Biol 100B Clicker questions

C. The translated protein would change

What do you think would happen if a nucleotide was inserted or lost in a coding region? TACACTCCCGGGTACTGACGATTAGGC C A. Transcription wouldn't happen B. The translated protein wouldn't change C. The translated protein would change D. B or C

D. B or C

What do you think would happen if a single nucleotide changed within a coding region? TACACTCCCGGGTACTGACGATTAGGC C A. Transcription wouldn't happen B. The translated protein wouldn't change C. The translated protein would change D. B or C

C. Amino acid

What type of biomolecule is this? A. Nucleotide B. Lipid C. Amino acid D. Water

B. Covalent

What types of bonds connect the different elements of glycine? A. Ionic B. Covalent C. Hydrogen D. Government

C) The nitrogen base pairs would separate in the interior of the molecule.

When proteins are heated, they usually denature. If moderate heat was applied to this molecule of DNA what part of the molecule would break down or break apart first? (Use your knowledge of chemical bonds.) A) The nucleotides along each side would break apart. B) The sugar-phosphate backbone would separate from the nitrogen bases. C) The nitrogen base pairs would separate in the interior of the molecule.

D. DNA bases, RNA bases, amino acids

An organism's genetic information is stored within the sequence of ___________. This information is transcribed into a sequence of ____________ which are then translated into a sequence of ___________. A. DNA bases, amino acids, RNA bases B. RNA bases, DNA bases, amino acids C. Amino acids, DNA bases, RNA bases D. DNA bases, RNA bases, amino acids

B In cellular respiration the electron source is the hydrogens in energy rich food and the final electron destination is oxygen.

Both cellular respiration and photosynthesis rely on electron transport chains embedded in membranes to produce ATP molecules. Which of the following correctly describes the difference between the two types of electron transport chains? A In cellular respiration the electron source is water and the final electron destination is oxygen. B In cellular respiration the electron source is the hydrogens in energy rich food and the final electron destination is oxygen. C In photosynthesis the electron source is water and the final destination is oxygen. Both B and C.

D 0

By the end of anaphase how many chromatids are present in one human cell? A 46 B 92 C 184 D 0

C 92

By the end of anaphase how many chromosomes are present in one human cell? A 23 B 46 C 92 D 0

C 0

By the end of cytokinesis, how many chromatids are present in one human cell? A 46 B 92 C 0

B 46

By the end of cytokinesis, how many chromosone are present in one human cell? A 23 B 46 C 92

B 46 A True

By the end of telophase how many chromosomes are present in one nucleus within the human cell? A 23 B 46 C 92 Are the nuclei identical? A True B False

c)Taking electrons from food and giving them to oxygen to make water, and using the energy released to make ATP

Cellular respiration can best be described as a)Using energy released from breaking high-energy covalent bonds in organic molecules to make ATP b)Taking electrons from food and giving them to phosphate to make ATP c)Taking electrons from food and giving them to oxygen to make water, and using the energy released to make ATP d)Converting higher energy organic molecules to lower-energy organic molecules, and using the energy released to make ATP

B The shape of enzyme's active site generally fits a specific substrate.

Enzymes catalyze the many reactions in a cell. There are hundreds of different enzymes in a cell—each with a unique three-dimensional shape. Why do cells have so many different enzymes? A Each enzyme molecule can only be used once. B The shape of enzyme's active site generally fits a specific substrate. C The substrate molecules react with enzymes to create new enzymes. D Enzymes are randomly produced. With thousands of different shapes—one is likely to work.

C. It started rising ~3 billion years ago.

For the last 4 billion years has the oxygen concentration in the atmosphere remained constant? A. Yes, more of less. B. It fluctuated as did the Earth's temperature. C. It started rising ~3 billion years ago. D. it has decreased E. It started rising since the origin of earth.

D. amount of 02 produced

Given what we know about photosynthesis, how could we easily measure the rate of photosynthesis? A. amount of sugar produced B. amount of CO2 produced C. amount of CO2 used D. amount of 02 produced

D the both use a chemiosmotic gradient to generate ATP

How are the light reactions similar to parts of cellular respiration? A they both require oxygen B they both produce water C they both require light D the both use a chemiosmotic gradient to generate ATP

A. 99

How many cycles of elongation are required to produce a protein with 100 amino acids? A. 99 B. 100 C. 33 D. none of the above

C 92

Human cells have 46 chromosomes. By the end of interphase. How many chromatids are present in one cell? A 23 B 46 C 92

B 46

Human cells have 46 chromosomes. By the end of interphase. How many chromosomes are present in one cell? A 23 B 46 C 92

B. a hydrolysis reaction

Polymers are disassembled into monomers via: A. a condensation reaction B. a hydrolysis reaction C. a dehydration reaction D. A and C are both correct

C Meiosis

The figure diagrams one of the genetic crosses that helped Mendel form his theories of inheritance. Which process distributes "P" alleles to approximately one half of the F1 gametes and the "p" allele to the other half? A Independent assortment. B Mitosis. C Meiosis. D Chromosome crossover.

D. redundant—most amino acids are coded by more than one codon

The genetic code is ________. A. always specific—no amino acids are coded by more than one codon B. overlapping—some codons overlap each other C. liberal—multiple codons coding for one amino acid usually vary in all three bases D. redundant—most amino acids are coded by more than one codon

A) 6 CO2 + 6 H2O + sunlight → C6H12O6 + 6 O2.

The summary equation for photosynthesis is A) 6 CO2 + 6 H2O + sunlight → C6H12O6 + 6 O2. B) C5H12O6 + 6 O2 + sunlight → 5 CO2 + 6 H2O. C) C6H12O6 + 6 O2 + sunlight → 6 CO2 + 6 H2O. D) the same as the equation for glycolysis written in reverse. E) 6 CH2O + 5 O2 + sunlight → CO2 + 2 H2O.

1)Two or more genes interact to produce the variation in the trait apparent in the population of the organism.

The traits studied by Mendel were mostly discrete traits with two phenotypes. Many traits such as human height vary continuously. Which of the following describe the inheritance of continuously varying traits using Mendel's rules of inheritance? 1)Two or more genes interact to produce the variation in the trait apparent in the population of the organism. 2)Two or more alleles interact to produce the variation in the trait apparent in the population of the organism. 3)Mendel's principles do not apply to continuously varying traits.4) Traits with continuous variability are not influenced by heredity.

A is endergonic.

This is the summary equation for the process of photosynthesis. This reaction A is endergonic. B is exergonic. C has an equal amount of energy in the reactants and the products. D is catabolic.

B) The R-groups on the surface of the molecule are mostly hydrophilic.

This lysozyme protein molecule is found in tears and protects the eye from bacterial infections. Which of the following best describes the outside of the molecule? A) The R-groups on the surface of the molecule are mostly hydrophobic. B) The R-groups on the surface of the molecule are mostly hydrophilic. C) The R-groups on the surface of the molecule are mostly non-polar. D) The R-groups on the surface of the molecule are constantly changing between non-polar and polar as the protein chain bends and folds.