Biology 1610 Final Exam Test Prep

In the F2 generation of a homozygous yellow-seed (AA) X homozygous green-seed (aa) cross in peas, two seeds are chosen at random. What is the probability that one is homozygous yellow (AA) and the other is homozygous green (aa)? (3/4) x (3/4) = (9/16) (1/4) x (1/4) = (1/16) 2 X (3/4) X (1/4)=(6/16) (3/4) x (1/4) = (3/16)

(1/4) x (1/4) = (1/16)

Which statements are true of an inhibitor that binds the active site of an enzyme? Select all that apply. (hint 3/5 are correct) -Adding more substrate can reduce the effect of these inhibitors. -These inhibitors compete with the substrate for the active site of the enzyme. -These inhibitors are structurally similar to the normal substrate of an enzyme. -These inhibitors increase the rate of enzyme activity. -These inhibitors are a kind of allosteric regulator that decreases enzyme activity.

-Adding more substrate can reduce the effect of these inhibitors. -These inhibitors compete with the substrate for the active site of the enzyme. -These inhibitors are structurally similar to the normal substrate of an enzyme.

Which of the following statements below do NOT correctly describe the role of the protein during DNA replication? Select all that apply -Primase adds an RNA primer -DNA polymerase adds dNTPs on the newly synthesized strand -Helicase breaks the covalent bonds between the nitrogenous bases -Ligase removes the RNA primer

-DNA polymerase adds dNTPs on the newly synthesized strand -Helicase breaks the covalent bonds between the nitrogenous bases

Which of the statements is true regarding glycine? R=H Select all that apply -Glycine increases the flexibility of the peptide backbone. -The side chain is small so it tucks in -Glycine is an asymmetric amino acid. -Glycine is a polar amino acid. -Glycine is a large amino acid. -Glycine is special because it contains a -SH group important in protein folding. -Glycine is kinky (causes a bend in protein backbone) because the side chain binds to the central carbon AND the amino o-group.

-Glycine increases the flexibility of the peptide backbone. -The side chain is small so it tucks in

Which of the options correctly match the type of cell division with the cellular events or results characteristic of that type of cell division? Select all that apply. -Mitosis produces four daughter cells. -In mitosis, homologous chromosomes undergo synapsis. -In meiosis, the original cell undergoes two rounds of cell division. -Mitosis produces genetically identical daughter cells. -Meiosis produces genetically unique daughter cells.

-In meiosis, the original cell undergoes two rounds of cell division. -Mitosis produces genetically identical daughter cells. -Meiosis produces genetically unique daughter cells.

As scientists were unraveling the mysteries associated with transcription and translation in eukaryotes, they discovered there was not a one-to-one correspondence between the nucleotide sequence of a gene and the base sequence of the mRNA it codes for. They proposed the genes-in-pieces hypothesis. How can the genes-in-pieces hypothesis be explained? -Exons are noncoding segments of DNA that are not read or transcribed by RNA polymerase. -Introns are noncoding segments of DNA that are not read or transcribed by RNA polymerase. -Introns are noncoding segments of DNA that are present in the initial transcript, but are removed by splicing. -Exons are noncoding segments of DNA that are present in the initial transcript but are removed by splicing.

-Introns are noncoding segments of DNA that are present in the initial transcript, but are removed by splicing.

If a cell has completed meiosis I and is just beginning meiosis II, which of the following is an appropriate description of its contents? -It has half the chromosomes but twice the DNA of the originating cell. -It is identical in content to another cell formed from the same meiosis I event. -It has half the amount of DNA as the cell that began meiosis. -It has one-fourth the DNA and one-half the chromosomes as the originating cell. -It has the same number of chromosomes, but each of them has different alleles than another cell from the same meiosis.

-It has half the amount of DNA as the cell that began meiosis.

Assume you have isolated a protein from an organism in its proper shape and place it in hot water. Which of the following statements describes what you expect will happen? Select all that apply. -It will begin to denature, which means losing some of its secondary and tertiary structure -The hydrogen bonds will be among the first bonds to break -The peptide bonds will be among the first to break -It will begin to denature, which means the polymer will break down into all monomers -Its secondary structure will breakdown before its primary structure breaks down

-It will begin to denature, which means losing some of its secondary and tertiary structure -The hydrogen bonds will be among the first bonds to break -Its secondary structure will breakdown before its primary structure breaks down

Humans are often referred to as "carbon-based" life forms. Given that humans breathe oxygen, shouldn't humans be referred to as "oxygen-based" life forms? -No, because carbon is the most abundant element in human cells, not oxygen -No, because oxygen is not an organic molecule -Yes, because humans inhale oxygen -No, because humans exhale carbon dioxide -Yes, because oxygen is the most abundant element in human cells, not carbon

-No, because carbon is the most abundant element in human cells, not oxygen

The function of a protein is dependent upon the shape into which the chain of amino acids folds. Many noncovalent interactions are responsible for maintaining the protein's shape. Assume you have isolated a protein from an organism in its proper shape, and you have treated it with an enzyme that selectively targets and breaks only the peptide bonds in the proteins. Would the protein retain its shape under these conditions? -No; while the noncovalent bonds determine the shape of a protein, the peptide bonds are required to hold the amino acids together. The shape of the protein would be destroyed because most of the amino acids would exist as free monomers. The peptide bonds responsible for maintaining the primary structure of a protein are absolutely essential to the correct structure. -Yes; because the noncovalent interactions that determine the shape of a protein are stronger than the peptide bonds. -Yes; but the shape would be affected to a greater extent by changes in temperature. -Yes; once noncovalent bonding determines the shape of a protein the peptide bonds are no longer necessary.

-No; while the noncovalent bonds determine the shape of a protein, the peptide bonds are required to hold the amino acids together. The shape of the protein would be destroyed because most of the amino acids would exist as free monomers. The peptide bonds responsible for maintaining the primary structure of a protein are absolutely essential to the correct structure.

Select all that apply about O2 and CO2. -Oxygen (O2) is a cellular respiration input and CO2 is an output. -Both are nonpolar molecules. -Both are produced in cellular respiration. -Oxygen (O2) gains electrons and is reduced. CO2 is the product of oxidation. -Both are symmetrical molecules. -Both are small molecules. -Both can diffuse passively through cell membranes without the help of proteins. -Both are used in cellular respiration. -CO2 is reduced and Oxygen (O2) is the product of oxidation. -Both are hydrophilic molecules.

-Oxygen (O2) is a cellular respiration input and CO2 is an output. -Both are nonpolar molecules. -Both are symmetrical molecules. -Both are small molecules. -Both can diffuse passively through cell membranes without the help of proteins. -CO2 is reduced and Oxygen (O2) is the product of oxidation.

Which one of the following statements BEST represents the relationship between cellular respiration and photosynthesis? -Respiration stores energy in organic molecules, while photosynthesis releases it. -Photosynthesis occurs only during the day and respiration occurs only at night. -Photosynthesis reverses the biochemical pathways of respiration. -Respiration occurs only in animals and photosynthesis occurs only in plants. -Photosynthesis stores energy in organic molecules, while respiration releases it.

-Photosynthesis stores energy in organic molecules, while respiration releases it.

A biologist working in a lab adds a compound to a solution that contains an enzyme and substrate. This particular compound binds reversibly to the enzyme at the active site. Once the compound is bound to the enzyme, the rate of catalysis of substrate to product is greatly reduced. Which of the statements are true of the compound? Select all that apply -The compound competes with the substrate for the active site of the enzyme. -The effect of the compound can be overcome by adding more substrate. -The compound is an enzyme cofactor. -The compound is an allosteric activator. -The compound is an allosteric inhibitor.

-The compound competes with the substrate for the active site of the enzyme. -The effect of the compound can be overcome by adding more substrate.

Which choices accurately match each of the cellular processes to the stage of meiosis in which it occurs? Select all that apply. (5/9 of these are correct) -Microtubules from both poles of the spindle move chromosomes to the center of the cell in anaphase I. -The nuclear envelope disappears in prophase I. -Chromosomes condense to thickened structures that are visible under the microscope in prophase I. -Homologous chromosomes undergo synapsis in prophase II. -Sister chromatids move toward opposite poles of the cell in anaphase II. -Microtubules pull homologous chromosomes toward opposite poles in anaphase I. -Crossing over occurs between homologous chromosomes in prophase II. -Microtubules attach to kinetochores at the centromere of each homolog in prometaphase I. -The centromere splits, and the sister chromatids separate in anaphase I.

-The nuclear envelope disappears in prophase I. -Chromosomes condense to thickened structures that are visible under the microscope in prophase I. -Sister chromatids move toward opposite poles of the cell in anaphase II. -Microtubules pull homologous chromosomes toward opposite poles in anaphase I. -Microtubules attach to kinetochores at the centromere of each homolog in prometaphase I.

Indicate all of the phrases that accurately describe what happens in eukaryotes when a ribosome encounters a stop codon. (3 correct answers) -The ribosomal small subunit and ribosomal large subunit separate from the mRNA. -A release factor binds to the E site. -A tRNA's anticodon base pairs with the mRNA of the stop codon. -The polyA tail is added to the C-terminus. -The protein is released from the tRNA. -A release factor binds to the A site

-The ribosomal small subunit and ribosomal large subunit separate from the mRNA. -The protein is released from the tRNA. -A release factor binds to the A site

Which of the following are TRUE statements? Select all that apply -Amino acids with hydrophobic R groups are most often found in the interior of folded proteins. -Amino acids with polar R groups are most often found in the interior of folded proteins. -The unfolding of a protein by heat or chemical treatment is referred to as denaturation -For a folding domain that forms a sort of "fist" with certain amino acid R groups buried within and other R groups facing out, the hydrophobic R groups mainly face "out" and the hydrophilic R groups mainly face "in." -None of the other statements are true.

-The unfolding of a protein by heat or chemical treatment is referred to as denaturation -Amino acids with hydrophobic R groups are most often found in the interior of folded proteins.

Why does meiosis result in more genetic variation than can be explained by mutation alone? Select all that apply. -Meiotic cell division requires two rounds of DNA replication. -because not all the DNA gets replicated during S phase -because of crossing over between homologs during prophase I -because of the segregation of sister chromatids in anaphase of meiosis II -because of the random alignment of maternal and paternal homologs during metaphase of meiosis I

-because of crossing over between homologs during prophase I -because of the random alignment of maternal and paternal homologs during metaphase of meiosis I

Select all that apply. Why does meiosis result in more genetic variation than can be explained by mutation alone? -because the gametes produced and combine (fertilize) are random -because of the segregation of sister chromatids in anaphase of meiosis II -because of crossing over between homologs during prophase I -because not all the DNA gets replicated during S phase -because of the random alignment of maternal and paternal homologs during metaphase of meiosis I

-because of the random alignment of maternal and paternal homologs during metaphase of meiosis I -because of crossing over between homologs during prophase I -because the gametes produced and combine (fertilize) are random

Some poisonous plants harm people and animals because they produce compounds that are structurally similar to amino acids. Possible reasons why these compounds are toxic include that they _______________ Select all correct phrases. -alter the cytoplasm pH. -change the final folded shape of the protein. -prevent RNA polymerase from being active. -impair the function of proteins. -are recognized by amino acyl tRNA synthetases, and are linked to a tRNA molecule. -block tRNA biosynthesis. -block translation initiation.

-change the final folded shape of the protein. -impair the function of proteins. -are recognized by amino acyl tRNA synthetases, and are linked to a tRNA molecule.

Which stages of mitosis are correctly matched with the events that occur in the stage? Select all that apply. -metaphase; chromosomes line up in the middle of the cell -anaphase; chromosomes start to condense -prometaphase; nuclear envelope reforms -telophase; nuclear envelope breaks down -cytokinesis; a contractile ring of actin filaments forms at the cell equator

-metaphase; chromosomes line up in the middle of the cell -cytokinesis; a contractile ring of actin filaments forms at the cell equator

DNA polymerase can catalyze a dehydration synthesis reaction only at the 3' OH of the daughter strand of DNA. This means that -since the strands are antiparallel, one strand will grow toward the fork as it opens, and the other strand will grow in fragments away from the fork. -none of these are correct. -the leading and lagging strands extend in the 3' - 5' direction toward -the replication fork as the nucleotide bases are exposed. -the antiparallel nature of the parent molecules determine that the leading strand must be grown in fragments away from the fork and the lagging strand is synthesized continuously toward the fork. -Okazaki fragments extend toward the replication fork as the parent strands are unzipped by helicase.

-since the strands are antiparallel, one strand will grow toward the fork as it opens, and the other strand will grow in fragments away from the fork.

The structural diversity of carbon-based molecules is determined by which properties? Select all the apply -carbon's strong electronegativity results in polar covalent bonds -the ability of carbon to form four covalent bonds -the ability of carbon to ionize and interact with other ions -the ability of carbon's covalent bonds to rotate freely -the orientation of carbon's bonds in the form of a tetrahedron

-the ability of carbon's covalent bonds to rotate freely -the orientation of carbon's bonds in the form of a tetrahedron -the ability of carbon to form four covalent bonds

The energy in organic molecules is released in a series of steps, rather than a single step, because: -only a single electron can be moved at a time in a cellular reaction. -it is not possible to release it in a single step. -the amount of energy released in the single step would be too much to capture in one reaction (and may damage the cell). -more total energy is released in multiple steps than would be released in a single step. -less total energy is released in multiple steps than would be released in a single step.

-the amount of energy released in the single step would be too much to capture in one reaction (and may damage the cell).

A sample of DNA contains 20% guanine. What percentage of uracil does it contain? 20% 60% not enough information to answer 30% 0% 40%

0%

Suppose that in humans the ability to roll the tongue (R) is dominant to being unable to roll it (r), and having freckles (F) is dominant to having no freckles (f). If a woman heterozygous for both traits married a man with no freckles who couldn't roll his tongue, what is the probability that they would have a freckled, tongue-rolling child? 9/16 1/4 3/4 3/16 1/2 1/16

1/4

Compared to eukaryotes, prokaryotes are typically -Less important to life on earth -More complex -10 - 100 times smaller -none of these answers are correct -10 - 100 times larger

10 - 100 times smaller

Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucleotide content of the bacterial DNA. If the cytosine content of DNA from the bacterial cells is 40%, what is the adenine content? 10% 60% 40% 20% It is not possible to calculate this number for prokaryotes.

10%

A solution of pH 5 contains ___________ H+ than the same amount of solution at pH 3. 2 times less 100 times less 10 times less 100 times more 2 times more 10 times more

100 times less

A solution of pH 2, has ______ [H+] than a solution of pH 5? 1000X less 10x less 10X less 100X less 100x more 1000x more

1000x more

How many hydrogen atoms are present in a hydrocarbon chain of five carbons joined to each other by single covalent bonds? 12 6 8 10

12

A true-breeding black rabbit is crossed with a true-breeding white rabbit to produce an F1 generation of 16 individuals. If the black color trait is dominant, which of the outcomes represents the expected phenotype of an F1 generation cross? 0 black rabbits, 0 white rabbits, 16 gray rabbits 0 black rabbits, 16 white rabbits, 0 gray rabbits 9 black rabbits, 3 white rabbits, 3 gray rabbits, and 1 spotted rabbit 16 black rabbits, 0 white rabbits, 0 gray rabbits 5 black rabbits, 4 white rabbits, 7 gray rabbits

16 black rabbits, 0 white rabbits, 0 gray rabbits

You are given two true-breeding groups of gerbils. The gerbils in the first group have black fur and curly tails; the gerbils in the second group have yellow fur and straight tails. When you produce an F1 generation, you see only gerbils with black fur and curly tails. When you produce an F2 generation, 75% of the gerbils have black fur and 25% have yellow fur. You also see that 25% of the gerbils have straight tails and 75% have curly tails. If the single alleles responsible for fur color and tail appearance sort independently, how many of the black gerbils in this generation are expected to have straight tails? 0% 18.75% 75% 37.5% none of these answers are correct

18.75

If the [H+] is 0.01 M, the the pH is ________. negative 3 2 4 3 1 negative 2

2

If a double-stranded DNA sample were composed of 30% cytosine, what would be the percentage of thymine? 20% 60% it is impossible to tell from the information given 40% 30%

20%

You are studying an atom with two electron shells. When full, the innermost electron shell of the atom contains _________ electrons, and the next shell contains ________electrons. 2; 6 8; 2 2; 8 2; 4 4; 2

2; 8

Read this story and identify the different aspects of the scientific method by choosing the statement number : You get in your car to drive to class. (1) You turn the key, and the engine starts making a clicking sound, but does not start. (2) You think to yourself, "The battery must be dead". (3) So, you borrow the battery from your neighbor's car (with permission, of course) and exchange it for the one in your car. (4)You figure that if the battery in your car is dead and you replace it then the car will start. (5) You get in the car again, turn the key, and the car starts right up. Which of these statements is an experiment/test? Which of these statements is a prediction? Which of these statements is a observation? Which of these statements is a hypothesis? Which of these statements is a theory? What is wrong with the experiment?

3 4 1 2 none of these There is no control or repetition

In a DNA strand, successive nucleotides are linked by: 3'-5' phosphodiester bonds. 5'-3' phosphodiester bonds. base stacking. 2'-5' phosphodiester bonds. peptide bonds. hydrogen bonds.

3'-5' phosphodiester bonds.

The FoxP2 gene is thought to be involved in language in humans. At prophase I, how many copies of the FoxP2 gene are present in a cell? Keep in mind that humans are diploid. 4 copies; 1 on each sister chromatid in a pair of homologous chromosomes 8 copies; 1 on each strand of each chromatid per homologous pair 1 copy; there are no homologous chromosomes or sister chromatids 8 copies; 1 on each sister chromatid in a pair of homologous chromosomes 2 copies; 1 on each homologous chromosome

4 copies; 1 on each sister chromatid in a pair of homologous chromosomes

You have a solution with a Hydrogen ion concentration of 0.00001 A. What is the pH of this solution? B. Is this solution acidic, basic or neutral?

5 acidic

Which strand listed below is the complementary strand to this DNA strand: 3' ATCTCTGG 5' 3' ATCTCTGG 5' 5' TAGAGACC 3' 3' TAGAGACC 5' 5' ATCTCTGG 3'

5' TAGAGACC 3'

A template DNA strand contains the sequence 5'-ATGCTGAC-3'. The corresponding sequence in the RNA transcript is:____. 5'-GUCAGCAU-3' 5'-TACGACTG-3' 5'-UACGACUG-3 5'-GTCAGCAT-3'

5'-GUCAGCAU-3'

The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. 5' CGAGCAUGCAAUCUAAUUAAUC 3' 5'UAC3' ; 5'GUU3' ; 5'AGA3' none of these answers are correct 5'GCU3' ; 5'CGU3' ; 5'ACG3' 5'UCG3' ; 5'UGC3' ; 5'GCA3' 5'CGA3' ; 5'GCA3' ; 5'UGC3' 5'CAU3' ; 5'UUG3' ; 5'AGA3'

5'CAU3' ; 5'UUG3' ; 5'AGA3'

Nitrogen is an element found in many biological molecules. How many electrons does it have in its valence shell? ; How many covalent bonds can it form with other atoms? 3,3 5,3 2,4 5,2

5,3

A mutation takes place in a protein-coding gene that changes one nucleotide resulting in a single amino acid replacement. Which type of replacement is least likely to result in a disruption of protein structure and function? 5. a polar amino acid to a polar amino acid 1. a polar amino acid to a hydrophobic amino acid 2. an acidic amino acid to a basic amino acid 3. a hydrophilic amino acid to a hydrophobic amino acid 4. a hydrophobic amino acid to a hydrophilic amino acid

5. a polar amino acid to a polar amino acid

Consider the events that describe the progress of a protein that will be secreted from the cell. 1. SRP binds to the growing polypeptide chain and to the ribosome. 2. Translation resumes. 3. SRP binds to its receptor. 4. The signal sequence is cleaved. 5. Protein synthesis begins in the cytosol. 6. Translation pauses. Which of the following is the correct sequence of events? 3→5→1→2→6→4 5→1→6→3→2→4 5→1→4→3→2→6 6→1→5→3→4→2 5→6→1→3→2→4 3→6→1→2→4→5

5→1→6→3→2→4

You have a solution with a Hydrogen Ion concentration of .000001. What is the pH of this solution? 4 7 5 6 8 3

6

Carbon as it appears on the periodic table is shown below. Carbon has an atomic number of (ANSWER) which represents the number of [ANSWER] Carbon has [ ANSWER] electrons with [ANSWER] in the inner shell and [ANSWER] in the outer, valence shell. Carbon has an atomic mass of [ANSWER] . This indicates that most carbon atoms have [ANSWER] neutron (mass minus protons). The fact that this is not an even number indicates that there are other rare forms of Carbon, called isotopes, that have different numbers of [ANSWER] .

6 protons 6 2 4 12.011 6 neutrons

Complete the description: ____________ can occur when a molecule has a hydrogen atom covalently linked to an electronegative atom, whereas _______________ occurs between oppositely charged atoms and ______________ occurs when atoms share electrons. A covalent bond; a hydrogen bond; an ionic bond An ionic bond; a hydrogen bond; a covalent bond A covalent bond, an ionic bond, a hydrogen bond A hydrogen bond; an ionic bond; a covalent bond A hydrogen bond; a covalent bond; an ionic bond

A hydrogen bond; an ionic bond; a covalent bond

Which statement is true of DNA? -A purine always forms a complementary base pair with a pyrimidine. -The percentage of the purine A always equals the percentage of the purine G. -It is used by ribosomes for translation. -A phosphate group in a nucleotide is attached to the 3' carbon in ribose. -Successive nucleotides in a strand are connected by hydrogen bonds.

A purine always forms a complementary base pair with a pyrimidine.

Atractyloside is a poison that inhibits the transport of ADP from the cytosol across the mitochondrial membranes and into the mitochondrial matrix. The direct effect of this drug is to stop ATP synthesis because: -no concentration gradient is available. -the poison prevents electron transfer to O2. -the poison prevents electron transfer from NADH to complex I. -ADP is a necessary substrate for the reactions catalyzed by ATP synthase. -the poison prevents proton pumping across the inner mitochondrial membrane.

ADP is a necessary substrate for the reactions catalyzed by ATP synthase.

Which of these statements is true? -An exon is considered a "coding sequence" of DNA, and its information is retained in the processed mRNA within a cell. -None of these answers are correct -During transcription, the RNA/DNA complex extends for the entire length of the DNA sequence of interest. -During transcription of a given protein-coding gene, both strands are used as template. -all of these choices are correct. -The same strand in a DNA double helix is used as the template strand for transcription of every gene in a given chromosome.

An exon is considered a "coding sequence" of DNA, and its information is retained in the processed mRNA within a cell.

All of the following are TRUE statements about atoms except: -Atoms are the unit of composition for elements. -Atoms are the smallest building block that is considered to be alive. -Atoms are the basic unit of matter. -Atoms cannot be broken down by normal chemical means but can gain or loose electrons -Atoms contains protons, electrons, and neutrons (almost always). -Atoms have negatively charged particles circling around a positively charged nucleus.

Atoms are the smallest building block that is considered to be alive.

Why does ADP have less potential energy than ATP? Because ATP has ribose as a sugar. Because ADP has only one phosphate group. Because ATP has adenine in it. Because ADP has only two phosphate groups.

Because ADP has only two phosphate groups.

If FRAP is performed on two membranes, one at 25oC and the other at 40oC, which one of the following results would most likely be observed? (hint: think of butter in freezer, room temperature, or melted.) -Both membranes would recover fluorescence in the bleached area at the same rate. -Only the membrane at the lower temperature would recover fluorescence in the bleached area. -Only the membrane at the higher temperature would recover fluorescence in the bleached area. -Both membranes would recover fluorescence in the bleached area, but the membrane at the colder temperature would recover more rapidly. -Both membranes would recover fluorescence in the bleached area, but the membrane at the warmer temperature would recover more rapidly.

Both membranes would recover fluorescence in the bleached area, but the membrane at the warmer temperature would recover more rapidly.

Protein polarity is described as having an N-terminus and a C-terminus. Consider a ribosome that is actively engaged in translation. As the ribosome moves along the mRNA, the protein grows at the ________ terminal end by addition of the amino acid that is bound to the tRNA at the _______ site. N-terminus, P site N-terminus, A site N-terminus, E site C-terminus, E site C-terminus, P site C-terminus, A site

C-terminus, A site

Which molecule would most likely require a transport protein to cross the plasma membrane of a red blood cell? H2O C6H12O6, glucose O2 CO2

C6H12O6, glucose

Which reactant will lose electrons in this reaction? What is the resulting oxidized product? C6H12O6 + O2 → CO2 + H2O + ATP C6H12O6.....H20 C6H12O6....CO2 C6H12O6.....ATP H2O....O2 CO2.....C6H12O6 O2.....H2O

C6H12O6....CO2

What anticodon in tRNAMet would pair with the codon 5'-AUG-3'? 5'-CAT-3' 5'-CAU-3' 5'-ATG-3' 5'-GUA-3' 5'-UAC-3' 5'-AUG-3'

CAU

Agrobacterium is a bacterium that infects plants and causes them to form tumors. You are asked to determine how long a plant must be exposed to these bacteria to become infected. Which of the following is an appropriate CONTROL for the experiment? -Expose the plant to another concentration of Agrobacterium for -different lengths of time and measure tumors formed. -Use many plants to do the experiment. -Expose the plant to Agrobacterium for only 1 minute. -Do not expose the plant to Agrobacterium and measure how many tumors are formed.

Do not expose the plant to Agrobacterium and measure how many tumors are formed.

Which statement below is true regarding water? -Water dissolves solutes by breaking their covalent bonds -all of these answers are correct -Water hydrogen bonds with ions -Hydrogen bonding leads to high cohesiveness between water molecules

Hydrogen bonding leads to high cohesiveness between water molecules

Which statement describes the proton gradient generated by the electron transport chain? The concentration is highest in the hydrophobic center of the outer membrane. It is an electrochemical gradient. It results from differences in the concentration of hydroxide ions. It contains a great deal of kinetic energy. The concentration is highest in the hydrophobic center of the inner membrane.

It is an electrochemical gradient.

As a short cut, many biologists state that the phosphate-phosphate bonds in ATP are "high energy". I supposed we should use air quotes around the term "high energy". In fact, the phosphate-phosphate bonds are not notably high in energy. Rather, they are easy to break, and the negative ΔG of hydrolysis is a "useful" quantity of energy that can be used to do work. What makes the phosphate bonds easy to break? High acidity attacks bonds between amino acids. High alkalinity attacks bonds between phosphate groups. Negative charges on phosphate groups repel each other. Positive charges on amino groups repel each other. They are close to the destabilizing nitrogenous base adenosine.

Negative charges on phosphate groups repel each other.

You have learned that mutations can occur in DNA sequences. Are all mutations deadly? No, all mutations are benign. Yes, because all mutations in DNA disrupt the central dogma. Yes, all mutations are deadly. No, most mutations have no effect and a few can be beneficial.

No, most mutations have no effect and a few can be beneficial.

Recall that a carbon atom behaves as if it possesses four valence electrons. Given this information, what is the most likely structural formula for carbon dioxide (CO2)? O=C-O O-C=O O-C-O O=C=O

O=C=O

Two semi-permeable membrane bags containing 40% glucose solution (bag A) and 20% glucose solution (bag B), respectively, are placed in a beaker containing 30% glucose. The bags are permeable to water, but not glucose. What will happen? -Only bag B will gain mass -Both bags lose mass -none of these answers are correct -Only bag A will gain mass -Both bags gain mass

Only bag A will gain mass

At physiological pH, the ionized state of the carboxyl group in the R group of aspartic acid is: R-COO- R-COOH R-COOH+ R-CO-O- R-COOH- R-C0-R

R-COO-

At physiological pH, the ionized state of the amino group in the R group of lysine is: R-NH3+ R-NH2 R-NH- NH4++

R-NH3+

Which example correctly lists the components necessary for eukaryotic transcription? -RNA polymerase, general transcription factors, DNA, and RNA nucleotides -ribosomes, general transcription factors, DNA, and RNA nucelotides -RNA polymerase, general transcription factors, DNA, and DNA nucleotides -DNA polymerase, primase, DNA, and RNA nucleotides -ribosomes, general transcription factors, DNA, and RNA nucleotides

RNA polymerase, general transcription factors, DNA, and RNA nucleotides

Which statement about RNA is correct? -RNA uses the same purine bases as DNA. -All of these choices are correct. -RNA uses the same pyrimidine bases as DNA. -RNA has the same 5-carbon sugars as DNA. -RNA is a more stable molecule than DNA.

RNA uses the same purine bases as DNA.

Select all that apply. Suppose that in humans the ability to roll the tongue (R) is dominant to being unable to roll it (r). Having freckles (F) is dominant to having no freckles (f). A freckled tongue-roller could have which genotypes? RRFF rrFF RrFf RRff and RrFf only All of these choices are correct.

RRFF RrFf

In translation, the dehydration synthesis reaction is catalyzed by which enzyme? DNA polymerase Ribosome Protease Topoisomerase Peptide RNA polymerase Ligase

Ribosome

In which of the four phases of the cell cycle do sister chromatids form? S phase G2 phase G1 phase M phase

S phase

Put the following DNA replication events in the correct order: Primase synthesizes an RNA primer. The initiator protein binds the origin. Ligase seals up the nicks in the lagging strands. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction. Helicase unwinds the DNA. DNA exonuclease removes mispaired nucleotides in the newly replicated strand.

The initiator protein binds the origin. Helicase unwinds the DNA. Primase synthesizes an RNA primer. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction. DNA exonuclease removes mispaired nucleotides in the newly replicated strand. Ligase seals up the nicks in the lagging strands.

A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group of cells, high levels of phosphorylated p53 occur in the nuclei. What can she deduce about these cells? These cells likely contain damaged DNA. These cells have entered mitosis. These cells have entered meiosis. Within these cells, the cell cycle has been halted at the G2/M transition. These cells are normal.

These cells likely contain damaged DNA.

You are working at NASA studying new life forms found in the Cueva de Villa Luz caves. You have collected an unknown specimen that appear to be 0.5 micron in size, have a cell membrane and ribosomes. This specimen could be... a molecule a prokaryote a virus an archea either a virus or a bacteria a eukaryote

a prokaryote

Which choice is considered an integral membrane protein? A protein attached to the cytoskeleton a protein attached to a transmembrane protein via hydrogen bonding a protein capable of diffusing throughout the cytoplasm of a cell a protein attached to a phospholipid via ionic bonding with the head group of the lipid molecule a protein with its amino-terminus in the cytoplasm and its carboxy-terminus in the extracellular space

a protein with its amino-terminus in the cytoplasm and its carboxy-terminus in the extracellular space

Energy released by transferring electrons along the electron transport chain is stored as potential energy in the form of: a photon gradient. a protein gradient. redox pairs a proton gradient. NADH coenzymeQ. ATP synthase. ATP.

a proton gradient.

The carboxyl functional group (R-COOH) tends to act as a(n) ______________ because it often ______________ protons in aqueous solutions acid; accepts base; donates base; accepts acid; donates

acid; donates

Which of the following is true of an enzyme? An enzyme____ (select all that apply) acts as a biological catalyst is not specific to one chemical reaction is usually a protein is used only once

acts as a biological catalyst is usually a protein

Select all that are true of a ribosome. acts as an enzyme composed of rRNA found in the nucleus composed of protein performs transcription

acts as an enzyme composed of rRNA composed of protein

Which of the answer choices must have arisen after the evolution of oxygenic photosynthesis? ATP as the major energy currency of cells aerobic cellular respiration ethanol fermentation bacteria lactic acid fermentation living cells

aerobic cellular respiration

Which of the following is true of a mutation? all of these answers are correct can be caused by a mutagen such as UV light can change the nucleotide sequence of a gene can be caused by a DNA replication error

all of these answers are correct

Two major types of protein secondary structures are referred to as: alpha helix or beta pleated sheet residual and permanent. primary and secondary tertiary and quatenary amino and carboxyl

alpha helix or beta pleated sheet

When a DNA and/or RNA strand base pairs with another nucleic acid (or bends back on itself to base pair), the orientation is Antiparallel for DNA, RNA never base pairs Antiparallel for DNA, parallel for RNA antiparallel for DNA/DNA, DNA/RNA, RNA/RNA DNA parallel, RNA antiparallel parallel

antiparallel for DNA/DNA, DNA/RNA, RNA/RNA

Animals breathe in air containing oxygen and breathe out air containing less oxygen. The consumed oxygen is used: in the glycolysis pathway. in the citric acid cycle. in the conversion of pyruvate to acetyl Co-A. as an electron acceptor in the respiratory electron transport chain. in photosynthesis.

as an electron acceptor in the respiratory electron transport chain.

How might an enzyme inhibitor slow down the action of an enzyme without binding to the active site? -by binding to another site on the enzyme and changing its shape. -by lowering the activation energy -by changing the shape of the substrate -by binding the substrate

by binding to another site on the enzyme and changing its shape.

Reactive oxygen species result when electrons are dropped during aerobic metabolism. How does the plant cell protect itself from harmful reactive oxygen species formed by the interaction of high-energy electrons with O2 molecules? by decreasing the production of ATP by producing antioxidants. by increasing the amount of e- donated to ferredoxin by increasing the amount of NADP+

by producing antioxidants.

The amount of _____ is fairly constant throughout the cell cycle, but the amount of _____ varies. DNA; cyclins cyclin-dependent kinases (CDK); cyclins cyclins; cyclin-dependent kinases (CDK) cyclins; DNA cyclin-dependent kinase; DNA

cyclin-dependent kinases (CDK); cyclins

Chemicals called uncouplers can make membranes permeable to small molecules and ions. What effect might uncouplers have on cellular respiration? decreased ATP production because the proton gradient would decrease increased ATP production because cyclic electron transport would increase decreased ATP production because the proton gradient would increase decreased NADPH production because the proton gradient would increase decreased NADPH production because the proton gradient would decrease

decreased ATP production because the proton gradient would decrease

Chemicals called uncouplers can make membranes permeable to small molecules and ions. What effect might uncouplers have on photosynthesis? decreased ATP production because the proton gradient would increase decreased NADPH production because the proton gradient would increase decreased NADPH production because the proton gradient would decrease decreased ATP production because the proton gradient would decrease increased ATP production because cyclic electron transport would increase

decreased ATP production because the proton gradient would decrease

How does the metabolism occurring in chloroplasts differ from that of mitochondria? different proton acceptors None of the other answer options is correct. different proton sources different electron acceptors and electron sources one makes ATP, the other makes NADPH

different electron acceptors and electron sources

A protein called Calmodulin binds calcium in cells. The polypeptide chain of this protein was cut into three pieces and the first piece still retains its calcium binding property. This piece of the polypeptide is an example of a amino acid beta pleat domain primary protein structure functional group

domain

A region of a protein that folds in a particular way, and that carries out a specific function, is referred to as a folding__________ domain amino acid structure level tertiary alpha helix or beta pleated sheet

domain

Consider hydrocarbon, C2H4 (electronegativity of C is 2.5, H is 2.1): If we assume that all of the atoms in this molecule have full valence shells because of their bonds, what type of bond must be between the two carbons? Is the bond polar covalent, nonpolar covalent, or ionic? -single bond; nonpolar covalent -single bond; ionic -double bond; nonpolar covalent -double bond; polar covalent -single bond; polar covalent -triple bond; covalent

double bond; nonpolar covalent

Ions are formed when an atom gains or loses one or more [ANSWER] Identify the correct types of bonds. [ANSWER] bonds are formed with atoms sharing electrons. [ANSWER] bonds are formed with atoms sharing electrons equally. [ANSWER] bonds are formed with atoms share electrons UNequally. [ANSWER] bonds are interactions between partially positive hydrogen atoms and highly electronegative atoms like O and N. [ANSWER] bonds are interactions between oppositely charged ions. (Ions have full charge not partial).

electrons Covalent Nonpolar covalent Polar covalent Hydrogen Ionic

A covalent bond is formed by the sharing of _______ between atoms, whereas an ionic bond is formed by the _______. -electrons; transfer of electrons from one atom to another -protons; electric attraction between two neutral atoms -electrons; sharing of ions -electrons; electric attraction between two neutral atoms -neutrons; sharing of electrons

electrons; transfer of electrons from one atom to another

Most of the proteins of the electron transport chain are: embedded in the outer mitochondrial membrane. embedded in the inner mitochondrial membrane. located in the mitochondrial matrix. located in the intermembrane space of mitochondria. embedded in both mitochondrial membranes.

embedded in the inner mitochondrial membrane.

Antennae pigments work with reaction centers by providing: H+ transfer. electron transfer. energy transfer. fluorescence. heat loss.

energy transfer.

A biologist hypothesizes that keeping mice on a restricted calorie diet will increase their aggression. The biologist designs an experiment in which fifty 1 year old male mice, all 50 grams in weight, are housed in individual cages at 27 degrees Celsius and fed the same low calorie diet. After 2 weeks he then plans to place pairs of mice together in the same cage to observe their interactions. Which is the most appropriate design of a control for this experiment. -fifty 1 year old male mice, all 50 grams in weight, are housed in individual cages at 27 degrees Celsius and fed the normal calorie diet -mice not fed a low calorie diet -fifty 1 year old male mice, all 50 grams in weight, are housed in individual cages at 27 degrees Celsius and fed a different low calorie diet -fifty 1 year old female mice, all 50 grams in weight, are housed in individual cages at 27 degrees Celsius and fed the same low calorie diet -fifty 1 year old male mice, all 50 grams in weight, are housed in individual cages at 27 degrees Celsius and fed nothing

fifty 1 year old male mice, all 50 grams in weight, are housed in individual cages at 27 degrees Celsius and fed the normal calorie diet

In plants and animals, _____ is the immediate source of the ELECTRONS, ENERGY and CARBON needed for cellular respiration. glucose sunlight ATP H2O NADPH CO2 H+

glucose

Which of the following correctly indicates the path of carbon as molecules are broken down in cellular respiration? -acetyl~CoA > CO2 > G3P (3 carbons + phosphate group) > glucose > pyruvate -glucose > G3P (3 carbons with a phosphate group) > pyruvate > acetyl~CoA > CO2 -CO2 > pyruvate > acetyl~CoA > G3P (3 carbons with a phosphate group > glucose -pyruvate > acetyl~CoA > CO2 > glucose > G3P (3 carbons with a phosphate group) -glucose > pyruvate > G3P (3 carbons + phosphate group) > CO2 > acetyl~CoA

glucose > G3P (3 carbons with a phosphate group) > pyruvate > acetyl~CoA > CO2

Based on what you know of ATP's chemistry, which of the following has functions similar to ATP? lysine (amino acid) potassium ions (K+) steroids phospholipids guanosine triphosplate (GTP)

guanosine triphosplate (GTP)

Many salmon return to the place where they were born to spawn (reproduce). You hypothesize that they use visual cues to find their way back. To test your hypothesis, you blind salmon and then examine whether or not they are able to return to their birthplace. You find that they are able to find their way back. From this experiment, you: -can't determine whether your hypothesis is supported or not. -have proven your hypothesis. -developed a theory about the role of vision in salmon navigation. -have rejected your hypothesis. -supported your hypothesis.

have rejected your hypothesis.

Mendel crossed true-breeding yellow-seed plants with true-breeding green-seed plants. The yellow color is a dominant trait. True-breeding means [ANSWER] What would the genotype of the offspring be? [ANSWER] What would the phenotype of the offspring be?

homozygous heterozygous for yellow and green alleles yellow-seed plants.

Which of the following statements is true of water molecules? -hydrogen bonding results in low cohesiveness between water molecules -the structure of a single water molecule is stabilized by hydrogen bonds -water molecules are non-polar -none of these answers are correct -hydrogen bonding allows water to dissolve polar solutes

hydrogen bonding allows water to dissolve polar solutes

Secondary structure is characterized by which type of interactions? -hydrogen bonding within the peptide backbone -hydrogen bonding between R groups of amino acids -a covalent bond between two cysteines -the covalent bond between an amino nitrogen and a carboxyl carbon -ionic bonding between an acidic R group and a basic R group

hydrogen bonding within the peptide backbone

Secondary active transport uses a pre-established ion gradient to move a second compound across the plasma membrane. The pre-established ion gradient arises from: diffusion cellular metabolism osmosis synthesis of ATP hydrolysis of ATP

hydrolysis of ATP

In Enzyme C, arginine, lysine, and histidine are crucial for the binding of the substrate at the active site. Which of the following characteristics do you predict that the substrate of Enzyme C will possess? hydrophilic, with a negative charge hydrophilic, but without a charge hydrophilic, with a positive charge relatively hydrophobic

hydrophilic, with a negative charge

In Enzyme B, threonine, serine, and glutamic acid are crucial for the binding of the substrate at the active site. Which of the following characteristics do you predict that the substrate of Enzyme B will possess? hydrophilic, with a positive charge hydrophilic, with a negative charge hydrophilic, but without a charge relatively hydrophobic

hydrophilic, with a positive charge

The interior region of a phospholipid bilayer is characterized as: hydrophilic. polar. hydrophobic. hydrophilic and polar.

hydrophobic

You've noticed that when your cat is napping she often curls up and puts her tail over her nose. This morning it was quite warm and you notice she does not have her tail over her nose. You think perhaps she puts her tail on her nose when it's relatively cold in your apartment, to keep her nose warm. Scientifically, this is a good example of a(n) -experiment -method -hypothesis -analysis -theory

hypothesis

Where must the SRP receptor be located in a cell? in the nuclear envelope in the membrane of the rough endoplasmic reticulum in the membrane of the lysosome in the membrane of the Golgi apparatus

in the membrane of the rough endoplasmic reticulum

Select all that are true of aminoacyl tRNA synthetase. is a protein is found in the nucleus attaches an amino acid to the correct tRNA builds a tRNA polymer from amino acid monomers is a nucleic acid

is a protein attaches an amino acid to the correct tRNA

Polymers are monomers connected by covalent bonds. The class of organic molecules that does not typically form polymers are the: lipids. carbohydrates. None of the other answer options is correct. nucleic acids. proteins.

lipids.

When a substance in a reaction is oxidized, it: is an electron acceptor. is usually oxygen. loses electrons. gains electrons.

loses electrons.

A basic solution has a ________ [H+] and a ________ [OH-] lower; higher not enough information to answer higher; lower tripled; doubled

lower; higher

Independent assortment of chromosomes occurs during ________. meiosis I only mitosis only mitosis and meiosis I mitosis and meiosis II meiosis II only

meiosis I only

Homologous chromosomes separate from each other in: meiosis II. mitosis and meiosis I. meiosis I. mitosis and meiosis II. mitosis. They never separate from each other during any form of cell division.

meiosis I.

Homologous pairs of chromosomes separate during: meiosis I and mitosis. mitosis. meiosis II. meiosis I. meiosis II and mitosis.

meiosis I.

The NASA spacecraft Perseverance landed on Mars successfully a few days ago to investigate life on Mars. It is collecting Martian soil samples to look for signs of microscopic life. What characteristics would NASA have to find in the Martian samples that would suppo rt the existence of life on Mars? Select ALL correct answers. membrane delimited evolves capable of storing and utilizing energy is spherical in shape responds to the environment stores and follows instructions replicates

membrane delimited evolves capable of storing and utilizing energy responds to the environment stores and follows instructions replicates

Let's say you feel very strongly that cigarette smoke does not increase the probability of getting cancer, and you base your view on something you read on the Internet. This is a good example of a(n): -hypothesis. -none of the other answers are correct. -observation. -experiment -theory.

none of the other answers are correct.

If you made a big deletion of DNA in the promoter sequence of a gene, which of the following is likely to happen? -The mutation of the DNA would be copied to the RNA sequence -The transcription factors will recognize and bind the DNA, initiating transcription -DNA polymerase would no longer be able to bind and carry out transcription -The promoter is not transcribed, therefore RNA would be made as usual -none of these answers are correct

none of these answers are correct

Which of the four major biomolecule types contains the information / instructions? nucleic acids (DNA) lipids proteins ATP complex carbohydrates

nucleic acids (DNA)

A protein that is found in the Golgi apparatus was synthesized: on ribosomes located in the smooth ER. on ribosomes bound to the rough ER. on ribosomes located in the chloroplast. in the nucleus. on ribosomes located in the cytoplasm..

on ribosomes bound to the rough ER.

In double-stranded DNA, the sugar-phosphate backbones are: -on the outside, separated by grooves of unequal size. -on the outside, separated by grooves of equal size. -on the inside, separated by grooves of unequal size. -on the inside, separated by grooves of equal size.

on the outside, separated by grooves of unequal size.

An ion with a -1 charge has ________ . one more electron than protons one less electron than protons none of these answers are correct an acidic pH the same number of protons and electrons the same number of electrons and neutrons

one more electron than protons

In a double-stranded DNA molecule, the strands are said to be antiparallel because: -one strand runs in 5' to 3' direction and the other in 3' to 5'. -only one of them is a template strand. -each purine of one strand pairs with a pyrimidine of another. -they form an uneven pair of grooves on the outside of the molecule.

one strand runs in 5' to 3' direction and the other in 3' to 5'.

Which of the following statements about the properties of life is false? -organisms have the ability to take in energy and use it -organisms have an unchanging, constant internal environment -organisms have the ability to reproduce -organisms have the ability to respond to stimuli from the environment -Living organisms are made of one or more cells.

organisms have an unchanging, constant internal environment

The mitochondrial electron transport chain is part of: oxidative phosphorylation. substrate-level phosphorylation. fermentation. pyruvate oxidation. glycolysis. the citric acid cycle.

oxidative phosphorylation.

A molecule that is _____ loses electrons, and a molecule that is _____ gains electrons. reduced; oxidized negative; positive weak; polar polar; nonpolar oxidized; reduced None of the other answer options is correct.

oxidized; reduced

Energy is transferred from ATP to other molecules by transferring a(n) ______. spring heat photon adenosine phosphate group package of energy

phosphate group

Photosynthesis in green plants is comprised of _____, in which H2O is oxidized; _______, in which NADPH is produced; and _____, in which CO2 is reduced. Calvin cycle; photosynthetic electron transport chain; ATP synthase photosystem II; electron transport chain: photosystem I photosystem I; photosystem II; the dark cycle photosystem II; photosystem I; the Calvin cycle CO2 reduction; NADPH oxidation; rubisco

photosystem II; photosystem I; the Calvin cycle

All cells have a ___, whereas not all cells have a(n) ___. plasma membrane; RNA or DNA nucleus; nuclear membrane nucleus; cytoplasm plasma membrane; nuclear membrane nucleus; plasma membrane

plasma membrane; nuclear membrane

Which of these levels of protein structure involve peptide bonds? quaternary primary tertiary secondary

primary

The _____ forms of the electron carriers NAD+/NADH and FAD/FADH2 have high potential energy. reduced none of these answers are correct negative charged oxidized

reduced

The potential energy in a molecule of ATP that is harnessed to do the work of the cell is held in part in the: the carbon-oxygen bonds of the sugar. carbon-carbon bonds of the sugar. repulsion of the sugar and the base. the carbon-nitrogen bonds of the base. repulsion of the phosphate groups from each other.

repulsion of the phosphate groups from each other.

During meiosis II: non-sister chromatids exchange maternal and paternal DNA. sister chromatids are separated. bivalents are formed during prophase II and are taken apart during anaphase II. All of these choices are correct. chromosomes undergo reductional division.

sister chromatids are separated.

Select all that are true of mitosis. sister chromatids separate during anaphase can be conducted without proteins it's a form of asexual reproduction it generates genetic diversity homologs separate during anaphase

sister chromatids separate during anaphase it's a form of asexual reproduction

Which of these is NOT true? In humans, if two sperm fertilize one egg (dispermy) then the zygote will be triploid have three of every gene have three of every chromosome have three sets of genetic information split into identical triplets

split into identical triplets

A cell cycle "checkpoint" would be best described as: -stages where progress of the cell cycle can be halted. -prophase, metaphase, anaphase or telophase. -any step in the cell cycle that is blocked by a mutated protein. -site in the cell where proteins are inspected for mutations. -all of these are correct

stages where progress of the cell cycle can be halted.

In chloroplasts, _____ is the source of the ENERGY needed for photosynthesis. sunlight NADPH glucose O2 CO2 H20

sunlight

Aquaclear is a new general herbicide for aquatic plants. It is effective against freshwater but not saltwater plants. It works by breaking down the cell walls of the plants and the freshwater plants die because their cells accumulate large concentration of the herbicide which causes them to.... (Hint: Think osmosis. When solute (herbicide) concentration is high inside the cells water concentration is low) -shrink and cease to function. -swell and burst. -remain the same size but malfunction. -are crushed by the weight of the plant.

swell and burst.

The fully folded structure of a functional protein composed of a single polypeptide chain is referred to as: tertiary quaternary primary secondary polypeptide

tertiary

Which of these levels of protein structure involve side chain interactions on a single polypeptide? primary tertiary quaternary secondary

tertiary

What is energy? a measure of disorder metabolism the capacity to cause movement the capacity to do work a measure of calories

the capacity to do work

Energy is required in order to add a nucleotide to the growing strand of DNA during replication. From where does that energy come? helicase ATP primase the incoming nucleotide DNA ligase DNA polymerase

the incoming nucleotide

Which of the following is true in a comparison of your skin cells to your kidney cells. one came from mom and the other from dad transcribe many different genes contain different genes conduct translation differently

transcribe many different genes

Select the TWO answers below that would diffuse across a plasma membrane the slowest. H2O N2 H+ glucose H2O O2

H+ glucose

A skin cell in G2 of interphase has _____ as much DNA as it had in G1. twice half one-fourth four times exactly

twice

Several chemical properties make water uniquely suited for its role as an essential "molecule of life". Which statement is FALSE? -Water resists temperature changes. -The structure of a water molecule is stabilized by hydrogen bonds. -Hydrogen bonding leads to high cohesiveness between water molecules. -Water resists temperature changes.

The structure of a water molecule is stabilized by hydrogen bonds.

Which example represents the reduced forms of the two major electron carriers? NAD+ and FADH2 DNA and RNA NADH and FADH2 NAD+ and FAD CO2 and O2 NADH and FAD

NADH and FADH2

Which of the answer choices are produced directly as a result of the movement of electrons through the photosynthetic electron transport chain? ATP CO2 NADH H20 carbohydrates NADPH

NADPH

The unfolding of a protein by heat or chemical treatment is referred to as denaturation. depolymerization. uncoupling. hydrolysis. disaggregation.

denaturation.

What is the final (terminal) electron acceptor in the electron transport chain? NAD+ ADP NADH ATP oxygen (O2) glucose

oxygen (O2)

The [H+] of a solution changes from .000001 to .000000001. Did the pH increase or decrease? What did the pH change to? pH increased to 9 pH decreased to 3 pH decreased to 1000 pH increased to 1000

pH increased to 9

Independent assortment of chromosomes is a result of ________. -the random distribution of the sister chromatids to the two daughter cells during anaphase II -the diverse combination of alleles that may be found within any given chromosome -The random assortment of sequences due to crossover -the random combinations of eggs and sperm during fertilization -the random way each pair of homologous chromosomes lines up at the metaphase plate during meiosis I

-the random way each pair of homologous chromosomes lines up at the metaphase plate during meiosis I

The potassium atom (uncharged) has [ANSWER] protons and [ANSWER] electrons. The potassium ion (charged) has [ANSWER] protons and [ANSWER] electrons. Potassium has the same number of electron shells as [ANSWER] and the same number of valence electrons as [ANSWER]. Compared to Potassium, living cells have more of the element [ANSWER] and less of the element [ANSWER].

19 19 19 18 Calcium (Ca) and Zinc (Zn) Sodium (Na) and Lithium (Li) phosphorus (P) Neon (Ne)

Match these properties/functions with the appropriate biomolecules: *Small high energy molecule that is provides usable energy for cellular work. *Can form a hydrophobic/water repelling barrier. *Primary information storing biomolecule *Most abundant organic biomolecule in an organism *Solvent in which nearly all life's chemical reactions occur

ATP Lipids Nucleic acids Protein Water

If you crossed two heterozygous yellow-seed pea plants (genotypes Aa), the relative frequency of: -homozygous yellow-seed plants (genotype AA) would be 1/4. -Heterozygous yellow-seed pea plants would be 1/2. -the a allele in each parent's gametes would be 1/2. -green-seed plants (genotype aa) would be 1/4. -All of these choices are correct. -the A allele in each parent's gametes would be 1/2.

All of these choices are correct.

Which of these choices is due to the ability of phospholipids to spontaneously form macromolecular structures when added to an aqueous solution? The ability of vesicles to bud off from the plasma membrane (endocytosis). The ability of vesicles to fuse with the plasma membrane (exocytosis). The first cells. The formation of lipid bilayers. All of these choices are correct.

All of these choices are correct.

Why does active transport of molecules across a membrane require ATP? -An input of energy is needed to move all molecules across a membrane. -An input of energy is needed to allow the movement of molecules from an area of low concentration to one of higher concentration. -An input of energy is needed to speed up the rate of facilitated diffusion. -An input of energy is needed because the movement of molecules requires the synthesis of additional membrane.

An input of energy is needed to allow the movement of molecules from an area of low concentration to one of higher concentration.

In chloroplasts, _____ is the source of the CARBON needed for photosynthesis. fertilizer G3P glucose CO2 (in air) soil citrate H20 ATP

CO2 (in air)

Which one of the choices is capable of phosphorylating key proteins involved in regulating the cell cycle? cyclin-CDK complex phosphatases cyclin alone p53 protein CDK alone

cyclin-CDK complex

Genetic information is stored within the sequence of _________. This information is transcribed into a sequence of ________ which are then translated into a sequence of _______. DNA nucleotides. amino acids, RNA nucleotides fatty acids. nucleic acids, amino acid fatty acids. nucleic acids, amino acids. RNA nucleotides. DNA nucleotides, amino acids DNA nucleotides. RNA nucleotides, amino acids

DNA nucleotides. RNA nucleotides, amino acids

Assuming that transcription and translation both proceed from left to right, which is the correct orientation of the DNA template, the RNA transcript, and the protein product? DNA template 3'- ......... -5' / RNA transcript 5'- ......... -3' / Protein product HOOC-......... -NH2 DNA template 3'- ......... -5' / RNA transcript 5'- ......... -3' / Protein product H2N- ......... -COOH DNA template 5'- ......... -3' / RNA transcript 3'- ......... -5' / Protein product HOOC-......... -NH2 DNA template 5'- ......... -3' / RNA transcript 5'- ......... -3' / Protein product H2N-......... -COOH

DNA template 3'- ......... -5' / RNA transcript 5'- ......... -3' / Protein product H2N- ......... -COOH

The energy from the movement of electrons through the electron transport chain is directly used to synthesize ATP. True False

False

The correct sequence of steps in the eukaryotic cell cycle is: G0→ S phase → G1→ G2→cytokinesis → mitosis. G0→ S phase → G1→ S phase → G2→ cytokinesis → mitosis. G0→ S phase → G1→ S phase → G2→ mitosis → cytokinesis. G1→ S phase → G2→ cytokinesis → mitosis. G1→ S phase → G2→ mitosis → cytokinesis.

G1→ S phase → G2→ mitosis → cytokinesis.

What is the principle product of the Calvin cycle that is exported from the chloroplast for use by the plant cell? sucrose and glucose NADPH RuBP ATP G3P (triose phosphate)

G3P (triose phosphate)

Secondary active transport in yeast and plant cells uses the _______ concentration gradient, whereas animal cells use the ______________ gradient. ATP ... Ca++ ATP ... and Na+/K+ Na+/K+ .... H+ H+ .... Na+/K+ Ca++ .... H+ H+ and Na+ .... K+

H+ .... Na+/K+

In chloroplasts, _____ is the source of the ELECTRONS needed for photosynthesis. NADPH H+ H2O CO2 glucose O2

H2O

A researcher is studying phases of the cell cycle in a population of cells during which there is an increase in the DNA content. This stage is most likely: meiosis cytokinesis. S phase. G1 phase. mitosis. G2 phase.

S phase.

Which of the following sequences accurately represents the flow of electrons through living organisms? H2O → photosynthesis → carbohydrate → cellular respiration → ATP H2O → photosynthesis → carbohydrate → cellular respiration → H2O CO2 → H2O → chlorophyll → carbohydrate → cellular respiration → ATP CO2 → photosynthesis → carbohydrate → cellular respiration → ATP O2 → cellular respiration → carbohydrate → photosynthesis → CO2

H2O → photosynthesis → carbohydrate → cellular respiration → H2O

During photosynthesis in plants and algae, ____ is oxidized and ____ is reduced. NADPH; ATP CO2; H2O ATP; NADPH O2; CO2 H2O; CO2 H2O; O2

H2O; CO2

In humans (a diploid bipedal primate), a widows peak hairline (H) is dominant to a straight hairline (h). Having freckles (F) is dominant to having no freckles (f). These traits assort independently. A person with a widows peak and freckles could have which of the following genotypes? (select all that apply) HF HHFF hhff HHff HhFf hhFF

HHFF HhFf

Which of these statements is incorrect concerning homologous chromosomes? -Homologous chromosomes undergo crossing over in prophase I of meiosis. -Four sister chromatids are present for each set of homologous chromosomes at prophase I. -One of the homologous chromosomes come from each parent. -Homologous chromosomes have identical alleles for every gene before crossing over. -Homologous chromosomes separate during anaphase I.

Homologous chromosomes have identical alleles for every gene before crossing over.

Which of the following happens by the end of meiosis I? The chromosome number per cell remains the same. Homologous chromosomes of a pair are separated from each other. Centromeres divide. Sister chromatids are separated. Four daughter cells are formed.

Homologous chromosomes of a pair are separated from each other.

Which of the following statements describes translation initiation in Eukaryotes: -Initiation factors provide a primer for DNA polymerase. -The ribosome's large subunit binds to AUG codon on the mRNA. -The ribosome's large subunit, tRNA, and P-site scan the mRNA for codons. -Initiation factors, a tRNAmet, and the ribosome's small subunit bind to the poly-A tail of mRNA. -A ribosome binds to the C-terminus of an mRNA. -The ribosome's large subunit binds to the small subunit at the initiation site. -Initiation factors, a tRNAmet, and the ribosome's small subunit bind to the 5'cap of mRNA.

Initiation factors, a tRNAmet, and the ribosome's small subunit bind to the 5'cap of mRNA.

Why is DNA ligase important for a cell? Select all that apply. -It joins DNA together from different origins of replication. -It relieves the stress of DNA unwinding. -It joins Okazaki fragments on the discontinuous lagging strand. -It fills in the 10 nucleotide gap where the RNA primer was removed. -It unwinds DNA.

It joins DNA together from different origins of replication. It joins Okazaki fragments on the discontinuous lagging strand.

Agrobacterium is a bacterium that infects plants and causes them to form tumors. You are asked to determine how long a plant must be exposed to these bacteria to become infected. Which of the following experiments will provide the best data to address that question? -Measure the number of tumors formed on plants, which are exposed to a known concentration of Agrobacterium solution for different lengths of time. -Measure the concentration of Agrobacterium in different soil environments where the plants grow. -Measure the number of tumors formed on a plant when exposed to various concentrations of bacteria. -Measure the number of tumors formed on plants, which are exposed to different concentrations of an Agrobacterium solution for different lengths of time.

Measure the number of tumors formed on plants, which are exposed to a known concentration of Agrobacterium solution for different lengths of time.

What would happen if complexes I-IV of the electron transport chain pumped protons in the opposite direction? ATP synthase would operate in reverse. There would be too many electrons in the mitochondrial matrix. Too much ATP would be synthesized. No ATP would be synthesized.

No ATP would be synthesized.

After Meiosis, each human gamete should contain: Four copies of every gene. One copy of every gene. It differs from cell to cell. Two copies of every gene. Three copies of every gene.

One copy of every gene.

Which of the following statements are true? (choose all that apply) -Some amino acids are specified by just one codon, whereas others are specified by multiple codons. -Because there are 4 RNA nucleotides and each codon is 3 nucleotides long, there are 64 possible codons, each of which directs the ribosome to incorporate a different amino acid into a growing polypeptide chain. -The limitations of the genetic code are such that a single amino acid may be specified by no more than four codons. -Because there are three different possible reading frames in a messenger RNA (mRNA) molecule, most mRNAs can be translated in a cell into three different proteins.

Some amino acids are specified by just one codon, whereas others are specified by multiple codons.

At the end of what stage of mitosis has the amount of DNA per nucleus decreased? Telophase Metaphase Cytokinesis Prophase Anaphase

Telophase

If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level? -Nothing, because the RNA would be made as usual. -The mutation of the DNA would be carried through to the RNA sequence. -The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made. -The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made.

The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made.

Which statement best summarizes cellular respiration? -Chemical potential energy in the bonds of ADP is transferred to the chemical potential energy in the bonds of ATP. -Organic molecules, such as carbohydrates, are converted to kinetic energy that can be used to do the work of the cell. -The chemical potential energy stored in organic molecules is converted to chemical energy that can be used to do the work of the cell.

The chemical potential energy stored in organic molecules is converted to chemical energy that can be used to do the work of the cell.

If you made a big deletion of DNA in the promoter sequence of a gene, which of the following is likely to happen? The gene would not be transcribed The transcription factors will recognize and bind the DNA, initiating transcription The promoter is not transcribed, therefore RNA would be made as usual DNA polymerase would no longer be able to bind and carry out transcription None of these answers are correct The mutation of the DNA would be copied to the RNA sequence

The gene would not be transcribed

Although the phospholipid molecules can be in constant lateral movement, they very rarely flip from one side of the bilayer to the other. Which of the answer choices could explain this? The cholesterol keeps the phospholipids on the correct side. The head groups are too large to fit between the interior fatty acid tails. The head groups are repelled by the hydrophobic membrane interior. The molecular attraction between the fatty acid tails is too strong.

The head groups are repelled by the hydrophobic membrane interior.

Which of the following statements must be true in order for mitochondrial ATP synthase to function properly? -There must be no difference in pH between the mitochondrial matrix and the intermembrane space. -pH has nothing to do with the production of ATP. -The pH of the intermembrane space must be lower than the pH of the mitochondrial matrix. -The pH of the intermembrane space must be higher than the pH of the mitochondrial matrix.

The pH of the intermembrane space must be lower than the pH of the mitochondrial matrix.

Predict how phospholipids would arrange if they were placed in a nonpolar solution rather than a polar solution like water. -The phospholipids would form a normal liposome. -The phospholipids would form a monolayer. -The phospholipid tails would orient toward the solution, and the -heads would cluster away from the solution. -The phospholipid heads would orient toward the solution, and the tails would cluster away from the solution.

The phospholipid tails would orient toward the solution, and the heads would cluster away from the solution.

The enzyme rubisco can catalyze two seemingly conflicting reactions. It is both a carboxylase and an oxygenase. When the enzyme first evolved, why was this probably less of a problem? There was very little CO2 in the atmosphere. There was very little O2 in the atmosphere. he only photosynthetic organisms were bacteria. There was much more CO2 in the atmosphere. The atmosphere had mostly heavy O2 (18O2).

There was very little O2 in the atmosphere.

Which of the statements is the best description of mutations in DNA? All of these choices are correct. They arise in order to harm an organism. They arise in order to benefit an organism. They do not affect an organism. They occur randomly.

They occur randomly.

A 0.9% NaCl solution is isotonic (aka same concentration) to red blood cells. Which of these describes the results if red blood cells are placed into a 9% solution of NaCl? (Hint: Think osmosis. Draw it out. Show salt and water and figure out where there is more water and then how water will move.) -None of the above. -They will burst. -They will shrink.

They will shrink.

The concentration of NaCl inside a red blood cell is 0.9%. Which of these describes the results if red blood cells are placed into a 9% solution of NaCl? Nothing will happen They will shrivel They will burst

They will shrivel

Promoters of many genes have regions that are rich in adenines and thymines. What is the most likely reason for this? -RNA polymerases are better at incorporating uracils and thymines into RNA molecules than incorporating guanines and cytosines. -It is possible to create more unique sequences for recognition with adenines and thymines than with guanines and cytosines. -all of these choices are correct. -Transcription factors bind more easily to AT-rich sequences than they do to GC-rich sequences. -This is the region where template and nontemplate strands separate, and A-T base pairs require less energy to separate than G-C base pairs. -None of the other answer options is correct.

This is the region where template and nontemplate strands separate, and A-T base pairs require less energy to separate than G-C base pairs.

One of your friends is arguing that viruses are alive. What information would you provide to convince him that viruses can't be considered alive? -Viruses are much more closely related to archaeons than bacteria. -Viruses contain either RNA or DNA but not both. -Viruses cannot carry out metabolic reactions (use energy) on their own. -Viruses typically have protein coats and no plasma membrane.

Viruses cannot carry out metabolic reactions (use energy) on their own.

Match the functional group with the correct property (each property will only be used once). Carboxyl Amino Carbonyl Hydrocarbon

acidic basic polar nonpolar

Suppose you are studying the transport of a certain polar molecule across the plasma membrane of cells in culture. Over a period of time, you measure the concentration of a polar molecule inside and outside of the cells. You find that the concentration of the molecule is higher in the cell and is gradually increasing. You also measure the ATP concentration inside the cell and find that it is decreasing. Which of the following is probably responsible for the transport of this polar substance into the cell? facilitated diffusion endocytosis active transport secondary active transport simple diffusion

active transport

The interactions between amino acids are major factors in determining the shape of a protein. These interactions can be affected by the environment surrounding a protein. Which factor would have an effect on the shape of a protein? -all of these choices are correct. -Whether the other molecules in the environment are predominantly hydrophilic or hydrophobic affects the shape of a protein.. -The temperature of the environment affects the shape of a protein. -The concentrations of ions present in the environment affects the shape of a protein. -The pH of the environment affects the shape of a protein.

all of these choices are correct.

A phospholipid molecule in a membrane can: -only flip (rotate between the two halves of the bilayer). -both spin (rotate around its vertical axis) and move side-to-side (lateral movement). -only spin (rotate around its vertical axis). -only move side-to-side (lateral movement). -only flip (rotate between the two halves of the bilayer), spin (rotate around its vertical axis), and move side-to-side (lateral movement).

both spin (rotate around its vertical axis) and move side-to-side (lateral movement).

What cellular process(es) is/are responsible for the increase in protein content associated with the gap (G1 and G2) phases of the cell cycle? DNA replication transcription alone both transcription and translation translation alone glycolysis

both transcription and translation

When carrying out a controlled experiment, it is important to: -subject different groups to different conditions. -change only one variable at a time. -change multiple variables at once to see the full effect of the variables. -All of these choices are correct.

change only one variable at a time.

In aerobic respiration, NADH is oxidized at _____, while FADH2 is oxidized at _____. complex II; complex III complex I; complex IV complex II; complex I complex I; complex II photosystem I; photosystem II

complex I; complex II

Sexual reproduction increases the genetic variability of a population more than does asexual reproduction because of all of these answers are correct mutation separating of sister chromatids crossing over a diploid organism having twice as much information

crossing over

Which component of a phospholipid is found in the interior of a lipid bilayer? phosphate group glycerol variable group fatty acids nucleic acids

fatty acids

Where does the globular F1 subunit of ATP synthase get its energy to catalyze the synthesis of ATP? from ADP directly from food from the oxidation of NADH from the hydrolysis of ATP the pH difference causes F1 and F0 protein subunits to unfold from rotational (kinetic) energy provided by the flow of protons through the channel in the Fo subunit

from rotational (kinetic) energy provided by the flow of protons through the channel in the Fo subunit

According to the principle of segregation, a heterozygous plant with alleles Aa will produce: gametes with only the A allele. some gametes with the A allele and some with the a allele, but in no predictable ratio gametes with only the a allele. gametes in the ratio of 3 A alleles:1 a allele. gametes in the ratio of 1 A allele: 1 a allele.

gametes in the ratio of 1 A allele: 1 a allele.

Certain complexes of the mitochondrial electron transport chain pump protons. Protons are pumped across the _____ mitochondrial membrane, from the _____ to the _____. inner; matrix; intermembrane space plasma; outside of cell; inside of cell. inner; intermembrane space; matrix outer; inside of cell; outside of cell. outer;cytoplasm;intermembranespace outer; intermembrane space; cytoplasm

inner; matrix; intermembrane space

Which step of the Calvin cycle would be affected first by a lack of NADPH? All of these choices are correct. carboxylation in the Calvin cycle. proton pump in the thylakoid regeneration of intermediate in the Calvin cycle. chemiosmosis in the thylakoid light harvesting in the thylakoid reduction in the Calvin cycle.

reduction in the Calvin cycle.

In Enzyme A, leucine, tryptophan, and alanine are crucial for the binding of the substrate at the active site. Which of the following characteristics do you predict that the substrate of Enzyme A will possess? relatively hydrophobic hydrophilic, with a negative charge hydrophilic, with a positive charge hydrophilic, but without a charge

relatively hydrophobic

When the peptide bond is created between amino acid 1 and amino acid 2: -the amino group of amino acid 1 is joined to the carboxyl group of amino acid 2. -the amino group of amino acid 1 is joined to the amino group of amino acid 2. -the carboxyl group of amino acid 1 is joined to the carboxyl group of amino acid 2. -the carboxyl group of amino acid 1 is joined to the amino group of amino acid 2.

the carboxyl group of amino acid 1 is joined to the amino group of amino acid 2.

Which of these events includes a checkpoint in the cell cycle? the transition from anaphase to telophase the transition from G1 to S phase All of these events include a checkpoint in the cell cycle. the transition from S phase and the completion of DNA synthesis to G2 phase

the transition from G1 to S phase

An explanation supported by a large body of observations and experimentation is referred to as a(n): -investigation -opinion -prediction -theory -hypothesis -supposition

theory

Chloroplast ATP synthases are powered by the flow (facilitative diffusion) of protons from the: intermembrane space to the cytoplasm. thylakoid lumen to the stroma. thylakoid lumen to the intermembrane space. intermembrane space to the matrix. stroma to the intermembrane space. stroma to the thylakoid lumen.

thylakoid lumen to the stroma.

Which of the following is true of phospholipids? unsaturated fatty acids have lower melting points saturated fatty acids have lower melting points None of these answers are correct unsaturated fatty acids have more hydrogen than saturated ones a single layer of phospholipids forms a plasma membrane

unsaturated fatty acids have lower melting points

Which of the following molecules crosses through a semipermeable membrane during the process of osmosis? glucose all of the above proteins water sodium

water

Random fertilization refers to the fact that mates are chosen at random none of these answers are correct there are nearly limitless ways that homologs can exchange DNA during crossing over we cannot predict which two gametes will come together

we cannot predict which two gametes will come together