Biology Chapter 24 Final Review
2. Investigations of the mechanisms and consequences of the evolution of macromolecules make up the field of _______.
molecular evolution
17. Genes found in different species whose divergence occurred as a consequence of speciation are known as _______.
orthologs
4. Suppose the ancestral nucleotide at position 786 is A, and the same substitution from A to G occurs in both descendant lineages. This substitution would be called a _______ substitution.
parallel
18. The developmental genes bicoid and zen are derived from a relatively old gene duplication. They are thus _______.
paralogs
53. The globin genes are an example of a. retrotransposons. b. a gene family. c. a gene tree. d. synonymous genes. e. None of the above
b. a gene family.
Coincident Substitutions
Different substitutions in different descendents
67. Most emerging diseases are caused by a. viruses. b. bacteria. c. in vitro evolution. d. concerted evolution. e. annelids.
a. viruses.
Pseudogene
A DNA segment that is homologous to a functional gene but is not expressed because of changes to its sequence or changes to its location in the genome.
Biased Gene Conversion
A mechanism of concerted evolution in which a DNA repair system appears biased in favor of using particular nucleotide sequences as templates for repair, resulting in the rapid spread of the favored sequence across all copies of the gene.
In Vitro Evolution
A method based on natural molecular evolution that uses artificial selection in the laboratory to rapidly produce molecules with novel enzymatic and binding functions.
Nonsynonymous Substitution / Missense Substitution
A nucleotide substitution that does change the amino acid sequence encoded by a gene. These are likely to be deleterious to the organism.
Synonymous Substitution / Silent Substitution
A substitution that does not change the encoded amino acid. They do not affect he functioning of a protein and are therefore less likely than other types of substitutions to be subject to natural selection.
Neutral Theory
A view of molecular evolution that postulates that most mutations do not affect the amino acid being coded for, and that such mutations accumulate in a population at rates driven by genetic drift and mutation rates.
Which of the following, about synonymous, mutations is true? A: They can occur because of the redundancy of the genetic code. B: They will likely be lethal. C: They usually evolve more slowly than nonsynonymous substitutions. D: They will affect the structure of the protein. E: They change the amino acid composition of the protein.
A: They can occur because of the redundancy of the genetic code.
In a phylogenetic tree of primates, a gene involved in the production of brain peptides shows 25 silent substitutions but only four missense substitutions. From these results, we can infer that: A: strong purifying selection has been operating on the gene. B: the gene is a pseudogene. C: strong positive selection has been operating on the gene. D: the gene is following a molecular clock. E: the evolution of the gene is affected only by mutation and genetic drift.
A: strong purifying selection has been operating on the gene.
Comparisons of the genes that code for lysozyme and the amino acid sequence of the enzyme from a number of organisms revealed that: A: the number of changes in lysozyme uniquely shared by cattle, langur, and the hoatzin was high. B: a common recent ancestor is necessary for organisms to develop very similar adaptations. C: the rate of nonsynonymous mutations is higher than that of synonymous mutations in most lineages. D: none of the changes in lysozyme were adaptive. E: bovine (cattle) lysozyme is very similar overall to langur lysozyme.
A: the number of changes in lysozyme uniquely shared by cattle, langur, and the hoatzin was high.
Genes found in different species that diverge as a result of speciation are called _______, whereas genes in the same or different organisms that arise by gene duplication are called _______. A: paralogs; orthologs B: paralogs; homologs C: orthologs; homologs D: homologs; paralogs E: orthologs; paralogs
E: orthologs; paralogs
The nucleotide at a position in a DNA sequence changes from C to A to T. This is an example of a _______ substitution. A: back B: multiple C: coincident D: single E: parallel
B: multiple
Consider the great diversity of genome size among organisms. As genome size increases, the relative proportion of noncoding DNA: A: steadily decreases. B: steadily increases. C: increases for awhile, and then decreases. D: is relatively stable. E: decreases for awhile, and then increases.
B: steadily increases.
Suppose the size of a population of whales is 2400. According to genetic drift theory, what is the probability that a newly-arisen neutral mutation will become fixed in this population? A: 1/2400 B: 1/2 C: 1/4800 D: 1/1200 E: 1/6000
C: 1/4800
The globin gene family is an example of: A: in vitro evolution. B: concerted evolution by biased gene conversion. C: gene duplication leading to divergence of function. D: lateral gene transfer. E: concerted evolution by unequal crossing over.
C: gene duplication leading to divergence of function.
Refer to The Genetic Code, Figure 14.6 in Chapter 14. Which of the following nucleotide substitutions in a codon in an mRNA strand that codes for a protein would likely have the greatest effect on the activity of the protein? A: GGA to GGG B: GGA to GCU C: GGU to GGC D: GGA to GAA E: GGU to GGG
D: GGA to GAA
Sequences from parts of a homologous gene from three species of dragonflies are presented below. Dragonfly 1: AGTCAGTAGATAGTTCGATAGCCA Dragonfly 2: AGTCTGTAGATAGTTCGATAGCCA Dragonfly 3: AGTCAGTAGATAGCGATCAGCCA Which of the following statements is False regarding the three sequences? A: Based on the gene sequences compared, Dragonfly 2 and Dragonfly 3 are less closely related than Dragonfly 1 and Dragonfly 2. B: The sequence alignments shown reveal the minimum number of nucleotide changes between the gene sequences of the three dragonfly species. C: The gene sequences of Dragonfly 1 and Dragonfly 2 have the greatest similarity. D: The gene sequences of Dragonfly 1 and Dragonfly 3 have the greatest % difference. E: Gaps have to be inserted at two places to align the three sequences.
D: The gene sequences of Dragonfly 1 and Dragonfly 3 have the greatest % difference.
The experiments of Rainey and Travisano with Pseudomonas fluorescens showed that: A: the mutation rates were increased by changing the growth environment. B: it took a long time for adaptation to occur because mutations occur so infrequently. C: adaptation to a new environment occurred without genetic change. D: certain mutations may be beneficial to the bacterium under one condition, but harmful under another. E: homogeneous environments resulted in adaptive radiation.
D: certain mutations may be beneficial to the bacterium under one condition, but harmful under another.
Paralogs
Homologous genes whose divergence can be traced to gene duplication events.
Orthologs
Homologous genes whose divergence can be traced to speciation events.
Multiple Substitutions
More than one change at a given position
Back Substitutions
One change at a position is changed back to the original (reversions)
Parallel Substitutions
Same substitution in different descendents
Concerted Evolution
The common evolution of a family of repeated genes, such that changes in one copy of the game family are replicated in other copies of the gene family, and thus evolve " in concert."
Gene Duplication
The generation of extra copies of a gene in a genome over evolutionary time. A mechanism by which genomes can acquire new functions.
Molecular Evolution
The scientific study of the mechanisms and consequences of the evolution of macromolecules.
Lateral Gene Transfer
The transfer of genes from one species to another, common among bacteria and archaea.
Unequal Crossing Over
When a highly repeated gene sequence becomes displaced in alignment during meiotic crossing over, so that one chromosome receives many copies of the sequence while the second chromosome receives fewer copies. One of the mechanisms of concerted evolution.
Refer to Figure 24.2 in your textbook. If the ancestral sequence was not available for comparison, the number of nucleotide substitutions inferred from pairwise comparison of Sequence 1 and Sequence 2 would be ___, which is ________ the actual number of changes. a. 3; an underestimate of b. 5; equal to c. 3; equal to d. 2; an underestimate of e. 4; equal to
a. 3; an underestimate of
13. Which of the following changes is a transition? a. A change from A to G b. A change from T to C c. A change from T to G d. A change from C to G e. Both a and b
a. A change from A to G
52. Which of the following statements about gene duplication is false? a. All duplications produce functional genes. b. It can result in evolution of novel functions in proteins. c. It created much of the diversity in our genome. d. Ribosomal RNA genes arose from duplications. e. It can result in increased complexity.
a. All duplications produce functional genes.
47. In which of the following would you expect the greatest extent of lateral gene transfer? a. Bacteria b. Plants c. Invertebrates d. Vertebrates e. Lateral gene transfer is roughly equally common across these groups.
a. Bacteria
54. Which of the following statements about the globin gene family is false? a. Hemoglobin has a higher affinity for oxygen than myoglobin has. b. Myoglobin is the primary oxygen storage molecule in the muscles. c. Hemoglobin and myoglobin have evolved to have somewhat different functions. d. Hemoglobin has a tetrameric structure that allows it to carry more oxygen molecules than does myoglobin. e. All of the above are true; none is false.
a. Hemoglobin has a higher affinity for oxygen than myoglobin has.
64. If one is interested in reconstructing the evolutionary history of species of birds, which of the following should be considered in the analysis? a. Orthologs b. Paralogs c. Perilogs d. Metalogs e. Both a and b
a. Orthologs
45. Which of the following were used by investigators to study the loss of genetic material in different insects? a. Retrotransposons b. Coding genes c. RNAs d. Noncoding regions of the globin gene family e. Bioprospecting genes
a. Retrotransposons
19. Which of the following is not a reason that bacteria would be especially useful for laboratory studies of molecular evolution? a. Substitution rates are related more to chronological time than to generation time. b. They can be cultured in large numbers. c. They have short generation times. d. Their genomes can be sequenced more easily than those of multicellular eukaryotes. e. All of the above make bacteria useful for laboratory studies of molecular evolution.
a. Substitution rates are related more to chronological time than to generation time.
42. Which of the following statements about genomes is true? a. The variation in genome size among animals is greater than the variation in the number of genes. b. The variation in genome size among animals is less than the variation in the number of genes. c. Most of the DNA in humans codes for proteins. d. Both a and c e. Both b and c
a. The variation in genome size among animals is greater than the variation in the number of genes.
36. Which of the following statements about lysozymes is false? a. They do not have a function in mammals that are not foregut fermenters. b. They have been subjected to convergent evolution in mammals. c. At several amino acid positions of this enzyme, nonsynonymous substitutions have occurred at a faster rate than have synonymous substitutions in the lineage leading to foregut fermenters. d. The changes that have occurred in the lysozymes of foregut fermenters have made the enzyme more resistant to attack by digestive enzymes. e. All of the above are true; none is false.
a. They do not have a function in mammals that are not foregut fermenters.
16. Which of the following statements is true? a. Transitions are more common than transversions. b. A purine changing into another purine is a transversion. c. A pyrimidine changing into a purine is a transition. d. Both a and b e. Both b and c
a. Transitions are more common than transversions.
60. Which of the following can result from the misalignment of highly repeated genes? a. Unequal crossing over b. Biased gene conversion c. Parallel substitutions d. The production of paralogs e. Transitions
a. Unequal crossing over
Before nucleotide and amino acid sequences can be compared in an evolutionary framework, they must be aligned to account for: a. deletions and insertions. b. selection and neutrality. c. parallelisms and convergences. d. gene families. e. all of the above
a. deletions and insertions.
43. One reason that crickets (Laupala) have a larger genome size than fruit flies (Drosophila) is that crickets a. lose DNA more slowly. b. have a higher population size. c. do not have retrotransposons. d. do not have LTRs. e. None of the above
a. lose DNA more slowly.
17. A similarity matrix gives us a measure of the _______ number of changes that have occurred during the divergence between pairs of organisms. a. minimum b. maximum c. most likely d. All of the above e. None of the above
a. minimum
A higher rate of synonymous than nonsynonymous substitutions in a protein-coding gene is expected under: a. purifying selection. b. positive selection. c. neutral evolution. d. concerted evolution. e. none of the above
a. purifying selection.
10. In the common ancestor, the nucleotide at site 167 is T. In colony 1, it changes to C; in colony 2, it remains T. This is an example of a _______ substitution. a. single b. coincident c. parallel d. back e. multiple
a. single
31. In a sequence of DNA taken from various species of snails, researchers have found that the rates of nonsynonymous substitutions and synonymous substitutions are roughly the same. What can we infer from this pattern? a. Transversions are more common than transitions. b. Most of the amino-acid changes are neutral. c. Strong stabilizing selection is acting on this gene. d. Strong selection for change is acting on this gene. e. None of the above
b. Most of the amino-acid changes are neutral.
63. A biologist is examining the gene tree of a gene family of hormone receptor proteins. Which of the following should she compare when focusing on changes in function due to gene duplication? a. Orthologs b. Paralogs c. Analogs d. Both a and b e. None of the above
b. Paralogs
44. Which of the following would be the strongest evidence that most noncoding DNA is slightly deleterious? a. Species with larger population sizes have more noncoding DNA. b. Species with smaller population sizes have more noncoding DNA. c. Species with larger genomes lose DNA more slowly than those with larger genomes. d. Species with larger genomes lose DNA more quickly than those with smaller genomes. e. There is an inverse relationship between the total amount of DNA in the genome and the percentage of the DNA that is noncoding.
b. Species with smaller population sizes have more noncoding DNA.
33. Researchers suspect that the gene FOXP2, which is involved in speech and cognition, has been under positive selection in the human lineage. Which of the following would provide the strongest support for such a claim? a. The gene shows evidence of bioprospecting. b. There is a higher rate of nonsynonymous substitutions than synonymous ones. c. There is a lower rate of nonsynonymous substitutions than synonymous ones. d. The gene evolves following the molecular clock. e. There have been more transitions than transversions in the gene.
b. There is a higher rate of nonsynonymous substitutions than synonymous ones.
23. Which of the following statements about nonsynonymous substitutions is true? a. They always affect the protein's shape and charge. b. They occasionally confer a selective advantage to the organism. c. The rate of their evolution is roughly the same among different genes. d. They are unlikely to be influenced by natural selection. e. All of the above
b. They occasionally confer a selective advantage to the organism.
39. The human genome contains _______ genes. a. less than 15,000 b. between 15,000 and 30,000 c. between 30,000 and 50,000 d. between 50,000 and 100,000 e. more than 100,000
b. between 15,000 and 30,000
65. A biologist is examining species of plants found in Thailand in the hope of finding a naturally occurring treatment for cancer. This project is an example of a. the application of the principles of concerted evolution. b. bioprospecting. c. bioremediation. d. bioinfomatics. e. the application of the principles of convergent evolution.
b. bioprospecting.
9.-12. In a hypothetical experiment, researchers split a bacterial colony in two, allowing each of the new colonies to evolve separately. They then sequenced a gene from colony 1 and colony 2. 9. In the common ancestor, the nucleotide at site 56 is A. In colony 1, it changes to C; in colony 2, it changes to T. This is an example of a _______ substitution. a. single b. coincident c. parallel d. back e. multiple
b. coincident
38. Some birds have an enlarged esophageal chamber called a a. hoatzin. b. crop. c. tranversion. d. locazen. e. vulva.
b. crop.
21. In the Rainey and Travisano experiments on Pseudomonas, cells with the "wrinkly spreader" phenotype a. had a selective advantage under all conditions. b. formed a mat on the surface of the medium in the static cultures. c. had a selective disadvantage under all conditions. d. were genetically the same as the original cells. e. None of the above
b. formed a mat on the surface of the medium in the static cultures.
49. Proteins can acquire new functions via a. retrotransposons. b. gene duplication. c. bioprospecting. d. biased gene conversion. e. concerted evolution.
b. gene duplication.
48. The best way to detect whether lateral gene transfer has occurred would be by a. looking for orphaned LTRs in the genome. b. looking for genes whose phylogenies differ from that of most of the genes. c. bioprospecting. d. comparing the ratios of synonymous and nonsynonmyous substitutions. e. comparing the transition to transversion ratios.
b. looking for genes whose phylogenies differ from that of most of the genes.
30. The hypothesis of neutral evolution asserts that a. the rate of molecular mutation is influenced by natural selection. b. most variability in the structure of molecules does not affect their functioning. c. closely related species have more similar molecular structures than do distantly related species. d. organisms evolved through neutral changes in their molecules. e. mutations neither add nor subtract amino acids from molecules.
b. most variability in the structure of molecules does not affect their functioning.
66. When researchers apply the principles of evolution to produce new molecules that can be used for pharmaceuticals, they are a. bioprospecting. b. performing in vitro evolution. c. performing concerted evolution. d. using biomes. e. ribozyming.
b. performing in vitro evolution.
57. The primary function of ribosomal RNA genes is a. to carry oxygen. b. protein synthesis. c. DNA preservation. d. to act as transcription factors regulating development. e. lateral gene transfer.
b. protein synthesis.
18. Regions of a DNA sequence that are invariant across diverse animals are most likely a. subject to transversions. b. under strong stabilizing selection. c. incapable of alignment. d. pseudogenes. e. undergoing silent substitutions.
b. under strong stabilizing selection.
19. Biologists who are searching for a natural compound to improve corn yield are practicing _______.
bioprospecting
28.-29. Suppose the size of a population of marmots is 300. 28. According to genetic drift theory, what is the probability that a newly arisen mutation will become fixed in this population? a. 1/100 b. 1/300 c. 1/600 d. 1/1,200 e. None of the above
c. 1/600
8. A hypothetical protein sequence taken from humans is 161 amino acids long. The homologous sequence in chimpanzees is 160 amino acids long. Which of the following is most likely needed to align the sequences? a. A single substitution b. A parallel substitution c. A gap d. A similarity matrix e. An amino acid replacement
c. A gap
62. Which of the following statements is correct? a. All orthologs are paralogs. b. All paralogs are orthologs. c. All orthologs are homologs. d. All homologs are orthologs. e. None of the above
c. All orthologs are homologs.
50. Which of the following is not likely to occur after a gene duplication event? a. One gene retains its function, while the other becomes a pseudogene. b. Both genes retain their function, but they are expressed in different patterns or tissues. c. Both genes become pseudogenes. d. One gene retains its function, while the other evolves to have a new function. e. All of the above are likely to occur.
c. Both genes become pseudogenes.
46. Which of the following statements is true? a. Selection against the accumulation of junk DNA is more effective in species with small populations. b. Noncoding sequences are thought to be slightly advantageous. c. Large genomes can slow down the rates of development. d. All of the above e. None of the above
c. Large genomes can slow down the rates of development.
20. Which of the following statements about the Rainey and Travisano experiments on Pseudomonas bacteria is true? a. The static cultures had a constantly uniform environment. b. No phenotypic evolution occurred in the static cultures. c. Molecular evidence showed that the same phenotype could arise from many genotypes. d. Both a and b e. None of the above
c. Molecular evidence showed that the same phenotype could arise from many genotypes.
5. The capacity for an allele to interact well with other genes of the genome will affect whether this allele will persist in the population. This phenomenon is an illustration of which of the following evolutionary forces or principles? a. Genetic drift b. Genomic drift c. Natural selection d. Concerted evolution e. Biased gene conversion
c. Natural selection
15. Which of the following usually does not lead to undercounting the real number of substitutions? a. Parallel substitutions b. Back substitutions c. Single substitutions d. All of the above e. None of the above
c. Single substitutions
40. Which of the following statements about genome evolution is true? a. Humans have between 10 and 20 times more genes than does Drosophila. b. Many species have more than 500 times the number of protein-coding genes than the typical bacteria have. c. Some salamanders have about 40 times as much DNA as humans do. d. A larger genome always indicates greater complexity. e. None of the above
c. Some salamanders have about 40 times as much DNA as humans do.
34. Histones are proteins that play important roles in gene regulation. Between plants and animals, only two amino acid changes have occurred in the histone H4 protein, despite many synonymous changes. What can we infer from this observation? a. A great deal of genetic drift is taking place. b. Most of the amino acid changes are neutral. c. Strong stabilizing selection is acting on this gene. d. Strong selection for change is acting on this gene. e. None of the above
c. Strong stabilizing selection is acting on this gene.
59. Biased gene conversion is a mechanism of a. unequal crossing over. b. convergent evolution. c. concerted evolution. d. bioprospecting. e. None of the above
c. concerted evolution.
6. Humans and chimpanzees both have large brains because their common ancestor had a large brain. Thus, their large brain size is considered a(n)_______ trait. a. analogous b. aligned c. homologous d. coincident e. coordinate
c. homologous
61. Copies of genes in the same or different species that are related as the result of gene duplications are known as a. analogs. b. orthologs. c. paralogs. d. heterologs. e. None of the above
c. paralogs.
2. The precursors to the genes that cause the electric discharges in the electric organs of some fish evolved from _______ genes that were involved in _______. a. calcium channel; muscle contraction b. calcium channel; neuronal activity c. sodium channel; muscle contraction d. sodium channel; neuronal activity e. NMDA channel; neuronal activity
c. sodium channel; muscle contraction
5. Suppose the common ancestor of cows and whales had an A at one nucleotide site. At this site, whales have G and cows have T. This would be an example of _______ substitution.
coincident
16. Chorion genes are involved in making the eggshells of many species of insects. In some species, the multiple copies of these chorion genes evolved so as to maintain similarity of the copies within the same species. This phenomenon is known as _______ evolution.
concerted
1. Fish use high-voltage discharges a. to locate prey. b. to communicate with other individuals. c. to stun prey. d. All of the above e. None of the above
d. All of the above
51. Gene duplication may involve a. part of a gene. b. a whole gene. c. whole chromosomes. d. All of the above e. None of the above
d. All of the above
3. Which of the following statements about the "living battery" electric organ possessed by some fish is true? a. It is composed of derived muscle cells called electrocytes. b. Its development involved modification of sodium channels. c. The signals produced by these organs are the same in all species with the organ. d. Both a and b e. Both b and c
d. Both a and b
56. In order to estimate the age of the split between the globin gene clusters, scientists examined which of the following? a. The fossil record b. The molecular clock assumption c. The ratio of nonsynonymous to synonymous substitution rates d. Both a and b e. Both b and c
d. Both a and b
24. Which of the following represents the correct ordering (from fastest to slowest) of the average rate of evolution of nonsynonymous substitutions, synonymous substitutions, and pseudogenes? a. Nonsynonymous substitutions, synonymous substitutions, pseudogenes b. Nonsynonymous substitutions, pseudogenes, synonymous substitutions c. Pseudogenes, nonsynonymous substitutions, synonymous substitutions d. Pseudogenes, synonymous substitutions, nonsynonymous substitutions e. All three evolve at roughly the same rate.
d. Pseudogenes, synonymous substitutions, nonsynonymous substitutions
32. Genes from many isolates of the influenza virus have been sequenced. In certain regions of the genome, nonsynonymous substitutions occur much more frequently than do synonymous substitutions. What can we infer from this pattern? a. A great deal of genetic drift is taking place. b. Most of the amino acid changes are neutral. c. Strong stabilizing selection is acting on this gene. d. Strong selection for change is acting on this gene. e. Mutations that change the amino acid are disadvantageous.
d. Strong selection for change is acting on this gene.
4. Genomes consist of a. protein-coding genes only. b. protein-coding genes and regulatory sequences. c. protein-coding genes and noncoding DNA. d. protein-coding genes, regulatory sequences, and noncoding DNA. e. regulatory sequences and noncoding DNA.
d. protein-coding genes, regulatory sequences, and noncoding DNA.
29. Assuming that the mutation rate for a particular gene is μ, the number of new mutations at each gene in this population is _______ × μ. a. 100 b. 200 c. 300 d. 500 e. 600
e. 600
When a gene is duplicated, which of the following may occur? a. Production of the gene's product may increase. b. The two copies may become expressed in different tissues. c. One copy of the gene may accumulate deleterious substitutions and become functionless. d. The two copies may diverge and acquire different functions. e. All of the above
e. All of the above
22. Which of the following statements about synonymous substitutions is false? a. They do not change the amino acid sequence of the protein. b. They are the same as silent substitutions. c. They generally evolve at a faster rate than nonsynonymous substitutions. d. They are less likely to be influenced by natural selection than nonsynonymous substitutions are. e. All of the above are true; none is false.
e. All of the above are true; none is false.
58. Which of the following statements about ribosomal RNA (rRNA) genes is true? a. Nearly all multicellular animals have hundreds (if not more) copies of them. b. There is much variation within species in different copies of the rRNA genes. c. They evolve through concerted evolution. d. Both a and b e. Both a and c
e. Both a and c
12. Detection of which of the following types of substitutions requires knowing the sequence of intermediates between the common ancestor and the descendant colonies, in addition to that of the two colonies and the common ancestor? a. Coincident substitutions b. Back substitutions c. Multiple substitutions d. Both a and b e. Both b and c
e. Both b and c
35. Which of the following are foregut fermenters? a. Lemurs b. Langurs c. Cattle d. Both a and b e. Both b and c
e. Both b and c
37. In which of the following animals would you find the enzyme lysozyme? a. Only in foregut fermentators b. Only in foregut fermentators and hoatzin c. Only in hoatzin d. Only in mammals and a few closely related organisms e. In nearly all animals
e. In nearly all animals
25. Which of the following scientists proposed the neutral theory of molecular evolution? a. Charles Darwin b. Stephen Jay Gould c. Albert Sabin d. Chung-I Wu e. Motoo Kimura
e. Motoo Kimura
14. Which of the following changes is a transversion? a. A change from A to G b. A change from C to T c. A change from G to A d. All of the above e. None of the above
e. None of the above
26. According to the neutral theory of molecular evolution, a. most alleles found in natural populations are neutral. b. nearly all mutations have some effect on the organism. c. the rate of fixation of neutral mutations is much faster in small populations than it is in large ones. d. molecular clocks do not work. e. None of the above
e. None of the above
41. Which of the following statements about genomes is true? a. All plants have genome sizes that are smaller than those of all animals. b. Humans have the largest genome size of all animals. c. Most of the bacterial genome is noncoding. d. All of the above e. None of the above
e. None of the above
7. Which of the following statements about molecular evolution is true? a. Almost all genes evolve at the same rate. b. All nucleotide substitutions give rise to amino acid replacements. c. Changes in the amino acid sequence of a protein can change its charge, but not its secondary structure. d. All of the above e. None of the above
e. None of the above
27. According to the neutral theory of molecular evolution, the fastest rate of fixation of neutral mutations by genetic drift should occur in which of the following populations? a. A population of 200 individuals b. A population of 400 individuals c. A population of 1,000 individuals d. A population of 10,000 individuals e. The rates of fixation should be roughly the same in all of the above.
e. The rates of fixation should be roughly the same in all of the above.
Paralogous genes are genes that trace back to a common a. speciation event. b. substitution event. c. insertion event. d. deletion event. e. duplication event.
e. duplication event.
55. The two globin gene clusters split _______ million years ago. a. approximately 10 b. approximately 50 c. approximately 100 d. approximately 200 e. more than 300
e. more than 300
11. In the common ancestor, the nucleotide at site 327 is G. In colony 1, it changes to C; in colony 2, it also changes to C. This is an example of a _______ substitution. a. single b. coincident c. parallel d. back e. multiple
e. multiple
15. A group of homologous genes with related functions is known as a _______.
gene family
1. The entire set of genes of an organism, along with all of its noncoding DNA, is known as its _______.
genome
3. The hands of humans and the wings of bats are derived from a structure possessed by the common ancestor of both. Human hands and bat wings are thus _______ structures.
homologous
14. A gene found in E. coli is not found in closely related species of bacteria, but similar genes are found in distantly related bacteria. The most likely explanation for this observation is _______.
lateral gene transfer
12. The enzyme _______ has evolved new functions in animals that perform foregut _______.
lysozyme; fermentation
9. Kimura's _______ theory of molecular evolution proposes that most molecular variations in natural populations are selectively equivalent.
neutral
8. A sequence of DNA that arose from a gene duplication and is no longer functional is known as a _______.
pseudogene
11. Many more synonymous than nonsynonymous substitutions have occurred in insects in the gene sevenless, a gene that is involved in eye development. This gene is most likely under _______ selection.
purifying (stabilizing)
13. To determine the rates at which organisms lose DNA, researchers have used _______ that have LTRs.
retrotransposons
7. Two species of pine trees differ by a nucleotide substitution in the coding region of a gene, but the proteins produced by this gene are the same in both species. This substitution is thus a _______ substitution.
silent (or synonymous)
10. Two species of grasshopper have the same neutral mutation rate for any particular gene, but species A has a population size that is ten times the size of species B. The substitution rate in species A should be about _______ as that of species B.
the same
6. In their studies of evolution within Pseudomonas, Rainsey and Travisano observed a new form called _______ that was able to form a mat across the medium's surface and thus compete more successfully for oxygen.
wrinkly spreader