 2 and 3 D 3 and 4
C
The diagram shows a slide of a transverse section of a stem. This diagram is the same size as the actual slide. A student observed this slide using a light microscope at a magnification of ×40. The student made a plan drawing of the stem, which was 20 cm in diameter. The student labelled the plan 'Transverse section of a stem ×40'. Which statement explains why this label is not correct? A The actual size of the stem should have been checked using an eyepiece graticule. B The actual size of the stem was smaller under low power. C The image size in the drawing was larger than ×40. D The image size in the drawing was smaller than ×40.
C
The diagram shows the molecular structure of a peptide. Which molecules would result from the complete hydrolysis of the peptide?
C
The diagrams show the shape and size of two types of cell. Which statement is correct about the palisade cell and epithelial cell shown in the diagrams? A An increase in surface area reduces the distance for gases to reach the centre of the cell. B The surface area of the palisade mesophyll cell is 500µm2 greater than the columnar epithelial cell. C The surface area to volume ratio is greater in the columnar epithelial cell than the palisade mesophyll cell. D The volume of the palisade mesophyll cell is 2500µm3 greater than that of the columnar epithelial cell.
C
The photomicrograph shows three white blood cells labelled X, Y and Z. Which row correctly identifies these cells?
C
What determines the specificity of an enzyme? 1 the bonding between R groups of the polypeptide 2 the optimum pH of the enzyme 3 the peptide bonds between amino acids of the polypeptide 4 the shape of the substrate molecule A 1, 2, 3 and 4 B 1 and 3 only C 1 only D 2, 3 and 4 only
C
What will be present in each chromosome at the end of the G2 phase of the cell cycle? A two centrioles B two centromeres C two molecules of DNA D two telomeres
C
Which cell structures may contain cisternae?
C
Which feature of stem cells enables them to replace cells in tissues such as the skin? A They are undifferentiated cells that are present at birth. B They differentiate to form skin cells. C They divide by mitosis to supply some cells that can differentiate. D They have the full number of chromosomes.
C
Which nucleic acid bases are purines? A adenine and cytosine B cytosine and thymine C guanine and adenine D uracil and cytosine
C
Which row represents the correct features of the nitrogenous base adenine?
C
Which statement about sucrose loading into companion cells and then into the phloem sieve tube element is not correct? A Hydrogen ions and sucrose molecules move into the companion cells using a carrier protein. B Hydrogen ions are pumped out of the companion cells by active transport. C Sucrose molecules are carried into the companion cells down the concentration gradient for sucrose. D Sucrose molecules move from a companion cell into the sieve tubes of the phloem through plasmodesmata.
C
Which statements about a non-infectious disease may be correct? 1 It can result from a mutation. 2 It can be transmitted by an insect vector. 3 It can be transmitted from mother to child. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
C
Which statements about bronchioles are correct? 1 They have ciliated cells. 2 They have goblet cells. 3 They have muscle tissue. A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
C
Which use of antibiotics helps to reduce the spread of resistance in bacteria? A using high concentrations of the antibiotic to kill all the bacteria B giving routine preventative antibiotics to people who are having an operation C regularly changing the type of antibiotic used to treat particular bacterial infections D giving antibiotics to treat low level infection caused by a bacterium
C
The codons UGU and UGC code for the amino acid cysteine, which can form disulfide bonds in a polypeptide. The codon UGG codes for the amino acid tryptophan, which does not contain a sulfur atom. The codon UGA is a stop signal. The DNA triplet code for the 10th amino acid in a particular polypeptide is ACA. Which single base substitutions in this triplet code will result in no disulfide bond being formed with the 10th amino acid in the polypeptide? A ACC and ACG B ACG and ACT C ACT and ACC D ACT only
C ACT and ACC
A student wrote three statements about cell signalling. 1 A signal chemical always has the same shape as a protein receptor on a target cell. 2 An increase in temperature may decrease the effect of cell to cell signalling. 3 A mutation may decrease production of active protein receptors for the cell surface membrane. Which statements are correct? A 1, 2 and 3 B 1 and 3 only C 1 only D 2 and 3 only
D
Athletes often move from low altitude to high altitude to train for a race. Which statements about the effect of training at high altitude are correct? 1 Higher concentrations of carbon dioxide stimulate greater oxygen dissociation. 2 Lower concentrations of oxygen stimulate the uptake of more oxygen by red blood cells. 3 Lower partial pressures of oxygen stimulate higher production of red blood cells. A 1 and 2 only B 2 and 3 only C 1 only D 3 only
D
Cows and whales are mammals that produce milk to feed their babies. Newborn whales grow faster than newborn cows. The milk of both cows and whales contains saturated fatty acids with different chain lengths. The table shows the percentage of saturated fatty acids of different lengths in cow and whale milk. Which statement about the ratio of short fatty acids (4-16 carbons) to long fatty acids (18 or more carbons) in the milk of cows and whales is correct? A The ratio in cow milk is higher because young cows need more energy than young whales. B The ratio in cow milk is lower because young cows need less energy than young whales. C The ratio in whale milk is higher because young whales need less energy than young cows. D The ratio in whale milk is lower because young whales need more energy than young cows.
D
In the lungs, oxygen and carbon dioxide pass through cell surface membranes by diffusion. Which row is correct?
D
The DNA of typical prokaryotes is naked and circular. Which statement describes how the DNA of eukaryotes differs from the DNA of typical prokaryotes? A Only DNA of eukaryotes has a nuclear envelope around it and is a double helix. B Only DNA of eukaryotes has a nuclear envelope around it and is circular. C Only DNA of eukaryotes has proteins attached to it and is a double helix. D Only DNA of eukaryotes has proteins attached to it and is linear.
D
The drawing has been made from a section showing part of an alveolus and a red blood cell in a capillary. The magnification of the drawing is ×5000. What is the minimum distance that oxygen must diffuse from air in an alveolus into the red blood cell? A 0.1 nm B 1.0 nm C 0.1 μm D 1.0 μm
D
The graph shows how the concentrations of four components, 1, 2, 3 and 4, of an enzyme-catalysed reaction change with time. Which component is the enzyme-substrate complex? A 1 B 2 C 3 D 4
D
The photomicrograph shows a transverse section of part of a dicotyledonous leaf. What are the correct labels for 1, 2, 3 and 4?
D
The photomicrograph shows tissues in a stained transverse section of a plant stem. Students are asked to draw four adjacent xylem vessel elements. Which drawing, all drawn to the same scale, is correct?
D
The table shows the observations made by a student about three different cell types, P, Q and R, seen in a transverse section of a plant stem, using a light microscope. What type of cells are P, Q and R?
D
What happens during ventricular systole? 1 The atrioventricular node transmits an electrical signal to the apex of the heart. 2 The pressure in the ventricles drops below the pressure in the atria. 3 The atrioventricular valves close and the semilunar valves open. A 1 and 2 only B 1 and 3 only C 2 only D 3 only
D
What is the general formula for amylopectin? A (C5H10O5)n B (C5H10O6)n C (C6H12O6)n D (C6H10O5)n
D
What is the smallest unit of a DNA molecule that can be altered by a mutation and cause a change to the coding of a polypeptide? A base B codon C gene D nucleotide
D
Which definition of the magnification of a drawing of a leaf is correct? A the actual size of an object multiplied by the magnification of the microscope B the difference in size between an actual object and a drawing of the object C the increase in size of an object when observed using a microscope D the size of the drawing of a specimen in comparison to the actual size
D
Which features of an organism are affected by a drug that kills cells that are dividing mitotically? 1 cell repair 2 cell replacement 3 number of stem cells 4 tissue repair 5 tumour formation A 1, 2, 3, 4 and 5 B 1, 2 and 3 only C 1, 4 and 5 only D 2, 3, 4 and 5 only
D
Which statement about the properties of the antigen binding sites in antibody molecules is correct? A They are located on the light chains only. B They have a hinge region to give flexibility for different antigens. C They have binding sites for receptors on phagocytes. D They have variable amino acid sequences for different antigens.
D
Which statements about all bronchioles are correct? 1 they have goblet cells 2 they have ciliated cells 3 they have muscle tissue A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
D
Which type of sugar and which type of bond are found in a DNA molecule?
D
Which substances could displace oxygen from oxyhaemoglobin? 1 carbon dioxide 2 carbon monoxide 3 hydrogencarbonate ions 4 hydrogen ions A 1 and 2 B 1 and 4 C 2 and 3 D 2 and 4
D 2 and 4
Lysozyme is an enzyme found in tears and saliva.Which statement refers only to the tertiary structure of lysozyme? A A section of the molecule consists of an α-helix. B It consists of a single polypeptide. C It is 129 amino acids long. D The 35th and 52nd amino acids help form the active site.
D The 35th and 52nd amino acids help form the active site.