Biology 2440 Final Exam Review
Which of the following statements about RNA splicing is FALSE? a. Conventional introns are not found in bacterial genes b. for a gene to function properly, every exon must be removed from the primary transcript in the same fashion on every mRNA molecule produced from the same gene c. Small RNA molecules in the nucleus perform the splicing reactions necessary for the removal of introns d. Splicing occurs after the 5' cap has been added to the end of the primary transcript
B. for a gene to function properly, every exon must be removed from the primary transcript in the same fashion on every mRNA molecule produced from the same gene
You are examining the DNA sequences that code for the enzyme phosphofructokinase in skins and Komodo dragons. You notice that the coding sequence that actually directs the sequence of amino acids in the enzyme is very similar in the two organisms but that the surrounding sequences vary quite a bit. What is the most likely explanation for this? a. Coding sequences are repaired more efficiently b. Coding sequences are replicated more accurately c. Coding sequences are packaged more tightly in the chromosomes to protect them from the DNA damage d. Mutation in coding sequences are more likely to be deleterious to the organism than mutations in non-coding sequences
d. Mutation in coding sequences are more likely to be deleterious to the organism than mutations in noncoding sequences
Which of the following is NOT a general mechanism that cells use to maintain stable patterns of gene expression as cells divide? a. A positive feedback loop, mediated by a transcriptional regulator that activates transcription of its own gene in addition to other cell-type-specific genes b. Faithful propagation of condensed chromatin structures as cells divide c. Inheritance of DNA methylation patterns when cell divide d. Proper segregation of housekeeping proteins when cells divide
d. Proper segregation of housekeeping proteins when cells divide
Which mechanisms best describe the process by which nutrients are taken up selectively at the apical surface of the epithelial cells that line the gut and released from their basal and lateral surfaces? a.Proteins are tethered to the cell cortex b.Proteins are tethered to the extracellular matrix c.Proteins are tethered to the proteins on the surface of another cell d.Protein movement is limited by the presence of a diffusion barrier
d. Protein movement is limited by the presence of a diffusion barrier
What would be the most obvious outcome of repeated cell cycles consisting of S phase and M phase only? a. The cells would not be able to replicate their DNA b. The mitotic spindle could not assemble c. The cells would get larger and larger d. The cells produced would get smaller and smaller
d. The cells produces would get smaller and smaller
Telomeres serve as caps protecting the ends of linear chromosomes. Which of the following is FALSE regarding the replication of telomeric sequences? a. The lagging-strand telomeres are not completely replicated by DNA polymerase b. Telomeres are made of repeating sequences c. Additional repeated sequences are added to the template strand d. The leading strand doubles back on itself to form a primer for the lagging strand
d. The leading strand doubles back on itself to form a primer for the lagging strand
Which of the following statements is TRUE? a. The mitotic spindle is largely made of intermediate filaments b. the contractile ring is made largely of microtubules and actin filaments c. The contractile ring divides the nucleus in two d. The mitotic spindle helps segregate the chromosomes to the two daughter cells
d. The mitotic spindle helps segregate the chromosomes to the two daughter cells
Which of the following statements correctly explains what it means for DNA replication to be bidirectional? a. The replication fork can open or close, depending on the conditions b. The DNA replication machinery can move in either direction on the template strand c. Replication-fork movement can switch direction when the fork converges on another replication fork. d. The replication forks formed at the origin move in opposite directions
d. The replication forks formed at the origin move in opposite directions
In a DNA double helix a. The two DNA strands are identical b. Purines pair with purines c. Thymine pairs with cytosine d. The two DNA strands run antiparallel
d. The two DNA strands run antiparallel
The correct folding of proteins is necessary to maintain healthy cells and tissues. The presence of unfolded proteins are associated with some neurodegenerative disorders as Alzheimer's disease, Huntington's disease, and Creutzfeldt-Jakob disease (the specific faulty protein is different for each disease). What happens to these disease-causing, unfolded proteins? a. They are degraded b. They bind a different target protein c. They form structured filaments d. They form protein aggregates
d. They form protein aggregates
Human beings with inherited disease xeroderma pigmentosum have serious problems with lesions on their skin and often develop skin cancer with repeated exposure to sunlight. What type of DNA damage is not being recognized in the cells of these individuals? a. Chemical damage b. X-ray irradiation damage c. Mismatched bases d. Ultraviolet irradiation damage
d. Ultraviolet irradiation damage
Which of the following statements is FALSE? a. A new RNA molecule can begin to be synthesized from a gene before the previous RNA molecule's synthesis is completed b. If two genes are to be expressed in a cell, these two genes can be transcribed with different efficiencies c. RNA polymerase is responsible for both unwinding the DNA helix and catalyzing the formation of the phosphodiester bonds between nucleotides. d. Unlike DNA, RNA uses a uracil base and a deoxyribose sugar
d. Unlike DNA, RNA uses a uracil base and a deoxyriose sugar
Select the answer that BEST completes the following statement: Chemical reactions in living systems occur in an _____________ environment, within a narrow range of temperatures. a. optimal b. organic c. extracellular d. aqueous
d. aqueous
Despite the differences between eukaryotic and prokaryotic cells, prokaryotes have proteins that are distantly related to eukaryotic actin filaments and microtubules. What is likely to be the most ancient function of the cytoskeleton? a. cell motility b. vesicle transport c. membrane transport d. cell division
d. cell division
Cells require one particular monosaccharide as a starting material to synthesize nucleotide building blocks. Which of the monosaccharides below fills this important role? a. glucose b. fructose c. ribulose d. ribose
d. ribose
Macromolecules in the cell can often interact transiently as a result of non-covalent interactions. These weak interactions also produce stable, highly specific interactions between molecules. Which of these factors below is the most significant in determining whether the interaction will be transient or stable? a. The size of each molecule b. the concentration of each molecule c. the rate of synthesis d. surface complementarity between molecules
d. surface complementarity between molecules
Polar covalent bonds are formed when the electrons in the bond are not shared equally between the two nuclei. Which of these molecules contains polar bonds? a. molecular oxygen b. methane c. propane d. water
d. water
Which of the following statements is TRUE? a. anaphase A must be completed before anaphase B. can take place b. In cells in which anaphase B predominates, the spindle will elongate much less than in cells in which anaphase A dominates c. In anaphase A, both kinetochore and interpolar microtubles shorten. d. In anaphase B, microtubules associated with the cell cortex shorten.
D. In anaphase B, microtubules associated with the cell cortex shorten
There are 90 naturally occurring elements on the earth, _____________ of which compose 96% of the mass of living organisms. a. 4 b. 6 c. 7 d. 8
a. 4
Which of the following molecule of RNA would you predict to be most likely to fold into a specific structure as a result of intramolecular base-pairing? a. 5' - CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG - 3' b. 5' - UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG - 3' c. 5' - AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA - 3' d. 5' -GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG - 3'
a. 5' - CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG - 3'
Which statement is NOT true about mutations? a. A mutation is a change in the DNA that can generate offspring less fit for survival than their parents b. A mutation can be a result of imperfect DNA duplication c. A mutation is a result of sexual reproduction d. A mutation is a change in the DNA that can generate offspring that are as fit for survival as their parents are
a. A mutation is a results of sexual reproduction
Polypeptides are synthesized from amino acid buildings blocks. The condensation reaction between the growing polypeptided chain and the next amino acids to be added involves the loss of a. A water molecule b. An amino group c. A carbon atom d. A carboxylic acid group
a. A water molecule
Pumps are transporters that are able to harness every provided by other components in the cell to drive the movement of solutes across membranes, against their concentration gradient. This type of transport is called
a. Active transport
The process of generation monoclonal antibodies is labor-intensive and expensive. An alternative is to use polyclonal antibodies. A subpopulation of purified polyclonal antibodies that recognize a particular antigen can be isolated by chromatography. Which type of chromatography is used for this purpose? a. Affinity b. Ion-exchange c. Gel-filtration d. All of the answers are correct
a. Affinity
Which of the following channels would not be expected to generate a change in voltage by the movement of its substrate across the membrane where it is found? a.An aquaporin b.A sodium channel c.A calcium channel d.A proton channel
a. An aquaporin
Programmed cell death occurs a. By means of an intracellular suicide program b. Rarely and selectively only during animal development c. Only in unhealthy or abnormal cells d. Only during embryonic development
a. By means of an intracellular suicide program
You have isolated a strain of mutant yeast cells that divides normally at 30C but cannot enter M phase at 37C. you have isolated its mitotic cyclin and mitotic Cdk and find that both proteins are produced and can form a normal sensitive mutations could NOT be responsible for the behavior of this strain of yest? a. CDC25 dephosphorylation of Wee1 activates the kinase, promotin the G2/ M transition b. Phosphorylation of mitotic Cdk by the inhibitory kinase (Wee1) makes the Cdk inactive. c. Inhibiting the Cdc25 phosphatase will delay the G2/M transition. d. The activatin phosphate (Cdc25) removes the phosphates from mitotic Cdk that were added by Wee1, so that M-Cdk will be active
a. CDC25 dephosphorylation of Wee1 activates the kinase, promotin the G2/ M transition
Plasma membranes are extremely thin and fragile, requiring an extensive support network of fibrous proteins. This network is called the a.Cortex b.Attachment complex c.Cytoskeleton d.Spectrin
a. Cortex
Mitogens are a. Extracellular signals that stimulate cell division b. Transcription factors important for cyclin production c. Kinases that cause cells to grow in size.
a. Extracellular signals that stimulate cell division
The energy required by the cell is generated in the form of ATP. ATP is hydrolyzed to power many of the cellular processes, increasing the pool of ADP. As the relative amount of ADP molecules increased, they can bind to glycolytic enzymes, which will lead to the production of more ATP. The best way to describe the mechanism of regulation is a. Feedback inhibition b. Oxidative phosphorylation c. Allosteric activation d. Substrate-level phosphorylation
a. Feedback inhibition
Which of the following statements about the cell cycle is False? a. Once a cell decides to enter the cell cycle, the time from start to finish is the same in all eukaryotic cells b. An unfavorable environment can cause cells to arrest in G1 c. A cell has more DNA during G2 than it it did in G1 d. The cleavage divisions that occur in an early embryo have short G1 and G2 phases.
a. Once a cell decides to enter the cell cycle, the time from start to finish is the same in all eukaryotic cells
Transcription in bacteria differs from transcription in a eukaryotic cell because a. RNA polymerase (along with its sigma subunit) can initiate transcription on its own b. RNA polymerase (along with its sigma subunit) requires the general transcription factors to assemble at the promoter before polymerase can begin transcription c. The sigma subunit must associate with the appropriate type of RNA polymerase to produce mRNAs d. RNA polymerase must be phosphorylated at its C-terminal tail for transcription to proceed
a. RNA polymerase (along with its sigma subunit) can initiate transcription on its own
Complete the sentence with the best option provided below. The secondary structures of a protein are the a. Regular, repeated folds presented in a lowest energy conformation b. Interactions between polar amino acid side chains c. Chemical modifications of amino acid side chains
a. Regular, repeated folds presented in a lowest energy conformation
Sister chromatid separation occurs because ______ are destroyed by the APC/C. a. securins b. Cohesions c. Kinetochores d. Condensins
a. Securins
Transporters, in contrast to channels, work by a.Specific recognition of transport substrates b.A gating mechanism c.Filtering solutes by charge d.Filtering solutes by size
a. Specific recognition of transport substates
Which of the following statements about the Lac OPERON is FALSE? a. The Lac repressor binds when lactose is present in the cell b. Even when the CAP activator is bound to DNA, if lactose is not present, the Lac operon will not be transcribed c. The CAP activator can only bind DNA when it is bound to cAMP d. The Lac operon only produces RNA when lactose is present and glucose is absent
a. The Lac repressor binds when lactose is present in the cell
A friend declares that chromosomes are held at the metaphase plate by microtubules that push on each chromosome from opposite sides. Which of the following observations does not support your belief that the microtubules are pulling on the chromosomes? a. The jiggling movement of chromosomes at the metaphase plate b. The way in which chromosomes behave when the attachment to one kinetochore is severed d. The shape of chromosomes as they move toward the spindle poles at anaphase
a. The jiggling movement of chromosomes at the metaphase plate
The chemistry of life is carried out and coordinated primarily by small molecules. a. True b. False
b False
How many replication forks are formed when an origin of replication is opened? a. 1 b. 2 c. 3 d. 4
b. 2
You have a piece of DNA that includes the following sequence: 5' - ATAGGCATTCGATCCGGATAGCAT - 3' 3' - TATCCGTAAGCTAGGCCTATCGTA - 5 Which of the following RNA molecules could be transcribed from this piece of DNA? a. 5' - UAUCCGUAAGCUAGGCCUAUGCUA - 3' b. ' - AUAGGCAUUCGAUCCGGAUAGCAU - 3' c. 5' - UACGAUAGGCCUAGCUUACGGAUA - 3' d. none of these answers is correct
b. 5' - AUAGGCAUUCGAUCCGGAUAGCAU - 3'
Homologous recombination is an important mechanism in which organisms use a "backup" copy of the DNA as a template to fix double-strand breaks without loss of genetic information. Which of the following is NOT necessary for homologous recombination to occur? a. 3' DNA strand overhangs b. 5' DNA strand overhangs c. A long stretch of sequence similarity d. Nucleases
b. 5' DNA strand overhangs
Complete the sentence with the best option provided below. The primary structure of a protein is the a. Amino acid composition b. Amino acid sequence c. Average size of amino acid side chains d. Lowest energy conformation
b. Amino acid sequence
Membrane proteins, like membrane lipids, can move laterally by exchanging positions with other membrane components. Which type of membrane proteins is expected to be the least mobile, based on their functions? a. Channels b. Anchors c. Receptors d. Enzymes
b. Anchors
The world of prokaryotes is divided into two domains (bacteria and archaea), each as different from each other as from eukaryotes. Select the observable characteristics that BEST separate archaea from bacteria. a. Can metabolize inorganic substances b. Are found in extremely harsh environments c. thrive in anaerobic conditions d. are photosynthetic organisms
b. Are found in extremely harsh environments
How are most eukaryotic transcription regulators able to affect transcription when their binding sites are far from the promoter? a. By binding to their binding site and sliding to the site of RNA polymerase assembly b.By looping out the intervening DNA between their binding site and the promoter c.By unwinding the DNA between their binding site and the promoter d.By attracting RNA polymerase and modifying it before it can bind to the promoter
b. By looping out the intervening DNA between their binding site and the promoter
Which of the following is NOT a feature commonly observed in β sheets? a. Antiparrallel regions b. Coiled-coil patterns c. Extended polypeptide backbone d. Parallel regions
b. Coiled-coil patterns
Coiled-coils are typically found in proteins that require an elongated structural framework. Which of the following proteins do you expect to have coiled-coil domain? a. Insulin b. Collagen c. Myoglobin d. Porin
b. Collagen
A disaccharide consists of a sugar covalently linked to another molecule such as an amino acid or a nucleotide. a. True b. False
b. False
The number of mitochondria in a cell remains constant throughout the life of the cell. a. True b. False
b. False
The terms "prokaryote" and "bacterium" are synonyms. a. True b. False
b. False
The N-terminal tail of histone H3 can be extensively modified, and depending on the number, location, and combination of these modifications, these changes may promote the formation of heterochromatin. What is the result of heterochromatin formation? a. increase in gene expression b. Gene silencing c. Recruitment of remodeling complexes d. Displacement of histone H1
b. Gene silencing
Where does most new membrane synthesis take place in the eukaryotic cell? a. In the Golgi apparatus b. In the endoplasmic reticulum c. In the plasma membrane d. On ribosomes
b. In the endoplasmic reticulum
Proteins bind selectively to small-molecule targets called ligands. The selection of one ligand out of a mixture of possible ligands depends on the number of weak, non-covalent interactions in the protein's ligand-binding site. Where is the binding site typically located in the protein structure? a. On the surface of the protein b. Inside a cavity on the protein surface c. Buried in the interior of the protein d. Forms on the surface of the protein in the presence of the ligand
b. Inside a cavity on the protein surface
Cells use membranes to help maintain set ranges of ion concentrations inside and outside the cell. Which of the following ions is the most abundant inside a typical mammalian cell? a.Na+ b.K+ c.Ca2+ d.Cl-
b. K+
You are studying a disease that is caused by a virus, but when you purify the virus particles and analyze them you find they contain no trace of DNA. Which of the following molecules are likely to contain the genetic information of the virus? a. High-energy phosphate groups b. RNA c. Lipids d. Carhohydrates
b. RNA
Which of the following functions of the plasma membrane is possible without membrane proteins? a. Intercellular communication b. Selective permeability c. Cellular movement d. Import/export of molecules
b. Selective permeability
A mutation in the tRNA for the amino acid lysine results in the anticodon sequence 5' - UAU - 3' (instead of 5' - UUU - 3'). Which of the following aberrations in protein synthesis might this tRNA cause? a. Read-through of stop codons b. Substitution of lysing for isoleucine c. Substitution of lysine for tyrosine d. Substitution of lysine for phenylalanine
b. Substitution of lysing for isoleucine
Which of the following is NOT a chemical group commonly found on core histone N-terminal tails for chromatin regulation? a. Methyl b. Sulfhyldryl c. Phosphoryl d. Acetyl
b. Sulfhydryl
You have a bacterial strain with a mutation that removes the transcription termination signal from the Abd operon. Which of the following statements describes the most likely effect of this mutation on Abd transcription? a. The Abd RNA will not be produced in the mutant strain b. The Abd RNA from the mutant strain will be longer than normal c. Sigma factor will not dissociate from RNA polymerase when the Abd operon is being transcribed in the mutant strain d. RNA polymerase will move in a backward fashion at the Abd operon in the mutant strain
b. The Abd RNA from the mutant strain will be longer than normal
What do you predict would happen if your replace the Lac operator DNA from the Lac operon with the DNA from the operator region from the tryptophan operon? a. The presence of lactose will not cause allosteric changes to the Lac repressor b. The Lac operon will not be transcribed when tryptophan levels are high c. The lack of glucose will no longer allow CAP binding to the DNA d. RNA polymerase will only bind to the Lac promoter when lactose is present
b. The Lac operon will not be transcribed when tryptophan levels are high
which of the following events does NOT usually occur during interphase? a.Cells grow in size b. The nuclear envelope breaks down c. DNA is replicated d. The centrosomes are duplicated
b. The nuclear envelope breaks down
You have discovered a protein that inhibits translation. When you add this inhibitor to a mixture capable of translating human mRNA and centrifuge the mixture to separate polyribosomes and single ribosomes, you obtain the results shown below. Which of the following interpretation is consistent with these observations? a. The protein binds to the small ribosomal subunit and increases the rate of initiation of translation b. The protein binds to sequences in the 5' region of the mRNA and inhibits the rate of initiation of translation c. The protein binds to the large ribosomal subunit and slows down elongation of the polypeptide chain d. The protein binds to sequences in the 3' region of the mRNA and prevents termination of translation
b. The protein binds to sequences in the 5' region of the mRNA and inhibits the rate of initiation of translation
The DNA duplex consists of two long covalent polymers wrapped around each other many times over their entire length. The separation of the DNA strands for replication causes the strands to be "overwound" in front of the following replication fork. How does the cell relieve the torsional stress created along the DNA duplex during replication? a. Nothing needs to be done because two strands will be separated after replication is complete b. Topoisomerases break the covalent bonds of the backbone, allowing the local unwinding of DNA ahead of the replication fork c. Helicase unwinds the DNA and rewinds it after replication is complete d. DNA repair enzymes remove torsional stress as they replace incorrectly paired bases
b. Topoisomerases break the covalent bonds of the backbone, allowing the local unwinding of DNA ahead of the replication fork
Which of the following choices BEST describes the role of the lysosome? a. Transport of material to the Golgi apparatus b. clean-up, recycling, and disposal of macromolecules c. sorting of transport vesicles d. the storage of excess macromolecules
b. clean-up, recycling, and disposal of macromolecules
The second law of thermodynamics states that the disorder in any system is always increasing. In simple terms, you can think about dropping NaCl crystals into a glass of water. The solvation and diffusion of ions is favored because there is an increase in a. pH b. entropy c. ions d. stored energy
b. entropy
Activated carriers supply energy for catabolic reactions and are regenerated when coupled to anabolic reactions. a. true b. false
b. false
The source of all energy for living systems is chlorophyll. a. true b. false
b. false
Which of the following monomer building blocks is necessary to assemble selectively permeable boundaries around and inside cells? a. sugars b. fatty acids c. amino acids d. nucleotides
b. fatty acids
Your body extracts energy from the food you ingest by catalyzing reactions that essentially "burn" the food molecules in a stepwise fashion. What is another way to describe this process? a. reduction b. oxidation c. dehydration d. solvation
b. oxidation
Which subatomic particles contribute to the atomic mass for any given element? a. protons b. protons and neutrons c. neutrons d. protons and electrons
b. protons and neutrons
The potential energy stored in high-energy bonds is commonly harnessed when the bonds are split by the addition of______________ in a process called ________. a. ATP; phosphorylation b. water; hydrolysis c. hydroxide; hydration d. acetate; acetylation
b. water; hydrolysis
Which of the following mechanisms best describe the manner in which lysozyme lowers the energy required for its substrate to reach its transition-state conformation? a. By binding two molecules and orienting them in a way that favors a reaction between them b. By altering the shape of the substrate to mimic the conformation of the transition state c. By speeding up the rate at which water molecules collide with the substrate d. By binding irreversibly to the substrate so that it cannot dissociate
c. By speeding up the rate at which water molecules collide with the substrate
Apoptosis differs from necrosis in that necrosis a. Requires the reception of an extracellular signal b. Causes DNA to fragment c. Causes cells to swell and burst, where as apoptotic cells shrink and condense d. Involves a caspase cascade
c. Causes cells to swell and burst, where as apoptotic cells shrink and condense
Enhancers can act over long stretches of DNA, but are specific about which genes they affect. How do eukaryotic cells prevent these transcription regulators from looping in the wrong direction and inappropriately turning on the transcription of a neighboring gene? a. The cortisol-responsive genes share a DNA sequence in their regulatory regions that binds the cortisol-responsive transcriptional activator b. The cortisol-responsive genes must all be in an operon c. The transcriptional regulators that bind to the regulatory regions of the cortisol-responsive genes must all be the same d. The cortisol-responsive genes must not be transcribed in response to other hormones
c. Chromosome loop-forming proteins arrange the DNA into topological associated domains such that individual genes and their associated enhancer binding regions are in proximity
At the end of DNA replication, the sister chromatids are held together by the a. Kinetochrores b. securins c. Cohesins d. Histones
c. Cohesins
Operons a. Are commonly found in eukaryotic cells b. Are transcribed by RNA polymerase II c. Contain a cluster of genes transcribed as a single mRNA d. Can only be regulated by gene activator proteins
c. Contain a cluster of genes transcribed as a single mRNA
Which of the following substances is most commonly used to help purify a membrane protein? a.High salt solution b.Sucrose c.Detergent d.Ethanol
c. Detergent
Which of the following statements is TRUE? a. Disulfide bonds are formed by the cross-linking of methionine residues b. Disulfide bonds are formed mainly in proteins that are retained within the cytosol c. Disulfide bonds stabilize but do not change a protein's final conformation d. Disulfide bonds are more common for intracellular proteins, compared to extracellular proteins
c. Disulfide bonds are formed mainly in proteins that are retained with the cytosol
DNA replication is considered semiconservative because a. After many rounds of DNA replication, the original DNA double helix is still intact b. Each daughter DNA molecule consists of two new strands copied from the parent DNA molecule c. Each daughter DNA molecule consists of one strand from the parent DNA molecule and one new strand d New DNA strands must be copied form a DNA template.
c. Each daughter DNA molecule consists of one strand from the parent DNA molecule and one new strand
The concentration of mitotic cyclin (M clyclin) a. Rises maekdley during M phase b. Is activated by phsporylation c. Falls toward the end of M phase as a result of ubiquitylation and degradation d. Is the highest in G1 phase
c. Falls toward the end of M phase as a result of ubiquitylation and degradation
Consider two genes that are next to each other on a chromosome, as arranged: Which of the following is true: a. The two genes much be transcribed into RNA using the same strand of DNA b. If gene A is transcribed in a cell, gene B cannot be transcribed c. Gene A and B can be transcribed at different rates, producing different amounts of RNA within the same cell d. If gene A is transcribed in a cell, gene B must be transcribed
c. Gene A and gene B can be transcribed at different rates, producing different amounts of RNA within the same cell.
Which of the following statements about the anaphase-promoting complex (APC) is False? a. It promotes the degradation of proteins that regulate M phase b. It inhibits M-Cdk activity c. It is continuously active throughout the cell cycle d. M-Cdk stimulates its activity
c. It is continuously active throughout the cell cycle
RNA in cells differs from DNA in that a. It contains the base uracil, with pairs with cytosine b. It is single-stranded and cannot form base pairs c. It is single-stranded and can fold up into a variety of structures d. The sugar ribose contains fewer oxygen atoms than does deoxyribose
c. It is single-stranded and can fold up into a variety of structures
How does S-Cdk help guarantee that replication occurs only once during each cell cycle? a. It blocks the rise of Cdc6 concentrations early in g1 b. It phosphorylates and inactivates DNA helicase c. It phosphorylates and inactivates Cdc6 d. It promotes the assembly of a pre-replicative complex
c. It phosphorylates and inactivates Cdc6
In addition to the repair of DNA double-strand breaks, homologous recombination is a mechanism for generating genetic diversity by swapping segments of parental chromosomes. During which process does swapping occur? a. DNA replication b. DNA repair c. Meiosis d. Transposition
c. Meiosis
Which of the following statements is TRUE? a. Phospholipids will spontaneously form liposomes in non-polar solvents b.In eukaryotes, all membrane-enclosed organelles are surrounded by one lipid bilayer c. Membrane lipids diffuse within the plane of the membrane d. Membrane lipids frequently flip-flop between one monolayer and the other
c. Membrane lipids diffuse with the plane of the membrane
What type of macromolecule helps package DNA in eukaryotic chromosomes? a. Lipids b. Carbohydrates c. Proteins d. Rna
c. Proteins
Which of the following molecules is throught to have arisen first during evolution? a. Protein b. DNA c. RNA d. All came to be at the same time
c. RNA
The sigma subunit of bacterial RNA polymerase a. Contains the catalytic activity of the polymerase b. Remains part of the polymerase throughout transcription c. Recognizes promoter sites in the DNA d. Recognizes transcription termination sites in the DNA
c. Recognizes promoter sites in the DNA
some cells express aquaporin proteins- They are channel proteins that facilitate the flow of water molecules through the plasma membrane. What regulates the rate and direction of water diffusion across the membrane? a.Aquaporin conformation b.Resting membrane potential c.Solute concentrations on either side of the membrane d.Availability of ATP
c. Solute concentrations on either side of the membrane
The process of DNA replication requires that each of the parental DNA strands be used as a _______ to produce a duplicate of the opposing strand a. Catalyst b. Competitor c. Template d. Copy
c. Template
Protein E can bind to two different proteins, S and I. The binding reactions are described by the following equations and values: E + S → ES Keq for ES = 10 E + I → EI Keq for EI = 2 Given the equilibrium constant values, which of the following statements is true? a. E binds I more tightly than S b. When S is present in excess, no I molecules will bind to E c. The binding energy of the ES interaction is greater than that of the EI interaction d. Changing an amino acid on the binding surface of I from a basic amino acid to an acidic one will probably make the free energy of association with E more negative
c. The binding energy of the ES interaction is greater than that of the EI interation
Which of the following descriptions is consistent with the behavior of a cell that lacks a protein required for a checkpoint mechanism that operates in G2 a. The cell would be unable to enter M phase b. The cell would be unable to enter G2 c. the cell would enter M phase under conditions when normal cells would not d. The cell would pass through M phase more slowly than normal cells.
c. The cell would enter M phase under conditions when normal cells would not
a neuron and a white blood cell have very different functions. For example, a neuron can receive and respond to electrical signals, while white blood cell defends the body against infection. This is because a. All of the proteins found in a neuron are completely different from the proteins found in a white blood cell b. The neuron and the white blood cell within an individual have the same genome c. The neurons express some mRNAs that the white blood cell does not d. Neurons and white blood cells are differentiated cells and thus no longer need to transcribe and translate genes
c. The neurons express some mRNAs that the white blood cell does not
The Na+ -k+ ATPase is also known as the Na+- K+ pump. It is responsible for maintaining the high extracellular sodium ion concentration and the high intracellular potassium ion concentration. What happens immediately after the pump hydrolyzes ATP? a. Na+ is bound b. ADP is bound c. The pump is phosphorylated d. The pump changes conformation
c. The pump is phosphorylated
How do changes in histone modifications lead to changes in chromatin structure? a. they directly lead to changes in the positions of the core histones b. They change the affinity between the histone octamer and the DNA c. They help recruit other proteins to the chromatin d. They cause the histone N-terminal tails to become hyper extended
c. They help recruit other proteins to the chromatin
Although the chromatin structure of interphase is very compact, DNA-binding proteins and protein complexes must be able to gain access to the DNA molecule. Chromatin-remodeling complexes provide this access by a. Recruiting other enzymes b. Modifying the N-terminal tails of core histones c. Using the energy of ATP hydrolysis to move nucleosomes d. Denaturing the DNA by interfering with hydrogen-boding between base pairs.
c. Using the energy of ATP hydrolysis to move the nucleosomes
When there is an excess of nutrients available in the human body, insulin is released to stimulate the synthesis of glycogen from glucose. This is a specific example of a/an ______________ process, a general process in which larger molecules are made from smaller molecules. a. metabolic b. catabolic c. anabolic d. bionic
c. anabolic
You are a virologist interested in study the evolution of viral genomes. You are studying two newly isolated viral strains and have sequenced their genomes. You find that the genome of strain viral 1 contains 25% A, 55% G, 20% C and 10% T. You report that you have isolated a virus with a single-stranded DNA genome. Based on what evidence can you make this conclusion? a. because single-stranded genomes always have a large percentage of purines b. By using the formula G-A=C+T c. Because double-stranded genomes have equal amounts of A and T d. because single-stranded genomes have a higher rate of mutation
c. because double-stranded genomes have equal amounts of A and T
Energy cannot be created or destroyed, but it can be converted into other types of energy. Cells harvest some of the potential energy in the chemical bonds of foodstuffs to generate stored chemical energy in the form of activated carrier molecules, which are often employed to join two molecules together in ______________ reactions. a. oxidation b. hydrolysis c. condensation d. dehydrogenation
c. condensation
Mitochondria contain their own genome, are able to duplicate, and actually divide on a different time line from the rest of the cell. Nevertheless, mitochondria cannot function for long when isolated from the cell because they are a. viruses b. parasites c. endosymbionts d. anaerobes
c. endosymbionts
_______________ play an important role in organizing lipid molecules with long hydrocarbon tails into biological membranes. a. hydrogen bonds b. ionic bonds c. hydrophobic forces d. Van der Waals attractions
c. hydrophobic forces
Which of the following statements is TRUE? a. Peptide bonds are the only covalent bonds that can link together two amino acids in proteins b. There is free rotation around all covalent bonds in the polypeptide backbone c. Non-polar amino acids tend to be found in the interior of proteins d. The sequence of the atoms in the polypeptide backbone varies between different proteins
c. non-polar amino acids tend to be found in the interior of proteins
_________________ are fairly small organelles that provide a safe place within the cell to carry out certain biochemical reactions that generate harmful, highly reactive oxygen species. These chemicals are both generated and broken down in the same location. a. nucleosomes b. lysosomes c. peroxisomes d. endosomes
c. peroxisomes
Chemical reactions that lead to a release of free energy are referred to as "energetically favorable." Another way to describe these reactions is: a. uphill b. uncatalyzed c. spontaneous d. activated
c. spontaneous
Activated carriers are small molecules that can diffuse rapidly and be used to drive biosynthetic reactions in the cell. Their energy is stored in a readily transferrable form such as high-energy electrons or chemical groups. Which of the molecules below donates a chemical group rather than electrons? a. FADH2 b. NADH c. NADPH d. ATP
d. ATP
In which phase of the cell cycle do cells check to determine whether DNA is fully and correctly replicated? a. At the transition between G1 and S b. When cells enter G0 c. During M d. At the end of G2
d. At the end of G2
In the 1940s, proteins were though to be the more likely molecules to house genetic information. What was the primary reason that DNA was not originally believed to be the genetic material? a. DNA has a high density of negative charges b. Nucleotides were known to be a source of chemical energy for the cell c. Both protein and nucleic acids were found to be the components of chromosomes d. DNA was found to contain only four different chemical building blocks.
d. DNA was found to contain only four different chemical building blocks.
Which of the following questions would NOT be answered by using karyotyping? a. Is the individual genetically female or male? b. Do any of the chromosomes contain pieces that belong to other chromosomes? c. Does the individual have an extra chromosome? d. Do any chromosomes contain point mutations?
d. Do any chromosomes contain point mutations?
If the genome of the bacterium E. coli requires about 20 minutes to replicate itself, how can the genome of the fruit fly Drosophila be replicated in only 3 minutes? a. The Drosophila genome is smaller than the E. coli genome b. Eukaryotic DNA polymerase synthesizes DNA at a much faster rate than prokaryotic DNA plymerase. c. The nuclear membrane keeps the Drosophila DNA concentrated in one place in the cell, which increases the rate of plymerization. d. Drosophila DNA contains more origins of replication the E. coli DNA
d. Drosophila DNA contains more origins of replication the E. coli DNA
Cells that are specialized for the secretion of proteins are likely to have which of the following features? a. Long bundles of actin/myosin proteins b. Small volume of cytoplasm c. Large population of mitochondria d. Enlarged endoplasmic reticulum
d. Enlarged endoplasmic reticulum
Below is a list of molecules with different chemical characteristics. Knowing that all molecules eventually diffuse across a phospholipid bilayer, select the option below that most accurately predicts the relative rates of diffusion of these molecules (fastest to slowest.) a.Alanine > propanol > sodium > estrogen b.Sodium > propanol > alanine > estrogen c.Estrogen > propanol > sodium > alanine d.Estrogen > propanol > alanine > sodium
d. Estrogen>propanol>alanine>sodium
The complete set of information in an organism's DNA is called its a. Genetic code b. Coding sequence c. Gene d. Genome
d. Genome
ΔGo indicates the change in the standard free energy as a reactant is converted to a product. Given what you know about these values, which reaction below is the most favorable? a. ADP + Pi → ATP ΔGo = +7.3 kcal/mole b. Glucose 1-phosphate → glucose 6-phosphate ΔGo = -1.7 kcal/mole c. Glucose + fructose → sucrose ΔGo = +5.5 kcal/mole d. Glucose → CO2 + H2O ΔGo = -686 kcal/mole
d. Glucose → CO2 + H2O ΔGo = -686 kcal/mole
The octameric histone core is composed of four different histone proteins, assembled in a step-wise manner. Once the core octamer has been formed, DNA wraps around it to form a nucleosome core particle. Which of the following histone proteins does NOT form part of the octameric core? a. H4 b. H2A c. H3 d. H1
d. H1
Which of the following statements about DNA methylation in eukaryotes is FALSE? a. Appropriate inheritance of DNA methylation patterns involves maintenance methyltransferase b. DNA methylation involves a covalent modification of cytosine bases c. Methylation of DNA attracts proteins that block gene expression d. Immediately after DNA replication, each daughter helix contains one methylated DNA strand, which corresponds to the newly synthesized strand
d. Immediately after DNA replication, each daughter helix contains one methylated DNA strand, which corresponds to the newly synthesized strand
A hungry yeast cell lands in a vat of grape juice and begins to feast on the sugars there, producing carbon dioxide and ethanol in the process: C6H12O6 + 2ADP + 2Pi + H+ → 2CO2 + 2CH3CH2OH + 2ATP + 2H2O Unfortunately, the grape juice is contaminated with proteases that attack some of the transport proteins in the yeast cell membrane, and the yeast cell dies. Which of the following is the most likely cause of the yeast cell's demise? a.Toxic buildup of carbon dioxide inside the cell b.Toxic buildup of ethanol inside the cell c.Diffusion of ATP out of the cell d.Inability to import sugar into the cell
d. Inability to import sugar into the cell
The G1 DNA damage checkpoint a. Causes cells to proceed through S phase more quickly b. Involves the degradation of p53 c. Is activated by errors cause during DNA replication d. Involves the inhibition of cyclin-Cdk complexes by p21
d. Involves the inhibition of cyclin-Cdk complexes by p21
Which of the following statements about the newly synthesized strand of a human chromosome is TRUE? a. It was synthesized from a single origin solely by continuous DNA synthesis b. It was synthesized from a single origin by a mixture of continuous and discontinuous DNA synthesis c. It was synthesized from multiple origins solely by discontinuous DNA synthesis d. It was synthesized from multiple origins by a mixture of continuous and discontinuous DNA synthesis.
d. It was synthesized form multiple origins by a mixture of continuous and discontinuous DNA synthesis.
The inactivation of one X chromosome is established by the directed spreading of heterochromatin. The silent state of this chromosome is _____________ in the subsequent cell divisions. a Completed b. Switched c. Erased d. maintained
d. Maintained
Cholesterol serves several functions in mammalian cells. Which of the following is NOT influenced by cholesterol? a. Membrane permeability b. Membrane fluidity c. Membrane rigidity d. Membrane thickness
d. Membrane thickness
Disassembly of the nuclear envelope a. causes the inner nuclear membrane to separate form the outer nuclear membrane b. Results in the conversion of the nuclear envelope into protein-free membrane vesicles c. Is triggered by the phosphorylation of integrins d. Must occur for the kinetochore microtubules to form in animal cells
d. Must occur for kinetochore microtubules to form in animal cells
Spontaneous reactions are characterized by a negative change in free energy. a. true b. false
a. True
Substances that release protons when they dissolve in water are acids. Which of the following household substance is acidic? a. coffee b. bleach c. hand soap d. water
a. coffee
miRNAs, tRNAs, and rRNAs all a. do not code for proteins b. act in the nucleus c. Are packaged with other proteins to form RISC d. Form base pairs with mRNA molecules
a. do not code for proteins
Which of the following are examples of isomers? a. glucose and galactose b. alanine and glycine c. adenine and guanine d. glycogen and cellulose
a. glucose and galactose
Eukaryotic cells are able to trigger the release of material from secretory vesicles to the extracellular space using a process called exocytosis. An example of materials commonly released this way is a. hormones b. nucleic acids c. sugars d. cytosolic proteins
a. hormones
Choose the answer that best fits the following statement: Cholesterol is an essential component of biological membranes. Although it is much smaller than the typical phospholipids and glycolipids in the membrane, it is a/an ______________ molecule, having both hydrophilic and hydrophobic regions. a. polar b. oxygen-containing c. hydrophobic d. amphipathic
a. polar
The central dogma provides a framework for thinking about how genetic information is copied and used to produce structural and catalytic components of the cell. From the choices below, select the order of biochemical processes that best correlates with the tenets of the central dogma. a. replication, transcription, translation b. replication, translation, transcription c. translation, transcription, replication d. translation, replication, transcription
a. replication, transcription, translation
A covalent bond between two atoms is formed as a result of the a. sharing of electrons b. loss of electrons from both atoms c. loss of a proton from one atom d. transfer of electrons from one atom to the other
a. sharing of electrons
Enzymes increase the probability that any given reactant molecule will be converted to product. a. true b. false
a. true
Thermal energy promotes the random movement of proteins, vesicles, and small molecules in the cytosol. a. true b. false
a. true
For the reaction Y → X at standard conditions with [Y] = 1M and [X] = 1M, ΔG is initially a large negative number. As the reaction proceeds, [Y] decreases and [X] increases until the system reaches equilibrium. How do the values of ΔG and ΔGo change as the reaction equilibrates? a. ΔG becomes less negative and ΔGo stays the same b. ΔG becomes positive and ΔGo stays positive c. ΔG stays the same and ΔGo becomes less negative d. ΔG reaches zero and ΔGo becomes more negative
a. ΔG becomes less negative and ΔGo stays the same
