BIOLOGY SPRING FINAL (Ch. 10, 13-19, 34, 37)

Because Earth is spherical, its surface moves ______________ at the _____________ where its diameter is greatest than other latitudes

Faster equator

Offspring that they themselves can reproduce

Fertile offspring

Coniferous forests are often dominated by a _______ species of trees

Few

_________: -plays a crucial role in the cycling of ____________ -many plants have adapted to resist it whether it's the plant itself or the _________ of the plant

Fire nutrients seed

The aphotic zone is dominated by a variety of small ___________ and _____________

Fish crustaceans

Some plasmids carry __________ that enhance ______________ under certain conditions (ex: antibiotic resistance)

Genes survival

What dictates how codons are translated into amino acids?

Genetic code

What are the two parts of the binomial name?

Genus species

How does biogeography support evolution?

Geographic distribution of species can imply that organisms evolve from ancestral species, but the migration could evolve into a new species with reproduction from a homeland species -it shows that different animals have the same traits from a common ancestor but have evolved differently

Why is the soil nutrient rich in temperate grasslands?

Glacial deposits and mulch from decaying plant matter

Species descended from a common ancestor gradually diverge more and more in their morphology as they acquire unique adaptations

Gradualism model

Proteobacteria are all ___________-____________ and _____________ a particular rRNA

Gram negative share

technique used by scientists to classify prokaryotes based on the components of their cell wall (amount of peptidoglycan)

Gram stain

Plants evolved from __________ ___________ (charophytes) millions of years ago

Green algae

What were most likely the ancestors of land plants?

Green algae and red algae

What is the evolution of plants?

Green algae-->Bryophytes(mosses)-->Seedless Vascular Plants(ferns)-->Gymnosperms(conifers)-->Angiosperms(flowers)

Apical meristems help the plant because ______________ is needed for maximal exposure to resources in __________ and ____________

Growth soil air

What is an example of an ocean current that affects climates?

Gulf of Mexico/Gulf Stream

What is the problem with the morphological species concept?

It relies on subjective criteria

What is a huge benefit of food webs?

It shows that consumers can eat more than one type of producer -consumers feeding at many trophic levels below them (not just one)

Why is global climate change a growing concern for the 9 terrestrial biomes?

It's changing the temperature and precipitation which affects the vegetation in the biomes

Example of brown algae?

Kelp

A species whose impact on its community is larger than its biomass or abundance indicates -occupies a niche that holds the rest of its community in place

Keystone species

What is an example of a quaternary consumer in the marine environment

Killer whales

reptiles were more prominent on Earth a ___________ time ago

LONG

__________ species diversity is characteristic of most modern agricultural ecosystems

LOW

Standing water: -__________ and __________ -____________, _____________, and ____________ life distribution is based on depth of ___________ and _____________ from the shore -if it's deep enough, there can be an ___________ zone -that __________ zone will often be deprived of _____________ because of the respiration that ______________ undergo at the bottom -receive excesses of ___________ or ___________ runoff

Lakes ponds algae animal plant water distance aphotic aphotic oxygen decomposers fertilizers sewage

Freshwater biomes include ____________, _______________, ___________, ____________, and ___________

Lakes ponds streams rivers wetlands

This influence of Darwin came up with the theory of acquired characteristics and studied fossils of giraffes

Lamarck

Several different ecosystems linked by exchanges of energy, materials, and organisms

Landscape

What happens in termination stage of translation?

-Elongation continues until a stop codon reaches the A site of the ribosome -the stop codons do not code for any amino acid, they signal the end of translation -the last tRNA releases the polypeptide and the ribosomal subunits separate after a protein release factor binds to the A site

Compare and contrast flagella and fimbriae

-Flagella enable prokaryotes to move about in response to chemical or physical signals in their environment -fimbriae enable some prokaryotes to stick to a surface or to one another -Fimbriae allow many pathogenic bacteria to latch onto the host cells they colonize

What are the problems with the biological species concept?

-Fossils -it's useless for asexual organisms -it's useless when finding a new species if you only have one of them

What are the benefit within a lichen relationship?

-Fungi get photosynthetic products -algae/bacteria get protection and moisture retention

What are the differences between gram-positive and gram-negative bacteria?

-Gram positive bacteria has simpler walls with more peptidoglycan -outer membrane of gram negative bacteria has lipids bonded to carbohydrates which makes it usually more toxic

Sympatric speciation among cichlids occured because of

-Habitat differentiation: different areas of lake with different food sources -sexual selection: females choose mates based on coloration

How have pollinators coevolved with plants, especially angiosperms

-Insects and bats are largely drawn to flowers based on scents and birds are drawn by colors -some insects have bodies evolved to blend in with the flower -angiosperms rely on animals to aid in pollination

Who were Darwin's influences?

-Lamarck -Hutton -Lyell -Malthus

what are marsupials? *describe

-brief gestation -give birth to tiny live embryonic offspring -offspring complete development attached to mother's nipple (typically in an external pouch)

What type of animals in chaparral?

-browsers (deer) -fruit-eating birds -seed-eating rodents -snakes and lizards

What are three external characteristics useful in classifying prokaryotes?

-cell shape -cell wall components -projections

What are the 3 main eras?

-cenozoic -mesozoic -paleozoic

How do most bacteria obtain their energy and carbon?

-chemoheterotrophs acquire both energy and carbon from organic molecules

Human impact on the rainforests?

-clear cutting (deforestation) for farming, livestock, or mining -takes a long time for rainforests to recover because of poor soil

examples of lobe-finned fish?

-coelacanths -lungfish

What are example of adaptations for predator-avoidance in prey populations?

-color patterns -camouflage -sharp quills -hard shells -poison

Describe the temperate rainforest

-coniferous forests of coastal North America -supported by warm, moist air from the Pacific Ocean -dominated by a few species of trees (redwood, douglas fir, hemlock) -forests are heavily logged

What are some angiosperms we eat?

-corn -rice -wheat and other grains -apples -oranges -tomatoes -squash -nutmeg -ginger -cumin -cloves -cinnamon -black pepper (peppercorns)

What are the uses of an exoskeleton?

-covers body -protects the animal -provides points of attachment for the muscles that move appendages

What are examples of arthropods?

-crayfish -lobsters -crabs -barnacles -spiders -ticks -insects

How did plants overcome the problem of lacking water on land?

-cuticle -vascular tissue -seeds -fruit

What are unique structures of roundworms (nematoda)?

-cylindrical in shape -fluid filled body cavity and digestive tract with 2 openings -sheds cuticle

What type of vegetation is in chaparral?

-dense, spiny shrubs with tough, evergreen leaves -perennial shrubs are dominant but annual shrubs grow during the wet winter and spring months

What is the impact of eutrophication of lakes, rivers, and coastal waters?

-depletion of oxygen levels -decreased species diversity

Challenges of tetrapod evolution?

-dessication -gas exchange -water conservation -structural support (gravity) -reproduction

What are some ways that two species would not be able to reproduce?

-different "parts" -never come into contact with each other

What are the features of Chordates?

-dorsal, hollow nerve cord -notochord -pharyngeal gill slits -post anal tail

How has the ocean been abused?

-dying of commercial fish species -pollution causes closing of beaches -nutrient pollution -dying of coral reefs -areas have been turned into landfills -overfishing upsetting predator/prey relationships -contamination by pathogens or toxic chemicals -introduction of non-native species

what are monotremes?

-egg laying mammals -mother usually lays 2 eggs and incubates them -young rely heavily on mother's care (lick milk from mother's fur)

What do pili do?

-enables the cell to attach to surfaces -swap DNA with other cells (shoot plasma across tube into other cell)

What is the importance of the cell wall for prokaryotes

-enables them to live in a wide range of environments -provides physical protection -prevents the cell from bursting in a hypotonic environment

what are the 3 types of tissues?

-endoderm -mesoderm (in some animals) -ectoderm

characteristics of mammals?

-endothermic -hair/fur -mammary glands that produce milk -sweat glands -diverse teeth for different foods -complex folding of the brain -four chambered hearts

What was the atmospheric environment of earth when dinosaurs were?

-extremely harsh -no grass -pine trees -ferns -LOW OXYGEN LEVELS (15% compared to present day 21%)

Functions of plasmids?

-fertility factors -metabolic factors -resistance factors -virulence factors

What are the two types of projections?

-flagella -fimbriae

What are unique structures of flatworms (platyhelminthes)?

-flat body -complex life cycle -dense clusters of nerve cells=brain -scolex

What are examples of resources that cause competition?

-food -space -water -light

What helps spread angiosperm gametophytes around?

-fruit -wind -animal fur -animal (digestion and feces)

what are the 3 most diverse clades of molluscs

-gastropods (snails and slugs) -bivalves (clams, scallops, oysters) -cephalopods (squids, octopuses)

What are two ways allopatric speciation can occur?

-geological processes such as mountain ranges, lakes, continental drift -colonization--small groups of individuals leave the parent population and become isolated

what are eutherians?

-give birth to live fully developed young -placental mammals -placenta is more complex than marsupials -placenta is attached to wall of uterus -placenta allows nutrients to diffuse from the mother's blood to the embryo

What are examples of sponges

-glass sponges -demosponges -calcareous sponge -barrel sponges

What are examples of primary consumers on land?

-grasshoppers -many insects, snails -grazing mammals -birds that eat seeds and fruit

Animals in temperate grasslands?

-grazing mammals like bison and pronghorn -wild horses and sheep -birds nest on ground-small burrowing animals -diverse microorganism, annelid, and arthropod populations

examples of sharks and rays?

-great white sharks -mantarays

Desertification is due to

-growing human populations (expanding) -overgrazing -drying farmland

What are the two groups of vascular seed plants?

-gymnosperms (conifers) -angiosperms (flowering)

What are examples of round worms (nematoda)

-heartworms -hookworms

two major classes of arthropods?

-hexapods -myriapods -crustaceans

How are we influencing a mass extinction today?

-huge amounts of CO2 in our atmosphere causing global warming and a hole in the ozone layer -water levels rising, glaciers melting -deforestation

What caused the Cambrian explosion?

-increasingly complex predator-prey relationships -homoeotic genes already in place (control body plans)

What are the primary animal pollinators?

-insects -birds -bats

Explain how a retrovirus works

-it reverse-transcribes its RNA into DNA -inserts the DNA into a cellular chromosome -then transcribes more copies of the RNA from the viral DNA

examples of jawless fish?

-lampreys -hagfish

Animals in the tundra?

-large herbivores like musk oxen and caribou -small animals like lemmings, arctic fox, and snowy owl -migratory birds and mosquitoes in the summer

Animals in savannas?

-largest herbivores and their predators -elephants -cheetahs -zebras -giraffes -antelopes -lions -kangaroos -burrowing animals like mice, gophers, snakes, ground squirrels, worms, and arthropods are common -ants and termites are dominant herbivores

describe amphibian metamorphosis

-larvas (tadpoles) are legless with a long tail, gills, and lateral line -hormones trigger the tadpole to undergo metamorphosis -through the metamorphosis, the tadpole develops legs and lungs, the tail shrinks, and the lateral line disappears

What are examples of segmented worms (annelida)

-leeches -earthworm -polychaetes -clitellata

Major features of anoles that evolved per different environment

-leg length -toe pads -dewlap color

examples of primates?

-lemurs -monkeys -apes--humans

What were the CONS for life on land?

-less water -less nutrients -gravity -reproduction wasn't adapted without water -plants had to anchor their bodies in the soil and get resources from soil and air

Describe energy in aquatic environments

-light is not available everywhere -photosynthesis occurs at surface -chemosynthesis occurs deep where light doesn't reach

Describe energy in terrestrial environments

-light is the main source of energy and is rarely the limiting factor -shading by trees can create competition for plants growing on forest floors

What are the components of the cell wall in xylem?

-lignin -cellulose

How did plants overcome the problem of gravity on land?

-lignin -vascular tissue

Describe mammal embryonic development

-live birth mammal embryos remain in the mother and receive nourishment directly from her blood -produce extra embryonic membranes -structures in reptile eggs are present with different functions

examples of reptiles?

-lizards -snakes -birds

What factors are leading to the downfall of plant diversity?

-logging -mining -creating roads -deforestation -air pollution

What are the 3 main lineages of Bilaterians?

-lophotrochozoa -ecdysozoa -deuterostomia

What are the two clades of seedless vascular plants

-lycophytes -pterophytes (ferns)

How have animals adapted to deserts?

-many are burrowing and only active at night -seed eaters since plants produce so many seeds -most have adaptations to conserve water

What are examples of secondary consumers on land?

-many small mammals like mice -birds -frogs -spiders -lions -wolves -other large carnivores that eat grazers

Describe tropical dry forests

-marked by prolonged dry seasons -plants adapted to survive the dry season (succulents, thorny shrubs, deciduous trees)

What are unique structures to arthropods?

-molting -exoskeleton is a cuticle hardened by layers of chitin and protein

3 types of mammals

-monotremes -marsupials -eutherians

Animals in taiga?

-moose -elk -bears -wolves -grouse -migratory birds

What were the PROs for life on land?

-more sunlight -more CO2 -less pathogens and less predators -less competition

Types of fungi (types)

-most are DECOMPOSERS -some are PARASITES -some have SYMBIOTIC RELATIONSHIPS with other organisms

Describe tropical rainforests:

-most complex of all biomes in terms of diversity of life -soil is very nutrient poor -both plants and animals live in the forest from the ground to the tops of trees-monkeys, birds, insects, snakes, and frogs spend a lot of their lives off the ground

How have plants adapted to frequent fires and long droughts in savannas

-most growing regions are below the soil -deciduous trees drop their leaves in the dry season -plants have adapted to grow rapidly during the rainy season

How does species diversity impact pathogens?

-most pathogens infect a limited range of host species or may even be restricted to a single host species -when many potential hosts are living close together, it is easy for a pathogen to spread from one to another

What are unique structures to molluscs?

-muscular foot -visceral mass -mantle -radula

characteristics of old world monkeys?

-narrow downward pointing nostrils -longer hind legs than forearms -flattened nails -prominent buttock pads -non-prehensile tails -medium to large

Enormous increase in food production have come at the expense of

-natural ecosystems -the services those natural ecosystems provide

Animals in the polar ice biome?

-nematodes, mites, and wingless insects -seals, penguins, gulls, and skuas, polar bears

primate groups?

-new world monkeys -old world monkeys -apes

traits of jawless fish?

-no jaws -no scales -no paired fins

Organisms require phosphorus for....

-nucleic acids -phospholipids -ATP

What characteristics do protists have?

-nucleus -membrane-bound organelles -flagella and cilia with 9 + 2 microtubule pattern -cilia -pseudopods

What are characteristics of monocots?

-one cotyledon -parallel veins in leaves -scattered arrangement of vascular bundles -floral parts in multiples of 3 -fibrous root system

What are some characteristics of cyanobacteria?

-only group of prokaryotes with plant like oxygen generating photosynthesis -tolerance of extreme conditions

examples of marsupials?

-opossum -kangaroos

What were a couple of hypotheses to explain how life arose on this planet?

-organic molecule hypothesis: volcanic eruptions produced 22 amino acids -meteorite hypothesis: amino acids on meteors

Explain algae as a renewable resource

-organic remains of DIATOMS are thought to be the fossil part of fossil fuels for oils -lipid droplets in diatoms and algae are being tested as a possible biofuel

What type of animals are in estuaries?

-oysters -crabs -fish -waterfowl

How can protists obtain energy and nutrition?

-photoautotrophs -heterotrophs -parasites -mixotrophs

What are the 4 modes of nutrition?

-photoheterotrophs -chemoautotrophs -chemoheterotrophs -photoautotrophs

Areas where lichens can live?

-places with little or no soil -severe cold -severe droughts

What are examples of producers? *on land and in water

-plants -algae -autotrophic prokaryotes -photosynthetic unicellular protists and cyanobacteria (phytoplankton) -multicellular algae and aquatic plants

What are example of mutualism?

-plants and mycorrhiza -herbivores and the cellulose-digesting microbes that inhabit their digestive tracts

examples of monotremes?

-platypus -echidna

How did plants overcome to challenges of reproduction on land?

-pollen -seeds -flowers

What creates ocean currents?

-prevailing winds -planet's rotation -unequal heating of surface waters -locations and shapes of continents

What are the 5 major groups of bacteria?

-proteobacteria -gram-positive bacteria -cyanobacteria -chlamydias -spirochetes

What are 2 patterns of embryological development?

-protostome -deuterostome

What are the contrasting characteristics between the three DOMAINS?

-rRNA sequences -RNA polymerase types -Introns -Histones associated with DNA -Peptidoglycan in cell wall

What are examples of invasive species?

-rabbits in Australia -cane toads in Australia -lionfish in the Caribbean and North Atlantic

What are the three hybrid zones?

-reinforcement -fusion -stability

How is chaparral vegetation adapted to fire?

-remaining shrub roots after fires allow plants to regenerate -some plant seeds will only germinate after exposure to the hot fires -remaining ashes after the fire act as fertilizers to promote regrowth

Explain the three things that can occur when different species come back into contact with each other in hybrid zones

-reproductive barriers are strong enough to keep them separated (reinforcement) -interbreeding between species to make it one species (fusion) -combination of 2 species and the hybrids (stability)

examples of birds?

-robin -falcon

features of lobe-finned fish?

-rod shaped bones in pelvic and pectoral fins -FLESHY APPENDAGES

What are the three separate organs most plants have?

-roots -stems -leaves

examples of amphibians?

-salamanders -frogs -caecilians

What are examples of cnidarians?

-sea anemones -jellyfish -coral -man-o-war -hydra

what are examples of echinodermata?

-sea stars -sand dollars -sea urchins -sea cucumbers

Characteristics of bryophytes?

-seedless -nonvascular -lack roots and leaves but have apical meristems and embryos -lack lignin in cell walls -must be in moist environments to disperse gametes

How do prokaryotes differ from eukaryotes

-smaller -lack a nucleus and other membrane -enclosed organelles-more numerous

molluscs with open circulatory systems?

-snails -slugs -bivalves

What are some examples of molluscs?

-snails -slugs -oysters -clams -octopuses -cuddle fish -squids -scallops

What are the bodies of red algae like?

-soft-bodied or hard chalky cell walls (like coral reef)

Describe temperate broadleaf forest

-soil is rich in organic and inorganic material -trees aren't as tall or diverse as tropical rainforest -deciduous trees -relatively high precipitation -more open canopy

What structures are unique to cnidarians?

-specialized stinging cells -diffusion -tentacles -cnidocytes -toxic venom -nematocytes (stinging cells)

What animals inhabit the benthic realm

-sponges -burrowing worms -clams -sea anemones -crabs -echinoderms

What are the 9 groups of invertebrates?

-sponges (porifera) -cnidarians -flatworms (platyhelminthes) -molluscs -annelids -nematodes -arthropods -echinoderms -chordates

How do the dinosaur and bird lungs compare to those of mammals?

-spongy and hard -immobile -anchored -forked ribs

What are the three types of selection?

-stabilizing -directional -disruptive

What does the capsule allow bacteria to do?

-stick to certain surfaces (ex: respiratory tract) -protects cell against host's immune system

Communities change drastically following a severe disturbance that....

-strips away vegetation -removes significant amounts of soil

What are traits of healthy ecosystems?

-supply fresh water and some foods -recycle nutrients -decompose wastes -regulate climate and air quality

features of osteicthyes? *different from other groups

-swim bladder -bone skeleton -operculum

amphibian development/reproduction?

-swimming larval stage -metamorphosis from tadpole -eggs laid and fertilized in water -jelly eggs

What are examples of platyhelminthes (flatworms)

-tapeworms -turbellaria (marine) -flukes -planarians (free-living)

Describe a savanna?

-temperature is warm year round -rainfall averages 30-50 centimeters per year and almost all of it occurs during a brief rainy season -grass with limited trees

a food pyramid of production shows what?

-the flow of energy from producers to primary consumers and to higher trophic levels -numbers of individuals at each trophic level

What happens after editing is complete in transcription?

-the mRNA transcript exits the nucleus where either a ribosome within the cytoplasm or attached to the ER will translate the mRNA into a polypeptide

List plant defenses against herbivores

-thorns -spines -morphine -nicotine

What are the 9 terrestrial biomes?

-tropical forest -savanna -desert -chaparral -temperate grassland -temperate broadleaf forest -northern coniferous forest (TAIGA) -tundra -polar ice

What are 3 types of body cavities?

-true coelomate -acoelomate -pseudocoelomate

examples of ray-finned fish?

-tuna -bass -goldfish

What are the 3 subphylums of chordates?

-tunicates -lancelets -vertebrates

What are characteristics of dicots?

-two cotyledons-branched veins on leaves -vascular bundles arranged in a ring -floral parts in multiples of 4 or 5 -taproot usually present

Adaptations of osteichthyes due to swim bladder?

-various maneuverability/speed -feeding efficiency -various body forms -specialized fins -adaptability of body shape

Characteristics of seedless vascular plants?

-vascular tissue present -well developed roots and rigid stems (lignin) -common in temperate forests -require moist conditions for fertilization -spores carried by wind (no seeds)

How have plants adapted to deserts?

-very waxy coating on the leaves to prevent water loss -shrubs have deep roots -plants produce a lot of rugged seeds that only germinate during rainy periods

what are unique structures to echinoderms?

-water vascular system -network of water -filled canals that branch into extensions called TUBE FEET -some capable of regeneration -eats bivalve molluscs

characteristics of new world monkeys

-wide spaced apart circular nostrils -small to medium -long tails sometimes prehensile -no buttock pads -no cheek pouches

Describe downstream flowing water?

-wider, warmer, and slower -less oxygen and murkier, allowing phytoplankton to grow -catfish are predominate -burrowing insects and worms, waterfowl, and frogs are often abundant

examples of eutherians?

-zebra -elephants -rodents -humans

Which animals inhabit the pelagic photic zone

-zooplankton -fish -marine mammals -many other types of animals

-At temperatures near ____ degrees Celsius, an organism's _____________ slows so much that their bodies don't make enough energy to sustain them -At temperatures above _____ degrees Celsius, an organism's ______________ start to _____________

0 metabolism 45 enzymes denature

Freshwater biomes typically have a salt concentration of less than ____ percent

1

How many directions can DNA polymerase run?

1 continuous direction

What are the stages of life?

1. Abiotic synthesis of polymers 2. Formation of protocells 3. Self-replicating RNA

What are the four ways to define a species?

1. Biological Species Concept 2. Morphological Species Concept 3. Ecological Species Concept 4. Phylogenetic Species Concept

What are the three steps of elongation in translation?

1. Codon recognition 2. Peptide bond formation 3. Translocation

What are the five types of prezygotic barriers?

1. Habitat isolation 2. temporal isolation 3. behavioral isolation 4. mechanical isolation 5. gametic isolation

What are the levels of organization for ecology?

1. Individual (Organism) 2. Population 3. Community 4. Ecosystem 5. Biome 6. Biosphere

What are the three key points of evolution?

1. Individuals do not evolve, the population does. As certain traits become more common, often other traits will change or disappear 2. Natural selection can amplify or diminish heritable traits. Acquired traits can't be passed on 3. Evolution is not goal directed, the benefits of traits can change with time. Adaptions are often compromises

What are the three steps of translation?

1. Initiation 2. Elongation 3. Termination

What are the four stages of transcription (DNA->mRNA)

1. Initiation 2. Elongation 3. Termination 4. mRNA Splicing/Editing

What were the challenges for life on land?

1. Maintain moisture inside body 2. Be able to obtain nutrients from both soil and air 3. Support body in non-buoyant medium 4. Reproduce and disperse offspring without water

What are the 2 types of ecological succession?

1. Primary succession 2. Secondary succession

What are the trophic levels?

1. Producers 2. Primary consumers 3. Secondary consumers 4. Tertiary consumers 5. Quaternary consumers

What are the general steps for a biogeochemical cycle?

1. Producers incorporate chemicals from the abiotic reservoirs into organic compounds 2. Consumers feed on the producers, incorporating some of the chemicals into their own bodies 3. Both producers and consumers release some chemicals back to the environment in waste products 4. Decomposers play a central role by breaking down the complex organic molecules in detritus

What are the three steps of self-replicating RNA?

1. RNA monomers adhere to clay particles and become concentrated 2. monomers spontaneously join, which forms the first small "genes" 3. an RNA chain complementary to one of these genes assembles. If the new chain serves as a template for another round of RNA assembly, a replica of the original gene results

What are 4 reasons why natural selection doesn't mean perfection?

1. Selection can only act on existing variations 2. Evolution is limited by historical constraints 3. Adaptations are often compromises 4. Chance, natural selection, and the environment interact

Why is there limited trees in a savanna?

1. Soil is nutrient poor 2. Lightning and human activity causes frequent fires

Freshwater biomes fall into which two categories?

1. Standing water 2. Flowing water

What are the two general types of mutations?

1. Substitution 2. nucleotide insertion or deletion

Terrestrial biomes most precipitation to least precipitation

1. Tropical rainforest 2. Temperate Broadleaf forest 3. Taiga 4. Polar ice 5. Savanna 6. Chaparral 7. Tundra 8. Desert

What are the four steps of natural selection?

1. Variation 2. Inheritance 3. Selection 4. Time and Adaptation

What are the two ways polyploidy occurs?

1. Within a single species 2. Hybridization between two species

Describe the steps, in order, for how life came to be on the planet

1. abiotic synthesis of polymers: solutions of amino acids or nucleotides in the ocean vaporized the water, concentrating the solution forcing bonds between the amino acids or nucleotides 2. formation of protocells: protocells surrounded concentrated groups of organic molecules (may have been able to form, reproduce, create, and maintain an internal environment different from their surroundings) 3. self-replicating RNA: RNA molecules could aid in the replication process as their own catalysts (ribozymes)

What are the two types of genetic drift?

1. bottleneck effect 2. founder effect

What are 2 examples of how scientists can observe natural selection in action?

1. galapagos finches 2. pesticides

Sympatric speciation in animals is usually due to

1. habitat differentiation 2. sexual selection

what is evidence of bipedalism

1. larger brain size (bipedalism predates the larger brain size, so if a larger skull is present, then the organism must have been bipedal) 2. pelvic and limb structure 3. location of the opening at the base of the skull

3 groups of living primates

1. lorises, lemurs, and bush babies 2. tarsiers 3. anthropoids

Why can't trees grow in the tundra?

1. permafrost prevents the roots of plants from penetrating deep in the soil 2. Long, cold winters 3. Strong, high winds

What are the 3 lines of evidence to support that fungi were crucial to the colonization of land plants?

1. present day mycorrhizal relationships 2. fossils of early land plants 3. molecular genetics

What are the four steps that would have been required for life to arise?

1. the abiotic synthesis of small organic molecules such as amino acids and nitrogenous bases 2. The joining of these small molecules into polymers such as proteins and nucleic acids 3. The packaging of these molecules into "protocells" 4. The origin of self-replicating molecules that eventually made inheritance possible

What is nitrogen's two abiotic reservoirs?

1. the atmosphere (80% nitrogen gas) 2. soil

Describe the steps of the phosphorus cycle?

1. the weathering of rock gradually adds inorganic phosphate to the soil 2. Plants assimilate the dissolved phosphate ions in the soil and build them into organic compounds 3. Consumers obtain phosphorus in organic form by eating plants 4. Phosphates are returned to the soil by the action of decomposers on animal waste and the remains of dead plants and animals 5. Some phosphate drains from terrestrial ecosystems into the sea, where it may settle and eventually become part of new rocks 6. Geologic processes uplift the rocks and expose them to weathering, a process that takes millions of years

what are the 3 ways bacteria can take up dna?

1. transformation 2. transduction 3. conjugation

For a population to be in Hardy-Weinberg equilibrium, what 5 conditions must be met?

1. very large population 2. no gene flow between populations (immigration and emigration) 3. no mutations 4. random mating 5. no natural selection

only about ______ percent of the energy stored at each trophic level is available to the next level

10

How many species of finches were on the Galapagos?

13 species found in various patterns and places

The CDC has identified _______ microorganisms that pose an urgent or serious threat to public health

15

A ribosome is composed of _______ subunits

2

How many hydrogen bonds are between A and T?

2

There are _________ general hypotheses about how life-supporting molecules appeared on early Earth

2

Oldest widely accepted fossils of eukaryotes are how old?

2.1 billion years old

there are _______ extinct species of ___________, species more closely related to humans than chimps

20 HOMININ

The frequency of heterozygous

2pq

How many hydrogen bonds are between C and G?

3

How many steps of translation are there?

3

Marine biomes generally have a salt concentration around _____ percent

3

The large subunit of a ribosome has ____ different sites in which the ________ with amino acids attach and add their amino acid, then exit

3 tRNA

Which side does DNA polymerase add the nucleotides?

3' carbon end

What would be the complementary base sequence for a DNA strand with the following sequence? 5'-ATCAGGACT-3'

3'-TAGTCCTGA-5'

When did life first arise on earth?

3.5 years ago, at the earliest 3.8 billion years ago

Deserts are most common at latitudes ______ degrees north and _____ degrees south because of the _______________, _______, ________ air from the ____________ region

30 30 descending cold dry Tropics

how many chordate traits are there

4

Explain why codons are written in 3s

4 x 4 x 4 provides 64 different combinations to account for the 20 amino acids

How old is the earth according to scientists?

4.6 billion years old

Domain Bacteria is divided into _______ major groups

5

There have been _____ mass extinctions in which 50% or more of Earth's species were eliminated

5

Which direction does DNA Polymerase go?

5'->3' (adds on the 3' end)

Air temperature declines by about ______ degrees Celsius with every ____________ meter increase in elevation

6 1,000

We are living through a ______ mass extinction

6th

sharks have how many senses?

7

How many terrestrial biomes are there?

9

The part of an ecosystem where a chemical, such as carbon or nitrogen, accumulates or is stockpiled outside of living organisms

Abiotic reservoir

Aquatic biomes are defined by different _____________ factors -the primary factor based on ____________

Abiotic salinity

Inherited characteristic that enhances an organism's ability to survive and reproduce in a certain environment

Adaptation

Organisms on different continents that inhabit the same biome have ______________ to survive in the ____________ conditions

Adapted same

growth-producing regions of cell division found near tips of stems and roots

Apical meristems

Most protists are __________ and they are found almost anywhere there is moisture, including the bodies of various ___________

Aquatic hosts

____________ are hypothesized to be the first living organisms on the planet

Archaea

What are the two domains of prokaryotes?

Archaea and Bacteria

Selective breeding of plants and animals to promote the occurrence of desirable traits

Artificial selection

old world monkeys are from

Asia and Africa

What was Darwin's theory?

Evolution by natural selection

Speciation requires ____________ but _______________ doesn't always lead to speciation

Evolution evolution

A group of populations whose members have the potential to interbreed in nature and PRODUCE FERTILE OFFSPRING

Biological species concept

What is an example of an exaptation

Evolution of the feather

In deep dark aquatic environments (like caves or hydrothermal vents), ______________ bacteria harvest energy from _______________ materials to power the ecosystem

Chemosynthetic inorganic

In some communities in the deep-sea, the producers are _________________ __________________

Chemosynthetic prokaryotes

Prokaryotes called _____________ harness the energy stored in chemicals (either organic molecules or inorganic molecules)

Chemotrophs

____________ live inside eukaryotic host cells and is the most common STI in US

Chlamydias

Unicellular heterotrophs and mixotrophs that use cilia to move and sweep food into their mouth

Ciliates

a group of species that includes an ancestral species and all its descendants

Clade

______________ is based on the Darwinian concept that organisms both share characteristics with their ancestors AND differ from those same ancestors

Cladistics

What is the major defining factor of terrestrial biomes

Climate (temperature and precipitation)

The closer the branches of phylogenetic trees are, the ____________ the organisms are related based on the organisms listed in the tree

Closer

Which shape is tRNA in?

Clover/paperclip

The biome of Chaparrals is limited to _____________ areas

Coastal

A three nucleotide sequence in mRNA that specifies a particular amino acid or polypeptide termination, the basic unit of the genetic code

Codon

The anticodon is complementary to the ___________ triplet on the _________ transcript

Codon mRNA

Which stage of elongation in translation is this? -Anticodon of tRNA molecule pairs with the mRNA codon in the A site

Codon recognition

Genetic information is written in ___________ and translated into __________ _________ sequences

Codons amino acid

Occurs when a change in one species acts as a new selective force on another species, and the resulting adaptations of the second species in turn affect the selection of individuals in the first species

Coevolution

What type of water has high oxygen content

Cold, fast-moving water

Which type of allopatric speciation explains the finches on the Galapagos Islands?

Colonization

An assemblage of all the populations of organisms living close enough together for potential interactions

Community

How did the scientists come up with a phylogenetic tree for the lizards?

Comparing the DNA of anoles from different species and islands

Why are there so many types of cichlids in one lake?

Competition for a food source led to the adaptation of different cichlids for different food sources

Do molluscs have a gastrovascular system or a complete digestive system?

Complete digestive system

Do segmented worms (annelida) have a gastrovascular system or a complete digestive system?

Complete digestive system

What is an example of incrementally evolving structures?

Complexity of eyes in molluscs

Protists are more _____________ than any prokaryotes

Complicated/complex

Guard cells open and close depending on _______________ to prevent ___________ ________ through stomata

Conditions water loss

A biome characterized by conifers, cone-bearing evergreen trees

Coniferous

The union (mating) of two bacterial cells or protist cells and the transfer of DNA between the two cells

Conjugation

________________ movements help explain patterns of biogeography

Continental

The submerged part of the continents

Continental shelf

What type of winds dominate the tropics?

Cooling trade winds

As air moves from the tropics towards the poles, it ___________ and ___________ into clouds and then it __________

Cools condenses rains

Sexually reproducing organisms have the most genetic variation due to ____________ ____________ in meiosis

Crossing over

Because of its _____________, Earth receives an _____________ distribution of solar energy

Curvature uneven

Waxy layer surrounding above-ground parts that prevents water loss

Cuticle

What is the only group of prokaryotes with plant-like oxygen-generating photosynthesis

Cyanobacteria

Where in the cell does translation occur?

Cytoplasm

The study of how slight genetic changes can become magnified into major morphological differences between species

Evolutionary and Developmental Biology (evo-devo)

If any of the 5 Hardy-Weinberg equilibrium conditions are NOT met, then the population must be ________________

Evolving

Which group of protists stands alone?

Excavata

Selection can only act on _______________ variations: the fittest phenotypes, of the phenotypes available, are selected

Existing

The coding regions of the gene are known as

Exons

Invasive species establish themselves at the _______________ of native communities

Expense

What is the major driving force in the movement of water?

solar energy

what type of body cavities do echinoderms have?

spacious coelom

Biofilm can consist of several different ______________ and may include some protists or fungi

species

The structure of a community can be described by its ______________ ________________, including the number of ______________, their relative _______________, and their ________________ relationships

species compositions species abundance feeding

the number of species in a community

species richness

Species diversity includes both __________ __________________ and the ______________ ___________________ of the different species in the community

species richness relative abundance

Vertebrates: -nerve cord--> ________ ________ and _________ -notochord-->____________ _______________ and _______________ -pharyngeal gill pouches--> aquatic _________ or terrestrial ____________ _______ and ___________

spinal cord brain vertebral column cranium gills inner ear throat

relatively short and rigid spiral or corkscrew bacteria

spirilla

spiral or corkscrew bacteria

spirilla and/or spirochetes

Helical bacteria that spiral through their environment by means of rotating, internal filaments -many are pathogens

spirochetes

longer and more flexible spiral or corkscrew bacteria -helical bacteria that spiral through their environment by means of rotating internal filaments

spirochetes

Short RNA molecules can assemble ____________________ from nucleotide monomers and when RNA is added to a solution containing RNA monomers, new RNA molecules ______________________to parts of the starting RNA sometimes assemble

spontaneously complementary

What is the weakness of lichens?

air pollution

A cell that can develop into a new organism without fusion with another cell

spore

Seedless plants have ___________ instead

spores

The different types of _____________ are how fungi are classified

spores

____________ are produced at the tips of some specialized hyphae

spores

Hybrids continue to be produced but each species maintains its own integrity is which hybrid zone?

stability

Male reproductive structure (consists of the anther and filament)

stamen

the ____________ is a protein coat to protect the yolk and provide additional nutrients

albumen

A protist that produces its food by photosynthesis

algae

the ___________ helps dispose of metabolic waste

allantois

the ___________ is a fluid-filled sac surrounding the embryo

amnion

reptiles, birds, and mammals are _____________

amniotes

a shelled egg in which an embryo develops within a fluid-filled amniotic sac and is nourished by yolk

amniotic egg

sensory organ called electroreceptors that are jelly-filled pores -help detect electric field in water

ampullae of lorenzini

What is the cretaceous extinction thought to have been caused by?

an asteroid

amphibians: -_____________ -live on __________ and in _________ -can breathe through their ___________ because of _________ environment

tetrapods land water skin moist

What was Darwin's book called?

the Origin of Species

example of sympatric speciation

the apple maggot fly -the flies previously deposited eggs only on hawthorn fruits -When apple trees were brought by European immigrants, some began laying eggs on apples -May be widespread among insects

The region surrounding the equator between latitudes 23.5 degrees north and 23.5 degrees south

the tropics

what separates lancelets from other groups

their traits don't evolve or become more advanced

Earth's crust is divided in giant, irregularly shaped plates that essentially float on the underlying mantle

theory of plate tectonics

an integrated group of cells with a common function, structure, or both

tissue

sponges do not have _______________

tissues

the transfer of bacterial genes from one bacterial cell to another by a phage

transduction

the incorporation of new genes into a cell from DNA that the cell takes up from the surrounding environment

transformation

Frederick Griffith determined that bacteria have a _______________ ______________ that can cause heritable change in bacteria

transforming factor

RNA is ______________ to protein

translated

evaporative water loss from plants

transpiration

cavity completely lined by mesoderm tissue

true coelom

What type of body cavities do arthropods have?

true coelomate

What type of body cavity do molluscs have?

true coelomate

Undersea tectonic plate movements can cause _____________

tsunamis

adult stage is sessile and looks like a sponge but the larval stage meets the requirements of chordates

tunicates

The __________, ______________, and _____________ of disturbances vary from community to community

types frequency severity

Where are the stomata located

underside of the leaf

the same processes that occurred in the Earth long ago are still occurring

uniformitarianism

Mycorrhiza are present in nearly all _____________ plants

vascular

pertaining to the underside/bottom of a bilaterally symmetric animal

ventral

lampreys: -adult stage has ___________ but larval stage does not have ___________ -most are _____________ -have several rows of ____________ to latch onto fish -______less -_____________ ___________________ with simple _____________ -larval lampreys are ____________ feeders

vertebrae vertebrae parasites teeth jaw cartilage endoskeleton vertebrae suspension

what separates vertebrates from tunicates and lancelets?

vertebrate traits become more evolved

animals with a backbone

vertebrates

chondrichthyes: -______________ -flexible ______________ made of ___________ -no __________ _____________ -________, paired _________, and hinged ________ -________________ on their heads -_____________ __________ system

vertebrates endoskeleton cartilage swim bladder gills fins jaw electrosensors lateral line

Our appendix is an example of a _______________ feature

vestigial

Remnants or features that served important functions in the organism's ancestors

vestigial structures

A microscopic particle capable of infecting cells of living organisms and inserting its genetic material

virus

one of the three main parts of a mollusc, containing most of the internal organs

visceral mass

Ruptures between plants allow hot molten rock, ash, and gases to escape...these are ______________

volcanoes

In vascular seed plants: Pollen brings sperm-producing cells in contact with egg-producing parts without ______________

water

What nutrients that plants need are in the soil

water and minerals

Wind increases an organism's rate of _____________ loss by ______________ which then increases the rate of ________________ ______________ (beneficial on hot days but harmful in cold environments)

water evaporation evaporative cooling

a radially arranged system of water-filled canals that branch into extensions called TUBE FEET; this system provides movement and circulates water, facilitating gas exchange and waste disposal

water vascular system

do echinoderms have an open or closed circulatory system?

water vascular system w/diffusion

What is the evolution of plants in terms of adaptations?

water-->land-->vascular tissue-->seeds-->flowers/fruits

reptiles: -skin covered with ______________ __________ (used to keep water in the body) -obtain oxygen with ____________ -______________ (absorbing external heat)

waterproof scales lungs ectothermic

A biome that is transitional between an aquatic ecosystem (either marine or freshwater) and a terrestrial one

wetlands

What is the effect of large mountain ranges?

Larger mountain ranges cause moist air to rise and (due to their size) the majority of the precipitation falls and accumulates as deep snowpack -the dry air (from the release of all the precipitation) goes over the mountain and cools -the dry air absorbs moisture from the land creating an effect known as rain shadow

Ascomycetes: -______________ phylum of fungi -defining feature=_______________(tiny microscopic structure in which ascospores are formed) -species can be parasitic (insect ____________)

Largest ascus zombies

Rusts: -limited to ____________ or plant _____________ -don't kill the plant but reduces its __________

Leaves shoots health

Cell walls are reinforced with ____________

Lignin

What is the taiga characterized by

Long snowy winters and short, wet summers

flatworms, molluscs, and annelids -all have locophore

Lophotrochozoa

This influence of Darwin thought that the Earth is much older than previously thought and Darwin got the idea that if the Earth was changing, creatures must change with it

Lyell

A type of bacteriophage replication cycle in which the viral genome is incorporated into the bacterial host chromosome as a prophage -new phages are not produced, and the host cell is not killed or lysed unless the viral genome leaves the host chromosome

Lysogenic cycle

A type of viral replication cycle resulting in the release of new viruses by lysis (breaking open) of the host cell

Lytic cycle

What are examples of secondary consumers in aquatic environments?

Mainly small fish that eat zooplankton

This influence of Darwin thought that resources will eventually run out and Darwin thought that the better adapted/most fit organisms will fight for the resource and survive

Malthus

What type of mutation is this? -In the code for the normal blood protein hemoglobin a portion of the mRNA transcript codes for glutamine- GAA -Sickle cell is the result of a missense substitution causing a portion of the mRNA transcript to code for valine-GUA -the first A is substituted for a U causes a different amino acid to be brought

Missense mutation

A protist that is capable of both autotrophy and heterotrophy, depending on availability of light and nutrients

Mixotrophs

The term used to describe how an organism obtains energy and carbon are combined to describe its ___________ of ____________

Mode nutrition

Mosses and ferns must live in a ___________ environment because of reproduction

Moist

As air moves back toward the equator, it warms and picks up ____________ until it ____________ again

Moisture ascends

When air spreads away from the equator and cools and dries, it absorbs ___________ from the land -this explains why many of the world's greatest _____________ are located at these latitudes (30 degrees north and south)

Moisture deserts

The study of biologically important molecules such as DNA and proteins

Molecular biology

The study of heredity at the molecular level

Molecular biology

A method that uses DNA or other molecules to infer relatedness

Molecular systematics

_______________ are especially vulnerable to attack by pathogens and herbivorous insects -also have low genetic variation

Monocultures

Classification based on physical traits such as size, shape, and other morphological features

Morphological Species Concept

Which concept is used to classify most organisms?

Morphological species concept

Sharks, penguins, and dolphins all have fins used for swimming

analogous structures

Structures that have similar function but do not share common ancestry (not evidence of evolution)

analogous structures

What term goes hand in hand with convergent evolution?

analogous structures

Biogeography shows that organisms must have evolved from a common _____________

ancestor

Fruits help in ______________ dispersal

animal

multicellular heterotrophic eukaryotes that obtain nutrients by ingestion

animals

pertaining to the front/head of a bilaterally symmetric animal

anterior

Sac containing the male sporangia---releases pollen

anther

_____________ revolutionized medicine in that what was often a fatal infection could readily be treated

antibiotics

which primates don't have tails?

apes

which primates don't fully live in trees

apes and humans

only _________ and _____ __________ ___________ have a completely opposable thumb

apes old world monkeys

Organisms in flowing water?

arthropods such as small crustaceans and insect larva -trout are main predators

External parasites include

arthropods such as ticks, lice, mites, and mosquitoes which attach to their victims temporarily to feed on blood or other body fluids

diploid gametes fertilize themselves to make 4n offspring

autopolyploidy

produces their own food

autotrophs

rod shaped bacteria

bacilli

Nitrogen fixation is carried out by some

bacteria

a virus that infects bacteria; also called a phage

bacteriophage

animals with bilateral symmetry (most animals)

bilaterians

Asexual reproduction by the separation of the body into two bodies

binary fission

the small subunit of a ribosome has the ________ site for the mRNA

binding

Classification system in which each species is assigned a two-part scientific name

binomial nomenclature

when prokaryotes attach to surface in highly organized colonies

biofilm

Any of the various chemical circuits that involve both biotic and abiotic components of an ecosystem

biogeochemical cycle

The geographic distribution of species

biogeography

Primary production produces

biomass

the amount of living organic material in an ecosystem

biomass

If the climate in two geographically separate areas is similar, the same type of _____________ may occur in ___________ places

biome both

the use of organisms to remove pollutants from soil, air, and water

bioremediation

A living component of the environment; an organism, or factor pertaining to one or more organisms

biotic

___________ are surviving descendants of dinosaurs

birds

hollow ball of cells

blastula

What is a closed circulatory system?

blood always contained in vessels (veins, arteries, capillaries); deoxygenated and oxygenated blood NEVER mix

what is an open circulatory system?

blood is not always contained in vessels; mixing of oxygenated and deoxygenated blood

Smuts: -infect ________ kernels with __________ growths called galls -galls are seen as a _____________ in some cultures

corn hyphae delicacy

Do segmented worms (annelida) have an open or closed circulatory system?

closed

a specialized stinging cell for which the phylum cnidaria is named; consists of a capsule containing a fine coiled thread, which, when discharged, functions in defense and prey capture

cnidocyte

spherical shaped bacteria

cocci

Prokaryotes can live in extreme environments like: _________, ___________, ___________, ___________, etc.

cold acidic hot salt

At the source of flowing water, the water is _________, ___________, and ____________ rich

cold clear oxygen

This type of symbiotic relationship benefits one partner and has no impact on the other

commensalism (+/0)

an assemblage of all the populations of organisms living close enough together for potential interactions

community

the variability or stability in the species composition of a community caused by biotic and abiotic factors

community dynamics

Anatomical similarities between species

comparative anatomy

What is a (-/-) relationship?

competition

Do roundworms (nematoda) have a gastrovascular system or a complete digestive system?

complete digestive system

do arthropods have a gastrovascular system or a complete digestive system

complete digestive system

do echinoderms have a gastrovascular system or a complete digestive system?

complete digestive system

a digestive tube with two openings, a mouth and an anus

complete digestive tract

a type of development in certain insects in which development from larva to adult is achieved by multiple molts that are followed by a pupal stage; while encased in its pupa, the body rebuilds from clusters of cells

complete metamorphosis

Adaptations are often _______________

compromises

the union(mating) of two bacterial cells or protist cells and the transfer of DNA between the two cells

conjugation

____________ __________ is the movement of the plates as a result of movements in the mantle

continental drift

species from different evolutionary branches may come to resemble one another if they live in similar environments and natural selection has favored similar adaptations

convergent evolution

What type of mutation is this? -the codon UCA codes for the amino acid serine -if the C is substituted for a G the codon now reads UGA--a stop codon -this means the polypeptide will not have all the amino acids that are required to make the functioning protein

Nonsense mutation

When frequency is highest near the mean value (middle) and decreases towards each extreme, it is called a _______________ Distribution

Normal

The Taiga stretches across

North America and Asia south of the Arctic Circle

Desertification is happening rapidly in

Northern Africa

2nd step of fungus life cycle?

Nuclei fuse forming a diploid zygote

What are the monomers of nucleic acids?

Nucleotides

Where in the cell does DNA replication occur?

Nucleus

What are the benefits of fungi? -Aids in the cycling of ______________ in an ecosystem -Fungi can _______________ almost any organic ________________ -Have the ability to break down toxic chemicals like _______________ (DDT) and ____________-causing chemical agents. -Scientists are looking at the possibility of using fungi to help clean up ________________ spills -Fungi are the source of numerous ________________ such as penicillin and amoxicillin -Many fungi are a number of _________________uses -Fungi, primarily yeasts, are used in ________________ and ________________ research due to their easily coded and manipulated genome -Scientists are also looking at using fungi to help aid in the production of ________________

Nutrients breakdown chemical pesticides cancer petroleum antibiotics culinary molecular biotechnology biofuels

Why aren't substitutions always bad?

Occasionally they can lead to an improved protein that enhances the organism

Lizard species (anoles) evolved/evolve to...

Occupy different parts of the habitats to minimize competition for food and other resources between different species

River-like flow patterns at the ocean's surface

Ocean currents

_______________ control ______________ which influence --> ________________ which influence --> ______________ which determine --> _________________

Oceans climates biomes plants animals

Marine biomes include ___________, ______________ zones, ___________ ___________, and _______________

Oceans intertidal coral reefs estuaries

The lagging strand is replicated in fragments...these fragments are called _________________ fragments

Okazaki

Explain the antiparallel nature of DNA

One strand runs 3'-->5' and the other strand runs 5'-->3' -double stranded DNA compliments run in the opposite direction; this allows for nitrogen bases to pair up and bond with hydrogen bonds

What was the evolution with the finches?

Only one species came and evolved into 13 different species on the Galapagos Islands

Do roundworms (nematoda) have an open or closed circulatory system?

Open

What is the origin of single-celled eukaryotes?

Originated from prokaryotes that were able to use cellular respiration

A species from a lineage that is closely related but not part of the group of species being studied

Outgroup

What is descent with modification?

Overtime differences gradually accumulate by evolution by natural selection -an ancestral species could diversify into many descendant species by the accumulation of adaptations to various environments

Polypeptide site -holds the growing peptide

P site

Scientists who study fossils and fossil record

Paleontologists

What is an example of a ciliate from OUR LABS?

Paramecium

Organism that derives its nutrition from a living host, which is harmed by the interaction

Parasite

The adoption of the simplest explanation for observed phenomena in systematics

Parsimony

Use of common characteristic between organisms to determine relatedness as well as molecular evaluation to determine relatedness

Parsimony

What is the purpose of DNA replication?

Pass down the instructions of a cell as the cell divides

The Photic zone includes the ____________ realm, the ______________ realm, and the _____________ ______________

Pelagic benthic continental shelves

The region of the ocean that includes all open water (anywhere with seawater) from the surface to the bottom of the ocean

Pelagic realm

The growing polypeptide is held in the P site while the ribosome catalyzes the formation of a peptide bond between the polypeptide and the new amino acid from the tRNA in the A site

Peptide bond formation

Natural selection leads to adaptations however it doesn't engineer ________________ organisms

Perfect

Why is tree growth not supported in temperate grasslands (except along rivers and streams)

Periodic severe drought periods

Wetlands: -covered with water either ____________ or ______________ -ideal conditions for the growth of ____________ plants

Permanently periodically aquatic

What are the two largest mass extinctions

Permian and Cretaceous

Which eon includes the 3 eras?

Phanerozoic

Pipes of entirely living cells that distribute sugars from leaves throughout the plant

Phloem

Adding ____________ to water causes them naturally to form vesicles

Phospholipids

Coral reefs are scattered around the globe in the ____________ zone of warm ______________ waters above ______________ _____________

Photic tropical continental shelves

Extends between sea level to 200 meters deep (the maximum depth in which most light can penetrate in water)

Photic zone

An organism that obtains energy from sunlight and carbon from CO2 using the process of photosynthesis

Photoautotroph

An organism that obtains energy from sunlight and carbon from organic sources

Photoheterotroph

In aquatic environments, most _________________ occurs near the water's surface

Photosynthesis

Defines a species as the smallest group of individuals that share a common ancestor and thus form one branch on the tree of life

Phylogenetic Species concept

What are the different types of mutagens?

Physical and chemical

Algae and photosynthetic bacteria that drift passively in aquatic environments

Phytoplankton

In the sunlight regions of the pelagic and benthic realms, photosynthesis by _______________ and multicellular ___________ provides ______________ and organic ____________ for other animals

Phytoplankton algae energy carbon

What color is the stain of gram-negative bacteria?

Pink

_______________ species diversity in a community often has consequences for the species diversity of ________________

Plant animals

____________ are the main producers on land

Plants

In the terrestrial biomes, ___________ build the foundation for the communities of ____________, _____________, and ____________

Plants animals fungi microorganisms

We know that the PROS of land outweighed the CONs because...

Plants are abundant on land today

What distinguishes plants from algae in terms of embryos

Plants have embryophytes

What were the first organisms to colonize land?

Plants with fungi

Examples of biotic factors

Plants, animals, fungi, bacteria

A type of protist that has amoeboid cells, flagellated cells, and an amoeboid plasmodial feeding stage in its life cycle; a member of the amoebozoan clade

Plasmodial slime mold

Unicellular parasites with multiple stages of life in which they infect different organisms

Plasmodium

A terrestrial biome that includes regions of extremely cold temperature and low precipitation located at high latitudes north of the arctic tundra and in Antarctica

Polar ice

What are the two body forms of cnidarians

Polyp and medusa

Sequence of amino acids

Polypeptide

What is built during translation?

Polypeptide

Cells have more than two complete sets of chromosomes

Polyploid cells

Plant sympatric speciation is usually via __________________

Polyploidy

A group of individuals belonging to one species and living in the same geographic area

Population

A group of individuals of the same species that live in the same area and interbreed

Population

Small-scale disturbances often have _____________ effects

Positive

_____________, ______________, and _____________ continually move water

Precipitation evaporation transpiration

Major global air movements; winds that result from the combined effects of Earth's rotation and the rising and falling of air masses

Prevailing winds

An herbivore; an organism that eats plants or other autotrophs

Primary consumers

the conversion of solar energy to chemical energy (in organic compounds) by photosynthesis

Primary production

A type of ecological succession in which a biological community arises in an area without soil

Primary succession

an enzyme that synthesizes short RNA sequences called primers -These primers serve as a starting point for DNA synthesis

Primase

All consumers directly or indirectly depend on the output of _________________

Producers

An autotrophic organism that makes organic food molecules from CO2, H2O, and other inorganic raw materials

Producers

What is the first trophic level?

Producers

What is the haploid generation?

Production of egg and sperm

What is the diploid generation

Production of spores

How does the relative size and number of prokaryotes compare to eukaryotic cells?

Prokaryotes are extremely small but their collective biomass is 10 times that of eukaryotes

How do prokaryotes form biofilms?

Prokaryotes excrete CHEMICAL SIGNALS that attract nearby cells to cluster

What started the oxygen revolution?

Prokaryotes that were capable of photosynthesis transformed the seas with the introduction of oxygen

A specific nucleotide sequence that acts as a binding site for RNA polymerase and determines where transcription starts

Promoter

Are molluscs protostomes or deuterostomes?

Protostomes

are arthropods protostomes or deuterostomes?

Protostomes

A temporary extension of an cell that functions in moving cells and engulfing food

Pseudopodia

Double ring structure of a nitrogenous base (A & G)

Purine

single ring structure of a nitrogenous base (T & C)

Pyramidines

A large molecular complex that links together the growing chain of RNA nucleotides during transcription, using a DNA strand as a template

RNA Polymerase

What are the two main enzymes required in transcription?

RNA Polymerase and Helicase

________ ___________ is the process in which introns are cut out leaving only the exons

RNA splicing

what type of body symmetry do echinoderms have?

Radial (penta-radial)

arrangement of body parts like pieces of pie around an imaginary central axis; divide any axis and get equal pieces

Radial symmetry

A protist that moves and feeds by means of threadlike pseudopodia and has a mineralized support structure composed of silica

Radiolarian

Uneven heating from the sun causes _______ and ___________ patterns

Rain wind

In the tropics, Earth's ____________ moving surface deflects vertically ______________ air, making the trade winds blow from east to west

Rapidly circulating

Describe the precipitation of the tundra

Receives as little precipitation as a desert but moisture is retained due to poor drainage and slow evaporation

Why is red algae red?

Red accessory pigment masks the green chlorophyll

A mule is an example of which postzygotic barrier/effect?

Reduced hybrid fertility

This happens when creatures can't produce viable offspring

Reduced hybrid fertility

This impairs hybrid's development or survival--the organisms are usually dying before reproductive age

Reduced hybrid viability

What is a good example of how mutualists benefit from their relationship?

Reef-building corals and photosynthetic dinoflagellates

Ocean currents have a profound effect on ______________ climates

Regional

Hybrids are less fit than either purebred species. The species continue to diverge until hybridization can occur no longer (reproductive barriers)

Reinforcement

These can interfere with interbreeding

Reproductive barriers

The "umbrellas" (mushrooms) are _____________ structures made of ___________

Reproductive hyphae

Prevents genetic exchange (gene flow) and maintains the gap between species

Reproductive isolation

__________ (other than birds) and _____________ do not have adaptations to withstand really cold temperatures

Reptiles amphibians

The return of CO2 to the atmosphere by _______________ closely balances its removal by _________________-

Respiration photosynthesis

What does RNA stand for?

Ribonucleic acid

Other than Watson and Crick, who else helped discover the double helix shape of DNA?

Rosalind Franklin and Erwin Chargaff

What are examples of fungal diseases in plants and crops?

Rusts, smuts, ergots, dutch elm disease

Where in the cell cycle would DNA replication happen?

S phase

When does DNA replication take place?

S phase of the cell cycle so that there's enough DNA to be split into the two daughter cells in mitosis

Animals in temperate broadleaf forests?

Soil is inhabited by many invertebrates and vertebrates -bobcats -foxes -black bears -mountain lions

_____________ structure, ________, and ______________ content often play major roles in determining the distribution of plants

Soil pH nutrient

_________ energy powers most ecosystems

Solar

Pertaining water; what is the danger for aquatic organisms in their environments?

Solute concentration -freshwater organisms live in a hypotonic medium while the environment of marine organisms is hypertonic

What is the abiotic synthesis of polymers?

Solutions of amino acids or nucleotides in the ocean could have washed up on hot shorelines vaporizing the water, concentrating the solution, forcing bonds to form between the amino acids or nucleotides (dehydration synthesis)

How does the theory of plate tectonics explain the biogeography of organisms today?

Some animals similar to each other found on different continents must have been the same species on Pangea

What is the symmetry of sponges?

Some are radially symmetric but MOST LACK BODY SYMMETRY

The water in rivers and streams change drastically from its ______________ to where it empties into a __________ or ___________

Source lake ocean

The process by which one species splits into two or more species

Speciation

The variety of species that make up a community

Species diversity

Unicellular algae have mutually beneficial relationships with a wide variety of other marine invertebrates, including ____________, _____________, and _____________

Sponges flatworms molluscs

Multicellular diploid form that produces haploid spores (meiosis)

Sporophyte

which generation (gametophyte or sporophyte) is dominant in angiosperms and gymnosperms?

Sporophyte

_______________ Selection on a graph looks like slimmer/narrower Normal Selection

Stabilizing

_______________ selection favors the intermediate phenotype

Stabilizing

spherical shaped bacteria in clusters

Staphylococci

Gas exchange (CO2 and O2) come in through pores called ___________ surrounded by _________ cells

Stomata guard

What does SAR mean?

Stramenopila, Alveolata, Rhizaria

when 2 plates do not move smoothly past each other but stick in one spot and build up pressure, the energy released is an earthquake

Strike-slip fault

What was the earliest evidence of life on Earth?

Stromatolites

The "branches" of phylogenetic trees show common ancestral lineage which can be based on ______________ or ______________ homologies

Structural molecular

What are phylogenetic trees based on?

Structural, developmental, molecular, and behavioral traits

When the Northern Hemisphere is tilted towards the sun (it's _____________) the Southern Hemisphere is tilted away from the sun and it's __________

Summer winter

Global climate patterns are determined by the amount of ________ and the planet's _______________ in space

Sun movement

Prokaryotic phototrophs capture energy from __________ using thylakoid membranes

Sunlight

A new species arises within the same geographic area as its parent species

Sympatric speciation

True or False: A clade can be as big or as small as we want

TRUE

True or false: Evolution is not goal directed

TRUE

The northern coniferous forest, largest terrestrial biome on Earth

Taiga

A biome located throughout midlatitude regions, where there is sufficient moisture to support the growth of large, broadleaf deciduous trees

Temperate broadleaf forest

A biome dominated by grasses and other nonwoody plants and maintained by seasonal drought, occasional fires, and grazing by large mammals

Temperate grassland

Why are stromatolites so important?

They created the atmosphere which protected the Earth from radiation

What did Beadle and Tatum do?

They hypothesized that the function of an individual gene is to dictate the production of a specific enzyme -worked with bread mold strains that were unable to be grown on a simple growth medium -"one gene one enzyme"

Why were cyanobacteria so important in the evolution of life on Earth?

They oxidized the oceans and atmosphere, creating the ozone layer, making Earth suitable for life

What are hominins?

This group includes humans and all extinct species more closely related to them than to any other group

What are examples of DNA viruses?

Those that cause hepatitis, chicken pox, and herpes

What are examples of RNA viruses

Those that cause the common cold, measles, mumps, polio, and AIDS

Which nitrogenous bases are pyrimidines?

Thymine, Cytosine, and Uracil

Why are sponges in the phylum porifera?

Tiny PORES in their outer walls

Why is DNA held by hydrogen bonds (weak bonds)?

To make replication easier like a zipper

What is Koch's Postulate used for?

To test whether a certain bacterium is the cause of disease

Responsible for the unwinding of DNA ahead of helicase. If _____________________ didn't exist, the DNA would get overwound and it would cause an accumulation of torsion stopping the ability of helicase and DNA or RNA polymerase

Topoisomerase

DNA is _________________ to RNA

Transcribed

DNA->mRNA

Transcription

What are the two processes in the Central Dogma of Molecular Biology

Transcription and Translation

What is this? -The polypeptide on the tRNA from the P site is moved to the tRNA in the A site. The tRNA that was in the P site (that just had the polypeptide moved from it) is moved to the E site. The tRNA with the polypeptide on it is now moved to the P site vacating the A site for a new tRNA with the anticodon that compliments the next codon on the mRNA transcript

Translocation

The genetic info for the amino acid sequence of a polypeptide chain are written in DNA and RNA as a series of nonoverlapping 3 base "words" called codons

Triplet code

The pattern of feeding relationships consisting of several different levels

Trophic structure

Very humid equatorial regions that have 200-400 centimeters of rain per year

Tropical rainforest

True or False: many amino acids have more than one codon for the same amino acid

True

What type of body cavity do segmented worms (annelida) have?

True coelomate

A biome at the northernmost limits of plant growth and at high altitudes, characterized by dwarf woody shrubs, grasses, mosses, and lichens

Tundra

Translate the following strand of tRNA into mRNA -AUGGUACCCACAUUUGCUAA-

UACCAUGGGUGUAAACGAUU

What are the three stop codons?

UGA, UAA, UAG

While natural selection acts on the best variations within a population there are mechanisms that keep ___________________ genotypes from being completely eliminated

Unfavorable

Protists are a collection of mostly ___________ eukaryotes

Unicellular

Why are scientific names of creatures in Latin?

Universal identification

What is Hardy-Weinberg equilibrium used to explain?

Used the explain why the shuffling of alleles that accompanies sexual reproduction does not alter the genetic makeup of the population

What is the function of biofilm?

Various functions including defense against invaders, resource apprehension, and more

Most mosses do NOT have _____________ ____________

Vascular tissue

The climate of the terrestrial biomes determines the type of ____________ that can grow

Vegetation

Tetrapods

Vertebrates with 4 appendages

What is an example of green algae FROM OUR LABS?

Volvox (colonial)

All parts of the biosphere are connected via the ____________ __________

Water cycle

Heterotrophic unicellular protists that decompose dead plants and animals in freshwater habitats

Water mold

Vascular tissue is used to conduct ___________ and _____________ upward from roots and to distribute _________ produced by leaves to rest of plant

Water nutrients sugar

Who is credited for discovering the double helix structure of DNA?

Watson & Crick

When does elongation stop in translation?

When the A site reaches a stop codon

When are endotoxins released?

When the cell dies or is digested by a defensive cell

What were some of the factors that lead to the mass extinctions that have occurred?

Widespread volcano eruptions lead to CO2 warming the earth and dissolved O2 levels lowering in water along with acid rain

Dead cells that form microscopic pipes that convey water and minerals upward from roots

Xylem

Do roundworms (nematoda) have body cavities?

YES: PSEUDOCOELOM

Are the two molecules of DNA made during replication identical to each other?

Yes

Are tissue layers present in cnidarians? If so, which ones?

Yes: ectoderm and endoderm

Do molluscs have tissues present? which kinds?

Yes: ectoderm, endoderm, mesoderm

What was incorrect about Lamarck's theory?

You cannot decide what traits are passed on to your offspring

Animals that drift in aquatic environments

Zooplankton

Zygomycetes: -have a protective _________________ where the zygote produced spores via meiosis -some are ______________ of plants and small animals -example: __________ ___________ ____________

Zygosporangium parasites black bread mold

All lophotrochozoans have:

a feeding apparatus known as a locophore

What are examples of primary consumers in aquatic environments?

a variety of zooplankton (mainly protists and microscopic animals such as small shrimps)that eat phytoplankton

Some heterotrophic protists obtain organic molecules by _______________ and some are _____________

absorption parasitic

Many thermophiles not only thrive in heat but also in __________ environments (such as the pools in Yellowstone National Park)

acidic

no body cavity--body is solid except digestive sac

acoelomates

Evolution of many diverse species from a common ancestor

adaptive radiation

the evolution of many diverse species from a common ancestor

adaptive radiation

what separates tunicates from other groups?

adult tunicates lose 3 of the 4 chordate traits

Prokaryotes are essential to _______________ and _______________ nutrients in the environment

decomposing recycling

Over time, standing water ecosystems gradually accumulate nutrients from the __________________ of organic matter and fresh influx from the land AND primary production increases in a process known as __________________

decomposition eutrophication

forward facing eyes in primates allows for

depth perception

Are echinoderms protostomes or deuterostomes

deuterostomes

the anus forms first and then the mouth

deuterostomes

What is the advantage of a complete digestive tract?

different parts of the digestive tract can be specialized for different functions

Body cavity: in animals with three tissue layers, the fluid-filled space between the ______________ tract and outer wall to cushion _______________organs and enable them to ___________ and ___________ independently of the __________ wall

digestive internal grow move body

Most animals are _____________ (except gametes) and reproduce _________________

diploid sexually

The majority of natural selection is ______________ selection

directional

Seeds fascilitate wide ____________ and can travel great ______________

dispersal distances

______________ selection occurs when both extreme phenotypes are favored, while individuals with intermediate phenotypes are selected against by something in nature

disruptive

the scientific study of the interactions between organisms and the environment

ecology

outer folds (dermal tissue and nervous tissue)

ectoderm

the outer layer of three embryonic cell layers in a gastrula; forms the skin of the gastrula and gives rise to the epidermis and nervous system in the adult

ectoderm

what kind of tissues do arthropods have?

ectoderm, endoderm, mesoderm

what type of tissues do echinoderms have?

ectoderm, endoderm, mesoderm

"cold blooded"

ectothermic

Interspecific interactions are classified according to the ____________ on the populations -whether they are _____________ (+), _____________(-), or have ______ effect (0)

effect helpful harmful no

Events in one biome can have ___________ in others

effects

what is the female gametophyte in angiosperms?

egg within the ovule

Along with homologous structures, comparative _______________ is also evidence of common ancestry

embryology

Multicellular, dependent embryo

embryophyte

A virus that has appeared suddenly or has recently come to the attention of medical students

emerging virus

Community ecology is necessary for the conversation of _______________ species and the management of ______________, ___________, and ______________ -also vital for controlling _______________ -applies to ________________

endangered wildlife game fisheries diseases agriculture

internal folds (digestive tract)

endoderm

the innermost of three embryonic cell layers in a gastrula; gives rise to the innermost linings of the digestive tract and other hollow organs in the adult

endoderm

hard skeleton within soft tissues

endoskeleton

what type of skeletons do echinoderms have?

endoskeleton

specialized, dehydrated, inner cell that has a thick, protective coat

endospore

Lipid components of outer membrane of gram-negative bacteria that are released when the cell dies or is digested by a defensive cell

endotoxins

The absence of natural ______________/_______________ often allows rapid population growth of invasive species

enemies predators

There is no way to recycle ____________

energy

In an ecosystem, ____________ moves THROUGH the components of an ecosystem while _____________ _____________ transfer materials WITHIN the ecosystem

energy chemical nutrients

the passage of energy through the components of an ecosystem

energy flow

Evolution occurs in response to the _______________ and ______________ conditions

environment changing

As well as mass extinctions, ______________ _________________ have also caused adaptive radiation

evolutionary innovations

in vertebrates, chordate traits become more _____________

evolved

Traits that have evolved for one purpose but became co-opted for another function

exaptations

Proteins that bacterial cell secrete into their environment

exotoxins

animal cells are held together by __________________ ______________ _____________ (collagen) and by unique intercellular ______________

extracellular structural proteins junctions

true or false: lancelets lose all their chordate traits as adults

false-they maintain all of the chordate traits

DNA Replication is ________ and __________

fast accurate

the evolution of the jaw opened up new ______________ opportunities

feeding

__________, ________________, and ______________ have vascular tissue

ferns gymnosperms angiosperms

Plants have evolved to have floral adaptations that increased pollinator ______________ to a species

fidelity

Holds up the anther

filaments

Sponges are __________-feeders

filter

hair-like projections that enable prokaryotes to stick to surfaces or each other (colonies)

fimbriae

Chaparral vegetation is adapted to periodic ____________ even though the plants contain many flammable chemicals

fires

long projections that help them move in response to chemical or physical signals in environment

flagella

Bryophytes and seedless vascular plants in moist environments have _____________ sperm

flagellated

Internal parasites include

flukes, tapeworms, and a variety of nematodes that live inside a host organism's body

The sequence of food transfer up the trophic levels is known as a

food chain

The type of vegetation in the terrestrial biomes provide types of ___________, ____________, __________ areas, and much of the organic material that is characteristic of the biome

food shelter nesting

Protocells on early Earth may have been able to ________, ________________ and create and maintain an _______________ environment different from their surroundings

form reproduce internal

Sequence in which fossils appear in the layers of sedimentary rock

fossil record

The ___________ __________ provides a substantial chronicle of evolutionary change that can help trace the phylogeny of many groups. However it is _______________ because we don't have fossils of every life form

fossil record incomplete

Few individuals colonize an island or new habitat

founder effect

birds: -_________-chambered heart -__________ influences their body structure -______________ have been remodeled as __________-covered _________ -large flight ___________ along the _______________ -lack _________ -small __________ -______________ feather shafts -light bones with _______________ structure-________________ -high rate of _____________ -large ____________ and complex _____________ -vertebral _____________

four flight forelimbs feather wings muscles breastbone teeth tails hollow honeycomb endothermic metabolism brain behaviors pneumaticity

in the polar ice biome, only a very small mass of the land is ever __________ of snow or ice in the summer

free

Amoebozoans include many species of ________-__________ amoeba, some _____________ amoebas, and the slime _________

free living parasitic molds

The ripened ovary of a flower which AIDS IN SEED DISPERSAL

fruit

protective ovary around the seed

fruits

______________ has nothing to do with common ancestry

function

Interbreeding to become one species is which hybrid zone? (reproductive barriers weaken until the two species become one)

fusion

Do cnidarians have a gastrovascular system or a complete digestive system?

gastrovascular system

______________ leads to the development of the digestive tract

gastrulation

Bilateral symmetry allowed for __________ which lead to development of __________

heads brains

consumption of plant parts or algae by an animal

herbivory

Although _______________ is not usually fatal, a plant whose body parts have been eaten by an animal must expend ___________ to replace the loss

herbivory energy

Natural selection can only work to increase or decrease ________________ traits

heritable

Prokaryotes who obtain their carbon atoms from the organic compounds of other organisms are _______________

heterotrophs

All organisms in trophic levels above the producers are __________________ (___________________)

heterotrophs consumers

species more closely related to humans than chimps; the members of the human lineage after it split with the chimpanzee lineage

hominins

why are homo sapiens present today and neanderthals aren't even though neanderthals have bigger brains?

homo sapiens were better at socializing, creativity, problem-solving, had a greater capacity for higher thought, and were more resourceful (ex: neanderthals could stab fish but homo sapiens could make a net for the whole river)

Features that often have different functions but are structurally similar due to common ancestry

homologous structures

Humans, cats, whales, and bats have similar bone patterns: humerus, radius, ulna, carpals, metacarpals, and phalanges

homologous structures

Similarities in characteristics that result from common ancestry

homology

What are some examples of homologous structures?

human arm, cat leg, whale fin, bat wing

What is the cause of the 6th mass extinction?

humans

Regions in which members of different species meet and mate, producing at least some hybrid offspring

hybrid zone

haploid gametes from two different species with different chromosome numbers fertilize to create a new species (due to errors in cell division)

hybridization

What type of skeletons do roundworms (nematoda) have?

hydrostatic

What type of skeleton do cnidarians have?

hydrostatic skeleton

What type of skeleton do flatworms have?

hydrostatic skeletons w/some muscular support

Network of threadlike filaments used for feeding

hyphae

a type of development in certain insects in which development from larva to adult is achieved by multiple molts but WITHOUT FORMING A PUPA

incomplete metamorphosis

Most complex structures evolved _______________ from simpler versions with the same basic ______________

incrementally function

75% of all invertebrates are ____________

insects

Animal life must withstand the cold of the tundra by having good _______________ and __________ retention

insulation heat

Community ecologist focus on the _________________ among species and community _________________

interactions dynamics

Male uses a variety of display/courtship methods to attract a female mate

intersexual selection

Males compete with one another to win the right to mate with females

intrasexual selection

The noncoding regions of the gene are known as

introns

animals without backbones

invertebrates

Atoms of an element that have the same number of protons, but a different number of neutrons

isotopes

a superclass of vertebrates known as agnatha--includes lampreys and hagfish

jawless fish

the evolution of vertebrates and a more complex endoskeleton gave rise to other features like _________, _________/___________ ______________, ________ __________ (_____________), and ______________ __________

jaws lungs/lung derivatives lobed fins tetrapods amniotic eggs

heterotrophic organisms that acquire their nutrients through absorption

kingdom fungi

small blade-like invertebrate chordates that live in marine sands; remain buried in the sand only protruding their head when cilia draw water into their mouth

lancelets

the evolution of lungs/lung derivatives and lobed fins opened up the possibility of life on ____________

land

amniotic eggs allowed for eggs to be laid on _________, no longer requiring the animal to be ___________ at some point in their life (aka now animals could live fully on land)

land aquatic

the genus homo's evolution was marked by what

larger brain size

osteichthyes: -______________ group of vertebrates-skeleton made of _____________ _________ -adapted to virtually every ______________ _____________ on earth -have a ________ ___________ -have an _______________

largest calcified bone aquatic habitat swim bladder operculum

immature individual that looks different from the adult animal

larva

row of sensory organs along each side of the body that is sensitive to changes in water pressure and can detect minor vibrations in the water

lateral line system

symbiotic association of millions of unicellular green algae or cyanobacteria held in a mass of fungal hyphae

lichen

Plant life in polar ice biome?

lichens and mosses

What nutrients that plants need are in the air

light and CO2

Members of a population may engage in intraspecific competition for _______________ resources such as __________, ____________, or ____________

limited food space water

What are examples of bryophytes?

liverworts, hornworts, and mosses

what are the names new world and old world monkeys based on

location

In aquatic ecosystems, primary production is limited by

low nutrient levels of phosphorus and nitrogen

nitrogen and phosphorus are more likely to be in ____________ quantities in aquatic environments than _____________

lower terrestrial

During a ______________ cycle, viral DNA replication occurs without destroying the host cell

lysogenic

The type of RNA that encodes genetic information from DNA and conveys it to ribosomes, where the information is translated into amino acid sequences

mRNA

You MUST have _________ to use the genetic code chart

mRNA

What are the four types of RNA?

mRNA, tRNA, rRNA, and snRNA

What is translation?

mRNA->amino acids

in a mollusc, the outgrowth of the body surface that drapes over the animal; this provides the shell and forms the _________ cavity

mantle

The end of each era is marked by a period of _______ ______________

mass extinction

Adaptive radiation occurred on a large scale following ______ ______________ due to the major vacancies of various ecological ___________

mass extinctions roles

eating __________ of any kind is expensive economically and environmentally

meat

Steps of animal reproduction and development: 1. Male and female gametes made through _______________ 2. Gametes ___________ (fertilization) to make a _________________ 3. Zygote divides via _____________->______________ 4. Blastula=hollow ball of __________ 5. One side of blastula folds inward forming a _______________ -internal folds->_______________(digestive tract) -outer folds->________________(dermal tissue and nervous tissue) -middle fold (in some animals)->_______________ (muscles and internal organs) 6. After gastrula, can form directly into adult or larva-> ___________________

meiosis fuse zygote mitosis blastula cells gastrula endoderm ectoderm mesoderm metamorphosis

middle fold (muscles and internal organs)

mesoderm

the middle layer of the three embryonic cell layers in a gastrula; gives rise to muscles, bones, the dermis of the skin, and most other organs in the adult

mesoderm

the method to investigate the diversity of prokaryotes by collecting samples from a particular environment, isolating, and sequencing the DNA they contain

metagenomics

the transformation of larva into an adult

metamorphosis

An archaean that lives in an anaerobic environment and gives off methane as a waste product

methanogen

the assembly of the collection of genomes of individual species present in an environment (done using computer software)

microbiome

the community of microorganisms that live in our body

microbiota

Change in the relative frequencies of alleles in a gene pool over a number of generations--evolution occurring on the smallest scale

microevolution

What is the climate of chaparrals?

mild, rainy winters and hot, dry summers due to cool ocean currents circulating offshore

A ___________ mutation is when the change in the nucleotide causes a change to the amino acid coding

missense

Excavata have modified _____________ that lack functional ETC and therefore use anaerobic glycolysis

mitochondria

A method that estimates the time required for a given amount of evolutionary changes

molecular clocks

the process of shedding an old exoskeleton or cuticle and secreting a new, larger one

molting (ecdysis)

Gastrovascular cavity: A central compartment with a single opening (the ___________); functions in both ____________ and _____________ distribution and may also function in ________________, body _____________, _________ disposal, and ______ exchange

mouth digestion nutrient circulation support waste gas

What is the benefit of radial symmetry?

movement in any direction

___________ evolves at a more rapid rate than nuclear DNA

mtDNA (mitochondrial DNA)

Almost all animals have ____________ cells for movement and _____________ cells to conduct impulses

muscle nerve

a structure used for locomotion or attachment; muscular organ extending from mollusc

muscular foot

Physical or chemical agents that cause mutations are called

mutagens

What is a (+/+) relationship?

mutualism

Hyphae branch repeatedly to form a mass called ______________ that absorbs food

mycelium

Fungal infection

mycosis

A process in which individuals with certain inherited traits are more likely to survive and reproduce than individuals that don't have those traits

natural selection

Organisms are adapted to abiotic and biotic factors through ___________ ____________

natural selection

which homo species had larger brains than homo sapiens

neanderthals

Are cnidarians protostomes or deuterostomes?

neither

Are sponges protostomes or deuterostomes?

neither

Do sponges have a gastrovascular system or a complete digestive system?

neither

do cnidarians have an open or closed circulatory system?

neither

Do sponges have an open or closed circulatory system?

neither because they use diffusion

The conversion of atmospheric nitrogen to nitrogen compounds that plants can absorb and use

nitrogen fixation

Eutrophication of aquatic systems may also result from increased levels of

nitrogen from feedlots and applications of large amounts of fertilizer

In lakes or ponds, the amounts of ________________ and ______________ determine the amount of phytoplankton

nitrogen phosphorus

Do cnidarians have body cavities?

no

Do flatworms have body cavities?

no

Do sponges have body cavities?

no

Do sponges have tissue? If so, how many?

no

What type of skeletons do sponges have?

no skeleton but they do have SPICULES and SPONGIN/COLLAGEN FIBERS

What are some characteristics of protozoans?

non-photosynthetic, unicellular eukaryotes, chemotrophs, parasitic ex: amoeba

Sexual selection is an example of _______________ mating

nonrandom

Eras are subdivided into

periods

Continuously frozen ground found in the arctic tundra

permafrost

______________ select for resistant insects while ______________ select for resistant bacteria

pesticides antibiotics

The conspicuous structures that attract animal pollinators

petals

Depiction of the hypothesized evolutionary relationships between organisms

phylogenetic trees

show common ancestral lineage which can be based on structural or molecular homologies

phylogenetic trees

Evolutionary history of a species or a group of species

phylogeny

Because the current of flowing water is swift, ________________ can't grow -all photosynthesis is carried out by _____________ attached to rocks or organic material

phytoplankton algae

Lichen is known as a _____________ species

pioneer

____________ are also attacked by parasites (not just animals)

plants

Small circular DNA molecules that replicate independently of the chromosome

plasmids

What is the male gametophyte in gymnosperms

pollen grain

what is the male gametophyte in angiosperms?

pollen grain

Pines and flowering plants have ___________ ______________ so they don't need to live in a moist environment

pollen grains

Flowers help reproduction by attracting ________________

pollinators

A cell or organism contains more than 2 pairs of homologous chromosomes (or is more than 2n)

polyploidy

sympatric speciation occurs when mating and gene flow between populations is reduced by factors such as _________________, ______________ differentiation, and _______________ selection

polyploidy habitat sexual

a group of interacting individuals of a particular species

population

pertaining to the rear/tail of a bilaterally symmetric animal

posterior

After fertilization of egg and sperm

postzygotic

Describe temperate broadleaf forests precipitation

precipitation is relatively high ranging from 75-150 centimeters per year which is easily distributed throughout the year as rain and snow

an interaction between species in which one species, the predator, kills and eats the other, the prey

predation

What are examples of a (+/-)relationship?

predation, herbivory, and parasites/pathogens

tails with the ability to grasp something

prehensile

Before zygote formation (fertilization)

prezygotic

Net _______________ production represents the stored chemical energy available to consumers

primary

Different ecosystems vary in their _____________ _______________ and contribution to the total production of the _______________

primary production biosphere

Primary production is carried out by

producers

What were the first life forms?

prokaryotes

What are ribosomes composed of?

proteins and rRNA

eukaryotes that are not members of the plant, animal, or fungi kingdoms

protists

Droplets with membranes that maintained an internal chemistry different from that of their surroundings

protocells

Are flatworms protostomes or deuterostomes?

protostomes

Are round worms (nematoda) protostomes or deuterostomes

protostomes

Are segmented worms (annelida) protostomes or deuterostomes?

protostomes

the first opening becomes the mouth

protostomes

Protists that are heterotrophs: eating bacteria and other protists

protozoans

cavity not completely lined by mesoderm tissue but functions like true coelom

pseudocoelom

amoebocyte: an amoeba-like cell that moves by __________________and is found in __________ animals; depending on the species, may ___________ and _______________ food, dispose of ___________, form ______________ fibers, fight _____________, and ____________ into other cell types

pseudopodia most digest distribute wastes skeletal infections change

Long periods of little change (equilibrium) punctuated by abrupt episodes of speciation

punctuated equilibria

A new species changes most as it buds from its parent species and then changes little for the rest of its existence

punctuated equilibrium model

What color is the stain of gram-positive bacteria?

purple

The frequency of dominant allele

q

The frequency of homozygous recessive

q2

An animal that eats tertiary consumers

quaternary consumer

closed circulatory systems are in __________, ____________, and more_____________ creatures

quick fast complex

This type of RNA with proteins makes up ribosomes, the most abundant type of RNA in most cells

rRNA

___________ sequences change at a much slower rate than DNA

rRNA

What is the body symmetry of cnidarians?

radial symmetry

A technique that uses the natural decay rate of unstable isotopes found in material in order to calculate the age of that material

radiometric dating

a toothed, rasping organ used to scrape up or shred food; found in many molluscs

radula

Some speciation can occur very _____________, other times very ____________

rapidly slowly

Evolutionary transformations often result from a change in the __________ or ____________ of developmental events

rate timing

Land plants evolved from

red and green algae

In which hybrid zone does the number of hybrids decrease?

reinforcement

the proportional representation of a species in a community

relative abundance

The contribution an individual makes to the gene pool of the next generation, relative to the contributions of other individuals in the population

relative fitness

These are the individuals that produce the greatest number of fertile offspring

relative fitness

As the air near 30 degrees north and south descends, they pick up moisture but then as they head towards the higher latitudes they ___________ the moisture -as a result, the north and south _______________ zones (latitudes around 60 degrees) tend to be relatively ________

release Temperate wet

RNA molecules could aid in the _______________ process as their own ________________

replication catalysts

water vascular system functions as every system except _______________

reproduction

Because predation has such a negative impact on _______________ success in prey populations, numerous ________________ for predator avoidance have evolved in ___________ populations through ______________ _________________

reproductive adaptations prey natural selection

dinosaurs were the largest and most diverse group of ____________

reptiles

An RNA virus that reproduces by means of a DNA molecule -it reverse-transcribes its RNA into DNA, inserts the DNA into a cellular chromosome, and then transcribes more copies of the RNA from the viral DNA

retrovirus

structures in the cytoplasm that coordinate the functioning of mRNA and tRNA and catalyze the synthesis of polypeptides.

ribosomes

An RNA molecule that functions as an enzyme

ribozyme

What are examples of fungal diseases in animals and humans?

ringworm, athlete's foot, yeast infections

A typical plant must obtain chemicals through both _________ and _______

soil air

Total collection of genes in a population at any one time

Gene pool

An animal that eats secondary consumers

tertiary consumer

a vertebrate with two pairs of limbs

tetrapod

What are the 8 layers of taxonomy?

-Domain -Kingdom -Phylum -Class -Order -Family -Genus -Species

What is the effect of interspecific competition?

- - for both populations

A nonliving component of the environment, such as air, water, or temperature

Abiotic factor

Describe the structure of DNA

-Double helix -Two complementary strands running antiparallel -Sugar-phosphate backbone (held by strong covalent bonds) -Bases point toward middle (held by numerous hydrogen bonds)

Compare and contrast DNA and RNA

-DNA is double stranded while RNA is single stranded -DNA has Thymine while RNA has Uracil -DNA is self-replicating while RNA isn't -DNA has deoxyribose while RNA has ribose -both have nitrogenous bases, a phosphate group, and a 5 carbon sugar -both have Cytosine, Guanine, and Adenine -both are synthesized by polymerase enzyme -both are polynucleotide strands

Which protists groups are part of the SAR supergroup?

-Diatoms -Brown Algae -Water Mold -Dinoflagellates -Ciliates -Foraminiferans -Radiolarians

What is the Cretaceous Extinction?

-Dinosaurs were wiped out -dust and debris blocked the sun for months, changing the overall global climate -thought to be caused by an asteroid

What are some unique structures of segmented worms (annelida)?

-body is segmented (better organization) -respire (breathe) through their body surface

What work did Erwin Chargaff do to help discover DNA's shape?

-Discovered the amount of adenine (A) was always in equal amounts to thymine (T) and the amount of cytosine (C) was always equal to the amount of guanine (G)

Describe deserts?

-2 centimeters of rain per year -extremely hot in the daytime (up to 140 degrees Fahrenheit) and extremely cold at night (below -22 degrees fahrenheit) -plants and animals have adapted to drought

What are the components of DNA?

-5 carbon sugar deoxyribose -Phosphate group -Nitrogen containing bases (A,G,T,C)

What are the components of RNA?

-5 carbon sugar ribose -Phosphate group -Nitrogen containing bases (A,G,U,C)

How can bacteria become resistant to antibiotics?

-A gene that codes for an enzyme to break down the antibiotic -A mutation that alters the binding site of an antibiotic can make it and its offspring resistant

Which protist groups are part of the ancestors of fungus and animals/us?

-Amoebazoans -Plasmodium slime molds -Cellular Slime Mold

What is the current theory for how multicellular organisms evolved from simpler unicellular organisms?

-Archaeplastids branched to include land plants--unikonts branch diverged into animals and fungi -choanoflagellates closely resemble collar cells -nucleariids closely resemble fungi

How do chimpanzee and human skulls change from youth to adult?

-As adults, the chimpanzee's jaw experiences an accelerated growth and a sloping forehead while human's growth has slowed -chimpanzee's brain growth dwindles after birth while human brains grow for the first year of life

What are examples of paedomorphosis?

-Axolotl retention of gills -Chimpanzee and human fetus skull development

Organisms can potentially be affected by many different variables, grouped into two major types:

-Biotic factors -Abiotic factors

What evidence is provided that birds have lungs similar to dinosaurs?

-Birds are the direct descendants of dinosaurs -Birds have immobilized lungs like dinosaurs -vertebral pneumaticity

What are the 5 types of fungi?

-Chytrids -Zygomycetes -Glomeromycetes -Ascomycetes -Basidiomycetes

What are the three main shapes of prokaryotes?

-Cocci -Bacilli -Spirochete

birds features

-Complex behaviors during mating seasons -Acute senses -Fine muscle control -Excellent eyesight -More efficient at extracting O2 from air then mammals (multiple air-sac, no diaphragm) ---vertebral pneumaticity

What is the criteria used for the phylogenetic species concept?

-DNA and protein sequencing -morphology -history

What is the differences and similarities between the lytic and lysogenic cycle?

-Lytic cycle doesn't have a prophage stage and the lysogenic cycle does -in the lytic cycle: DNA replication of virus takes place independently from the host DNA replication while in the lysogenic cycle: DNA replication of the virus takes place along with the host DNA replication -both of them describe virus replications -the lytic cycle is shorter than the lysogenic cycle -in the lytic cycle, viral replication occurs within a short period of time while it takes longer in the lysogenic cycle -lytic cycle is more common

What are the 3 types of symbiotic relationships?

-Mutualism (+/+) -Commensalism (+/0) -Parasitism (+/-)

What are the two general hypotheses about how life-supporting molecules appeared on early earth?

-Organic Molecule Hypothesis -Meteorite Hypothesis

Why were dinosaurs better adapted to thrive in low oxygen environment?

-Oxygen easily diffused across dinosaur's thin membranes (blood-gas barrier)

What are examples of keystone species in ecosystems?

-Pisaster sea stars -Sea otters -Gopher tortoises

What are the 6 major events in the history of life?

-Prokaryotes -Atmospheric oxygen -Single celled eukaryotes -Multicellular eukaryotes -animals -colonization of land

What are the three differences between RNA and DNA?

-RNA is single stranded while DNA is double stranded -RNA has the sugar ribose while DNA has the sugar deoxyribose -RNA has uracil instead of thymine

What are the three things that control development as organisms grow from zygote to adult?

-Rate -Timing -Spatial patterns

Which protist groups are part of the ancestors of land plants?

-Red algae -Green algae

What are the three effects of postzygotic barriers?

-Reduced hybrid viability -reduced hybrid fertility -hybrid breakdown

What could happen when separated populations of closely related species come back into contact with one another (3 options)

-Reproductive barriers are strong enough to keep them separated -Interbreeding between species to make it one -Combination of two species and the production of hybrids

How can mutations occur?

-Spontaneous mutations occur due to errors during DNA replication or recombination -Physical or chemical agents called mutagens

Explain how taxonomy and phylogenetics allow scientists to determine relationships between organisms?

-Taxonomy is the naming and classifying of species--it connects organisms by domains, kingdoms, phylums, classes, families, genuses, and species -phylogeny helps trace relationships between ancestors

What happens in the initiation step of translation?

-The small subunit first binds to the mRNA transcript and an initiator tRNA binds to the specific start codon AUG -the initiator tRNA has the anticodon UAC -the special tRNA brings the amino acid methionine -this signals the large ribosomal subunit therefore creating a functional ribosome

What did Beadle and Tatum discover?

-They hypothesized that the function of an individual gene is to dictate the production of a specific enzyme -worked with bread mold to come up with a breakthrough in demonstrating the relationship between genes and enzymes

The three bases that are pyrimidines are

-Thymine -Cytosine -Uracil

What are the five main enzymes involved in DNA replication?

-Topoisomerase -Helicase -DNA Polymerase -DNA Ligase -Single Stranded Binding Proteins

what are two clues provided to support that dinosaurs had different lungs than mammals?

-Vertebral pneumaticity compared to animal mobile lungs -forked ribs of dinosaurs (showing anchorage)

What work did Rosalind Franklin do to help discover DNA's shape?

-X-ray crystallography showed the shape of DNA to be spiral with a uniform diameter -Deduced DNA must be made of 2 polynucleotide strands

What are the two types of vascular tissue?

-Xylem -Phloem

Phosphate pollution leading to eutrophication comes from

-agricultural fertilizers -pesticides -sewage treatment facilities -runoff of animal waste from feedlots

What are examples of abiotic factors?

-air -water -temperature -forms of energy available

An ecosystem consists of...

-all the organisms in a community -the abiotic environment with which the organisms interact

5 parts of amniotic egg?

-amnion -yolk sac -allantois -chorion -albumen

What does detritus consist of?

-animal wastes -plant litter -bodies of dead organisms

Describe temperate grasslands

-annual precipitation is 25 -75 centimeters per year with periodic severe droughts -rain dictates size of grass -fires are a regular occurrence but the below-ground growing regions of the grasses survive the flames -largest agricultural regions in the world -nutrient rich soil

What are anthropoids?

-apes (gibbons, orangutans, gorillas, chimpanzees, bonobos, and humans diverged from Old World monkeys

What are the 3 types of symmetry?

-asymmetrical/spherical -radial -bilateral

Describe green algae

-autotrophs -some unicellular and some multicellular -colonial -grass green chloroplasts

Which mode of nutrition is red algae?Is it unicellular or multicellular?

-autotrophs -some unicellular most multicellular

primate characteristics?

-binocular vision (forward facing eyes) -five fingers and toes -most live in trees (except apes and humans) -prehensile tail (in primates through new world monkeys)

What do biogeochemical cycles include?

-biotic components -abiotic components -abiotic reservoirs

Major differences between modern chimps and humans are?

-bipedalism -brain size

What makes is a functional ribosome?

A functional ribosome consists of 3 tRNA binding sites (A,P, and E sites)

How are pesticides evidence of natural selection in action?

A relatively small amount of poison initially kills most of the insects but subsequent applications are less and less effective. The few survivors of the first pesticide wave are individuals that are genetically resistant, carrying an allele that somehow enables them to survive the chemical attack

Adding site -usually vacant waiting for the next tRNA bringing an amino acid

A site

What is the cap and tail?

A small cap (a modified form of a G nucleotide) at the 5' end and a long tail (a chain of 50 to 250 A nucleotides) at the 3' end

What are the complementary bases?

A with T and C with G

What are the three sites that the large subunit has?

A, P, and E sites

What is the start codon?

AUG (methionine)

Organisms must adapt to the ___________ factors in their environment

Abiotic

The two bases that are purines are

Adenine and Guanine

Which nitrogenous bases are purines?

Adenine and Guanine

What are the five types of nitrogenous bases?

Adenine, Cytosine, Guanine, Thymine, Uracil

_______________ led to the development of artificially selected crops based on __________ and ease of ____________

Agriculture taste growth

What scientist had a similar idea to Darwin but did not receive credit?

Alfred Russel Wallace

What motivated Darwin to publish his book?

Alfred Wallace

In many aquatic ecosystems, low levels of nitrogen and phosphorus limit the growth of ___________ and _________________ _______________

Algae photosynthetic bacteria

What are the descendants of multicellular eukaryotes?

Algae, plants, fungi, and animals

Insertion or deletion can change almost ______ of the amino acids brought during translation

All

What was Darwin's second observation?

All species are capable of producing more offspring than the environment can support

Mode of speciation in which a population is geographically isolated from other populations and evolves into new species

Allopatric speciation

What does antiparallel allow?

Allows the nitrogenous bases to pair up and bond

Life cycle in which a multicellular diploid (2n) form alternates with a multicellular haploid (n) form

Alternation of Generations

new world monkeys are from the....

Americas

What is the meteorite hypothesis?

Amino acids could have been present when Earth formed, or these organic molecules may have arrived on Earth through meteorite or asteroid impacts

A general term for a protist that moves and feeds by means of pseudopodia

Amoeba

All organisms are related through common ______________ and these relationships can be shown using _________________ trees

Ancestors phylogenetic

What is vertebral pneumaticity?

Anchoring of respiratory system to backbone

Most plants alive today are ______________

Angiosperms

Why did the colonization of land by animals happen so late?

Animals needed the ozone layer to colonize land--survive on land

At the bottom of a tRNA is a special triplet base known as an

Anticodon

Double stranded DNA compliments run in opposite directions, this makes them ________________

Antiparallel

Which types of surfaces can biofilm form on?

Any surface (ex: rock, soil, living tissue, liquids, metal, plastics)

Region between 200 meters and lower beneath the photic zone in which light does not penetrate enough for photosynthesis to take place -some light does reach up to 1,000 deep but it's not enough for photosynthesis to provide ____________

Aphotic zone energy

What mode of nutrition are diatoms?

Autotrophic (photosynthetic)

What body symmetry do molluscs have?

BILATERAL

What body symmetry do round worms (nematoda) have?

BILATERAL

What symmetry are segmented worms (annelida)

BILATERAL

what is the body symmetry of flatworms?

BILATERAL

what type of symmetry do arthropods have?

BILATERAL

A major type of ecological association that occupies a broad geographic region of land or water -characterized by organisms adapted to the particular environment

BIOME

Biofilms are common among ____________ that cause ____________ in humans

Bacteria disease

What are the differences in histones associated with DNA between the DOMAINS?

Bacteria: absent Archaea: Present in some species Eukarya: present

What are the differences in RNA polymerase between the DOMAINS?

Bacteria: one kind; relatively small and simple Archaea: several kinds; complex Eukarya: several kinds; complex

What are the differences in peptidoglycan in cell wall between the DOMAINS?

Bacteria: present Archaea: absent Eukarya: absent

What are the differences in introns between the DOMAINS?

Bacteria: rare Archaea: in some genes Eukarya: present

What are the differences in RNA sequences between the DOMAINS?

Bacteria: some unique to bacteria Archaea: Some unique to archaea; some match eukaryotic sequences Eukarya: some unique to eukaryotes; some match archaeal sequences

When natural selection maintains stable frequencies of 2 or more phenotypic forms in a population

Balancing selection

What is an example of convergent evolution?

Bats and dolphins both use echolocation as a mechanism for hunting

Sexual selection/choice--choosing not to mate (a lot of the time because of morphological difference)

Behavioral isolation

The seafloor ranging from the continental shelf to the deep-sea bottom

Benthic realm

arrangement of body parts so that the organism can be divided equally longitudinally, left and right side mirror images

Bilateral symmetry

The more species evolve and change, the more __________________ diversity

Biological

The entire portion of Earth inhabited by life -the sum of all the planet's ecosystems

Biosphere

What animal are the hypothesized structure of dinosaur lungs used as a basis to compare to?

Bird

Do molluscs have an open or closed circulatory system?

Both

Clades reflect the _____________ pattern of ______________ and can be used to construct _______________ trees

Branching evolution phylogenetic

How does a diverse tree community promote animal diversity?

By providing a broader range of habitats and food sources

A sticky layer of polysaccharides and proteins that covers the bacterial cell wall

Capsule

What is the major ingredient of all organic molecules

Carbon

Above primary consumers, the trophic levels are made up of ________________ including _______________ which eat the consumers from the level below

Carnivores insectivores

Who introduced taxonomy?

Carolus Linnaeus

What is an example of red algae that is used commercially in different substances?

Carrageenan (stabilizes ice cream, milk, makeup)

What is the function of mRNA?

Carries the genetic instructions of a gene to the ribosome in the cytoplasm

What caused the Permian Extinction?

Caused by massive widespread volcano eruptions -spewed ash and noxious gases produced enough CO2 to warm the earth by six degrees -the temperature raise lowered dissolved O2 levels in water as well as slowing down the circulation of water -noxious gases in the atmosphere provided the conditions for widespread acid rain

A type of protist that has unicellular amoeboid cells and aggregated reproductive bodies in its life cycle; a member of the amoebozoan clade

Cellular slime mold

To combat potential losses, many farmers and forest managers rely heavily on ______________ methods of controlling pests

Chemical

An organism that obtains both energy and carbon from inorganic chemicals -A _______________ makes its own organic compounds from CO2 without using ________ energy

Chemoautotroph light

Because they don't depend on sunlight, _______________ can thrive in conditions that seem totally inhospitable to life

Chemoautotrophs

An organism that obtains both energy and carbon from organic compounds

Chemoheterotroph

Which is the largest and most diverse group of prokaryotes' mode of nutrition?

Chemoheterotrophs

At the tropics, high solar radiation causes a lot of ____________ which spreads warm _________ air towards the __________

Evaporation moist poles

Fungi are essential _____________ in our ecosystem

DECOMPOSERS

Enzyme that bonds sugar phosphate backbone together and links Okazaki fragments on the lagging strand -acts like "glue" to bond sugar phosphate backbone of neighboring DNA fragments

DNA Ligase

Enzyme that links DNA nucleotides to growing daughter strand (only on the 3' end)

DNA Polymerase

Types of Nucleic acids?

DNA and RNA

What is DNA replication?

DNA replication is the process of making DNA from DNA (replicating DNA)

What is the Central Dogma of Molecular Biology?

DNA->RNA->Protein

A prokaryote or fungus that secretes enzymes that digest molecules in organic material and convert them to inorganic forms

Decomposer

By breaking down detritus, ________________ link all trophic levels

Decomposers

Prokaryotic _____________ are used in bioremediation because they break down matter

Decomposers

Enormous numbers of microscopic ________________ in the soil and in the mud at the bottom of lakes and oceans break down most of the community's organic materials to ________________ compounds that _____________ or ______________________ can use

Decomposers inorganic plants phytoplankton

The breakdown of organic materials into inorganic ones

Decomposition

Pertaining water; For terrestrial organisms, _______________ is a major danger

Dehydration

What happens when you take oxygen away from ribose?

Deoxyribose

What does DNA stand for?

Deoxyribose nucleic acid

The conversion of semi-arid regions to desert

Desertification

The driest of all terrestrial biomes characterized by low and unpredictable rainfall

Deserts

An organism that consumes decaying organic material

Detritivore

Dead organic matter

Detritus

echinoderms and chordates -deuterostomes

Deuterostomia

What is majorly important about chytrid fungus?

Devastating effect on amphibians

Which feature of the anoles kept different species from mating?

Different colored dewlaps

1st Step Fungi Life cycle: 1. Hyphae of _____________ fungi meet and ______________ fuses but the nucleus doesn't immediately fuse (________________ stage) containing 2 genetically different ______________

Different cytoplasm heterokaryotic nuclei

Because it would take so long to replicate from one end of DNA to the other, replication points (bubbles) occur at many ______________ ________ at the same time and are joined together by ___________

Different sites enzymes

Unicellular autotrophs, heterotrophs, and mixotrophs -blooms of these create toxic "red tide"

Dinoflagellates

_______________ selection moves the curve on the graph left or right.

Directional

________________ selection favors phenotypes at one extreme of a trait's range

Directional

The graph in ________________ selection has two curves, one at each extreme

Disruptive

While terrestrial organisms have a plentiful supply of oxygen, aquatic organisms must depend on oxygen _______________ in ___________

Dissolved water

In ecology, an event that changes a biological community by removing organisms from it or altering the availability of resources

Disturbances

All gram-positive bacteria are ____________ and ___________-_____________

Diverse gram-positive

What is the shape of DNA?

Double helix

Plants must keep their gametes and developing embryos from _______________ out in the air

Drying

Gene _____________ has played a crucial role in evolutionary development providing more genes meaning more opportunities for further evolutionary changes

Duplication

Exit site of the uncharged tRNA (no longer has an amino acid attached to it)

E site

what type of skeleton do arthropods have?

EXOSKELETON

What are examples of detritivores?

Earthworms and millipedes

nematodes and arthropods -all have external skeletons

Ecdysozoa

the role of a species in its community; the sum total of a species' use of the biotic and abiotic resources of its environment

Ecological niche

Identifies species in terms of their ecological niches, focusing on unique adaptations to particular roles in a biological community

Ecological species concept

The process of biological community change resulting from disturbance -transition in the species composition of a biological community

Ecological succession

All the organisms in a given area, along with the nonliving (abiotic) factors and the living (biotic) factors with which they interact -a biological community and its physical environment

Ecosystem

Wetlands have been recognized as important _______________ and are now being highly _______________

Ecosystems protected

Organisms that rely on their environment for body temperature regulation

Ectothermic

Modern day green algae: -Grows at the ___________ of __________ -___________-like _______________ colonies -Probably resemble early plant ________________

Edges lakes disk multicellular ancestors

Before the mRNA leaves the nucleus it undergoes a number of "________" (eukaryotes only)

Edits

Which stage of transcription does this happen? -RNA polymerase binds to the promoter region and begins transcribing the DNA template of the gene into mRNA -as the mRNA is being produced it strips away from the DNA template (does not stay attached to the DNA) -the DNA rebinds to its complementary strand reforming the double helix

Elongation

If environmental conditions become too harsh to sustain active metabolism, some prokaryotes can form a specialized resistant cell called an _________________

Endospore

Organisms that produce their own body heat

Endothermic

Which generation (gametophyte or sporophyte) is dominant in seedless vascular plants?

Equal

The Northern and Southern Hemisphere get an _____________ amount of light, the light is spread out over a greater area due to the Earth's _______________

Equal curvature

As dry air descends, some of it spreads back toward the ____________ -this movement creates the _____________ ___________ ___________ which dominate the ___________

Equator cooling trade winds tropics

The sun's rays strike ________________ areas most directly

Equatorial

Tropical forests: -occur in _____________ areas where the temperature is ____________ and days are 11-12 hours -________ types of tropical forests depending on the timing of the rain

Equatorial warm 2

Molecular clocks can provide ______________ for evolutionary changes that are not recorded in ____________ evidence

Estimates fossil

A biome that occurs where a freshwater stream or river merges with the ocean

Estuary

what is the example of excavata FROM OUR LABS?

Euglena

"true animals" that have true tissues (all animals except sponges)

Eumetazoans

true or false: bigger brains came before bipedalism

FALSE bipedalism came first

True or False: All substitutions are bad

False

True or False: the stop codons code for amino acids

False

A microorganism that lives in a highly saline environment such as the Great Salt Lake or the Dead Sea

Extreme halophile

A microorganism that thrives in a hot environment (140-176 degrees Fahrenheit)

Extreme thermophiles

Organisms with enlarged ___________ and/or _______________ live in the aphotic zone -at this depth, organisms such as ____________ ____________, _____________, and _______________ (________ ______________, ______ ___________, _________ ____________) survive on dead organisms that fall/sink from the ____________ zone

Eyes bioluminescence annelid worms crustaceans echinoderms sea cucumbers sea stars sea urchins photic

True or False: biofilms are always easy to get rid of

FALSE

True or false: mammals could compete against dinosaurs

FALSE

true or false: mutualism can't occur between species that are not symbiotic

FALSE

Chytrids: -Only fungi with ______________ ___________ -many are ____________ while others are ______________

Flagellated spores decomposers parasites

complex reproductive structures that develop seeds within protective chambers

Flowers

What is an example of mutualism between two non symbiotic species

Flowers and their pollinators

Diatoms are considered one of the bases of the ____________ ___________

Food chain

A network of interconnecting food chains

Food web

A protist that moves and feeds by means of threadlike pseudopodia and has porous shells composed of calcium carbonate

Foraminiferan

How does sexual selection lead to evolution and speciation?

Form of natural selection in which individuals with certain traits are more likely than others to obtain mates -this leads to more evolutions to gain mates for reproduction and can create new species when some mates don't respond to certain displays and others do

Imprints or remains of organisms that lived in the past

Fossils

The Galapagos finches were created by the _____________ effect from a single common ancestor

Founder

Adding or deleting nucleotides alters the reading frame of the message meaning everything "downstream" of the insertion or deletion can be altered, what is this mutation called?

Frameshift Mutation

_____________ ______________ laid the groundwork for the discovery of DNA in 1928 when studying 2 strands of bacterium

Frederick Griffith

_______________ biomes are less than 1% of the earth's surface and accounts for less than 0.01% of the world's water supply but harbors an estimated _____ percent of the Earth's _____________

Freshwater 6 biodiversity

example of allopatric speciation

Galapagos finches

male and female structures that produce gametes; have protective jackets of cells to protect the gametes

Gametangia

_______________ produce gametes; _____________ produce spores

Gametangia Sporangia

Egg remains in the female __________________ and is fertilized by the sperm that swims through a film of __________

Gametangium water

When creatures are different enough that the sperm can't fertilize the egg or egg can't recognize the sperm

Gametic isolation

Multicellular haploid form that produces haploid gametes (mitosis)

Gametophyte

Which generation (gametophyte or sporophyte) is dominant in bryophytes?

Gametophyte

______ ______________ can't occur through cuticle

Gas exchange

Do flatworms have a gastrovascular system or a complete digestive system?

Gastrovascular system

When a population gains or loses alleles when fertile individuals move into or out of a population or when gametes are transferred between populations -immigration vs. emigration

Gene flow

What are examples of retroviruses?

HIV and a number of cancer-causing viruses

hominin diversified greatly between 2 and 4 mya which is also when the human genus, ___________, arose

HOMO

Geographic physical barrier as a reproductive barrier

Habitat isolation

What are the four eons?

Hadean, Archaean, Proterozoic, Phanerozoic

What are the three parts of fungi life cycle?

Haploid (n), diploid (2n), and heterokaryotic stages (n+n)

The life cycle of all plants involve the alternation of a _____________ generation and a ____________ generation

Haploid diploid

What are the dominant trees in temperate broadleaf forests?

Hardwood deciduous trees (hickory, oak, birch, beech, and maple)

The state of a population in which frequencies of alleles and genotypes in a population remain constant from generation to generation, provided that only Mendelian segregation and recombination of alleles are at work

Hardy-Weinberg equilibrium

What is an example of a quaternary consumer on land?

Hawks

What did Darwin discover on the Galapagos islands?

He found that most of the animals were found nowhere else in the world but resembled South American species

How did Thomas Malthus contribute to Darwin's ideas

He thought that resources were going to run out because of the growing population -Darwin thought of survival of the fittest; people have to evolve to get the resources

Enzyme that "unzips" the double stranded DNA using ATP thereby exposing each strand for replication

Helicase

Using information discovered by Frederick Griffith, ______________ & _______________ discovered DNA was Griffith's "transforming factor" that can cause heritable change

Hershey Chase

Type of balancing selection in which heterozygous individuals have greater reproductive success than either type of homozygote, with the result that 2 or more alleles for a gene are maintained in a population

Heterozygote advantage

What are physical mutagens?

High energy radiation like x-rays, UV light, or gamma rays

________ temperatures throughout the year and ample ____________ largely explain why rain forests are concentrated near the ___________

High rainfall equator

Why is the soil nutrient poor in tropical rainforests?

High temperatures and rainfall lead to rapid decomposing and release of nutrients which are quickly taken up by the vegetation or washed away

What is the problem with the phylogenetic species concept?

It depends on how much difference is "required" to place organisms on their own branch

Why does DNA replication happen in the S phase?

It happens before Mitosis or Meiosis so that there's enough DNA to be split into the daughter cells

Evolution is limited by _______________ ______________: existing structures adapt to function in new/different fashions

Historical constraints

Genes which regulate the development of anatomical structures in various organisms

Homeotic genes

What is an example that evolution is not goal directed?

Horses

What can we learn from the fossil record?

How populations have changed over geological time; evolution, extinction

Invasive species have been introduced into non-native habitats usually by what?

Human actions

This influence of Darwin originated the idea of uniformitarianism-the same processes that occurred in the Earth long ago are still occurring

Hutton

This happens when the hybrids are viable and fertile but their offspring are feeble or sterile

Hybrid breakdown

In pairs of clearly distinct species that do occasionally interbreed, the resulting offspring are called _______________

Hybrids

The nitrogenous bases are held together by what type of bonds?

Hydrogen

what type of skeleton do segmented worms (annelida) have?

Hydrostatic

How were the Galapagos finches evidence for natural selection in action?

In dry years when all seeds are in short supply, birds must eat more large seeds. Birds with larger, stronger beaks have a feeding advantage and greater reproductive success-increase in average beak depth. During wet years, smaller beaks are more efficient for eating small seeds and there was a decrease in average beak depth

Which mode of nutrition is excavata?

Includes autotrophs, heterotrophs, and mixotrophs

Biomes are not _____________, ________-contained units

Individual self

What was Darwin's first inference?

Individuals whose inherited traits give them a higher probability of surviving and reproducing in a given environment tend to have more offspring than other individuals

The group of species being focused on that are related by a shared ancestral character

Ingroup

Which stage of transcription does this happen? -Helicase is used like in replication to unzip the DNA and expose the gene template -RNA Polymerase brings in RNA nucleotides to make a strand of mRNA--moves like DNA polymerase

Initiation

The distribution and abundance of photosynthetic organisms, including plants, algae, and photosynthetic bacteria depend on the availability of ________________ nutrients such as ________________ and _______________

Inorganic nitrogen phosphorus

Arthropods

Insects and spiders

When are exotoxins released?

Instantly (after creation)

Competition between individuals or populations of two or more species that require the same limited resources

Interspecific competition

Relationships with individuals of other species in the community -greatly affect population structure and dynamics

Interspecific interactions

Distinct biome in which the ocean interfaces with land or freshwater -pounded by waves during high tide and exposed to the sun and drying winds during low tide

Intertidal zone

What is the difference between intersexual and intrasexual selection?

Intrasexual selection is when males compete with one another to win a mate and intersexual is when males use display/courtship to attract a mate

What is the difference between an intron and an exon?

Introns are the noncoding regions of the gene and exons are the coding regions of the gene

A non-native species that spreads beyond its original point of introduction and causes environmental or economic damage

Invasive species

Coral reefs support a huge variety of _______________ and ____________

Invertebrates fish

Heterozygotes can "hide" an unfavorable recessive allele, what does this allow?

It allows the population to maintain a large pool of alleles, some of which may not be advantageous under the current conditions but might be favorable in the future

Freshwater wetlands range from _____________ (sunnier), ____________ (shaded), and ______________ (forms peat moss)

Marshes swamps bogs

When creatures don't have the right parts, parts don't match

Mechanical isolation

3rd step of fungus life cycle: Diploid zygote undergoes _______________ producing haploid _____________

Meiosis spores

What was Darwin's first observation?

Members of a population vary in their inherited traits

Function summary of types of RNA: mRNA: ______________ rRNA: ________________ tRNA: ________________ snRNA: __________ ___________

Messenger ribosomal transfer small nuclear

What were the early gases on Earth?

Methane, ammonia, hydrogen, and water vapor

What was the first "bug" to exhibit antibiotic resistance?

Methicillin resistant staphylococcus aureus (MRSA)

What is the difference between microevolution and speciation

Microevolution involves evolutionary changes within a population, while speciation occurs when a population changes enough that it diverges from its parent species and becomes a new species

What is the effect of small mountain ranges?

Smaller coastal ranges cause moisture from the coast to rise and cool, dumping a lot of precipitation on and beyond the range

____________ and ________ _____________ are coastal wetlands that often border estuaries and experience tidal fluctuations

Mudflats salt marshes

Brown algae are large, complex, ________________ ______________

Multicellular autotrophs

Basidiomycetes: -example: ________________, _____________, and _______ fungi -particularly excellent at breaking down ____________ in wood; making them powerful _________________ -two highly parasitic species: _________ and ____________

Mushrooms puffballs shelf lignin decomposers rusts smuts

In wetlands, there is high species diversity including organisms like ___________ and _____________ that ___________ the water

Mussels clams filter

______________ is the production of mutations

Mutagenesis

Any change in the nucleotide sequence of DNA

Mutation

What is the ultimate source of all new alleles

Mutations

An interspecific relationship in which both partners benefit

Mutualism

4th step of fungus life cycle: Spore producing structure arise from the haploid _______________ that hasn't undergone a ________________ or _______________ stage

Mycelium heterokaryotic meiotic

mycelium extends into plant roots to help the plant obtain phosphorus and essential minerals; the plant gives the fungus some sugars (MUTUALLY BENEFICIAL)

Mycorrhiza

Glomeromycetes: -form a distinct _______________ that invades plant roots and branch into tiny treelike structures known as abusculae -roughly 80%-90% of all plants have this ______________ relationship (helps deliver _________________ and other minerals to plant while receiving ______________ nutrients)

Mycorrhiza symbiotic phosphate organic

Interspecific interactions can act as power agents of _______________ _______________

Natural selection

How are mutations related to natural selection?

New alleles originate by mutation, a change in the genetic information encoded in the DNA. Thus, mutation is the ultimate source of the genetic variation that serves as raw material for evolution

What is an example of a chemical mutagen?

Nitrous acid

Do all mutations in the DNA coding for mRNA cause a change in an organism?

No, some can be silent and still code for the same amino acid

Relative fitness is an example of _________________ mating

Nonrandom

______________ mutations are the result of a mutation that substitutes a nucleotide to change the amino acid codon to a stop codon

Nonsense

Most precipitation in taiga is in the form of

Snow

___________, ____________, and ___________ may also play a role in aquatic ecosystems

Salinity currents tides

In an Estuary: -_______________ ranges from nearly __________________ to having the same saltiness of the __________ -crucial nesting and feeding area for _____________ -waters enriched with _____________ (some of the most ________________ biomes on Earth) -mix of salty and freshwater is known as _____________ water

Salinity freshwater ocean waterfowl nutrients productive brackish

A biome dominated by grasses and scattered trees -maintained by occasional fires and drought

Savanna

An animal that feeds on the carcasses of dead animals

Scavenger

A type of ecological succession that occurs where a disturbance has destroyed an existing biological community BUT left the soil intact

Secondary succession

Ergots: -infection of the _________ __________ -toxic to ______________

Seed head humans

____________________ Model: each daughter molecule has an original strand and a new strand. Half the parent molecule is maintained (conserved) in each of the daughter molecules

Semiconservative

Groups of lizards that occupy different ecological niches, and have different __________________ and/or ____________________/features

Shapes morphologies

A characteristic that is common to members of a particular clade but is NOT the distinguishing characteristic of that clade

Shared ancestral character

A characteristic that is common to members of a particular clade but not found in its ancestors. The characteristic that separates it from other ancestral groups

Shared derived character

What is an example of heterozygote advantage?

Sickle cell anemia protects from malaria

What type of mutation is this? -If a mRNA codon is GCA it codes for the amino acid alanine -If the A is substituted for a U (now GCU) it still codes for alanine

Silent mutation

Diatoms have a cell wall containing ___________ (glassy look)

Silica

The more _____________ the DNA sequence between species, the more related they must be; the more _________________ in DNA or amino acid sequences, the farther they are on the evolutionary tree

Similar differences

Proteins that prevent a DNA molecule from reforming the hydrogen bonds while the molecule is being replicated

Single stranded binding proteins

What are the two subunits of a ribosome called?

Small subunit and Large Subunit

Why was the first form most likely a form of self replicating RNA?

Smaller and simpler than DNA

What is the most important abiotic factor and why?

Temperature because of its effect on metabolism

________________ and __________________ are crucial aspects of what organisms can live in an area

Temperature precipitation

Terrestrial biomes are determined primarily by _____________ and ______________ -similar assemblies of plant and animal types are found in areas that have similar ______________

Temperature precipitation climates

Populations that are breeding at different times

Temporal isolation

Which stage of transcription does this happen? -The RNA polymerase transcribes the gene until it reaches a specific sequence of DNA nucleotides known as the terminator -then RNA Polymerase detaches from the DNA template

Termination

A special sequence of nucleotides in DNA that marks the end of a gene. It signals RNA polymerase to release the newly made RNA molecule and then depart from the the gene

Terminator

What did Lycell argue in his book Principles of Geology?

That Earth has been sculpted over millions of years by gradual geologic processes that continue today

What did the Miller-Urey experiment show?

That organic compounds could be made by passing an electrical current through a closed system of early gases

What has comparing genomes shown?

That the number of genes has not increased at the same rate as the complexity of organisms

Who were the explorers in the Galapagos Island video, who did an experiment proving what Darwin saw?

The Grants

Radiometric dating is usually measured using...

The amount of carbon-14 in a sample compared to other isotopes of carbon

What does 3' and 5' refer to?

The carbon number on the sugar

What happens after the introns are cut out of the mRNA strand?

The exons are "pasted" together to completely join the coding regions of the gene

What are molecular clocks based on?

The observation that some genes or regions of the genome appear to accumulate changes at a constant rate

How can mutations in the DNA cause a change in an organism's protein?

They change what the nucleotides code for and the proteins that will be made

What is an example of biogeography evidence for evolution from a common ancestor?

The similarities amongst the various armadillo/anteater organisms across the Earth

Which strand is the lagging strand?

The strand where DNA polymerase has to work in fragments away from the fork

Which strand is the leading strand?

The strand where DNA polymerase is adding towards the fork -continous

What was Darwin's second inference?

The unequal production of offspring will lead to the accumulation of favorable traits in a population over generations

What are other possible explanations (other than mutations) for how genetic variation occurs in most sexually reproducing populations

The unique combination of alleles that each individual inherits (crossing-over in meiosis)

The phosphorus cycle depends on what?

The weathering of rock

Why are gymnosperms called naked?

Their seeds are not produced in specialized chambers

Life can arise from nonliving matter at any moment

Theory of spontaneous generation

animals digest food within their _________ after ______________ other organisms dead or alive

body ingesting

Drastic reduction in population size due to natural disasters or epidemics

bottleneck effect

most rays are adapted to life on the __________, with ______________ bodies and eyes on the _______ of their heads

bottom flattened eyes

Animal forms arose during the ______________ explosion

cambrian

rapid diversification 535 to 525 million years ago during Cambrian period

cambrian explosion

Female reproductive structure (composed of the ovary, style, and stigma)

carpel

Competition lowers the _____________ ______________ for competing populations because the resources used by one population are not available to the other population

carrying capacity

the minimum amount of individuals that can be sustained by the resources in an environment

carrying capacity

Animal cells lack

cell walls

molluscs with closed circulatory systems

cephalopods

____________ can influence the genetic make-up of a population; environments can change unpredictably keeping evolutionary changes from taking root

chance

Except for meteorites, there are no extraterrestrial sources of ______________ elements

chemical

the transfer of materials, such as carbon, within an ecosystem

chemical cycling

The transfer of food in the food chain moves ________________ ________________ and _______________ from organism to organism up through the ______________ levels in a community

chemical nutrients energy trophic

A strong, flexible nitrogen-containing polysaccharide

chitin

Fungi cell walls are composed of _____________

chitin

a flagellated feeding cell in sponges; has a collar-like ring that traps food particles around the base of its flagellum

choanocyte (collar cells)

scientific name for sharks and rays?

chondrichthyes

the ____________ and ____________ enable the embryo to obtain oxygen from the air and dispose of carbon dioxide

chorion allantois

the organ system that transports materials such as nutrients, oxygen, and hormones to body cells and transports carbon dioxide and other wastes from body cells

circulatory system

chance events can cause allele frequencies to fluctuate unpredictably from one generation to the next

genetic drift

Differences among two similar species due to their different environments is not always due to changes in their ______________

genetics

The sequence and age of the rocks and fossils that established the fossil record

geologic record

When plates move toward/into one another it can cause _______________ __________________ (mountain formation)

geological upliftings

jaw originated from a modified ________ -the first ________ arch evolved to become jaw structure -teeth then evolved from _______-like epidermal structures

gill gill scale

Which model of speciation did Darwin believe in?

gradualism

The Tropics experience the _____________ annual input and least seasonal ______________ in ____________ radiation

greatest variation solar

The total primary production of an ecosystem during a given time period; expressed in units of energy or units of biomass

gross primary production

A place where an organism lives (includes biotic and abiotic factors)

habitat

Examples of _______________ isolation are high altitudes versus low altitudes, mountains, or Pangea

habitat

what are mollusc skeletons?

hard shell protecting soft body

Where do chemoautotrophic bacteria obtain their energy and carbon?

harness energy stored in chemicals, either organic molecules or inorganic chemicals such as hydrogen sulfide, elemental sulfur, iron-containing compounds, or ammonia

which primates have tails but not strong enough to be prehensile

old world monkeys

DNA complementary bases have to have _______ purine and _______ pyrimidine

one one

how can adaptive radiation be used to explain speciation on islands

one species comes from the mainland but diverges into different species based on adaptations to different habitats and speciation events

Do flatworms have an open or closed circulatory system?

open

do arthropods have an open or closed circulatory system?

open

protective covering over the gills

operculum

______________ is the only marsupial in North America

opossum

What are nitrogen fixers?

organisms that change nitrogen into a form of fertilizer that plants can use

largest group of vertebrates?

osteichthyes

scientific name for ray-finned fish

osteichthyes

Unique angiosperm adaptation that encloses the ovule (this is what develops INTO THE FRUIT which aids in seed dispersal)

ovary

Interspecific competition occurs when the niches of two populations ____________ and both populations need a _____________ that is in short _____________

overlap resource supply

Structure within the ovary that contains the sporangium that produces a female gametophyte-will ultimately BECOME THE SEED

ovule

What wasn't in the atmosphere when the earth was formed?

oxygen

___ + ____ = 1

p q

The frequency of homozygous dominant

p2

What is the equation for Hardy-Weinberg equilibrium?

p2 + 2pq + q2 = 1

The retention in the adult body of structures that were juvenile features in an ancestral species

paedomorphosis

the study of human origins and evolution

paleoanthropology

Both plants and animals may be victimized by ______________ or ________________

parasites pathogens

most lampreys are _______________ with several rows of ________ that penetrate the sides of fish like leeches

parasites teeth

symbiotic relationship in which one partner benefits and the other is harmed

parasitism

In all plants, the fertilized egg develops into an embryo while attached to and nourished by the _________________ plant

parent

Life has to be ______________ on

passed

disease-causing agents

pathogens

disease-causing bacteria, viruses, fungi, or protists that can be thought of as microscopic parasites

pathogens

The cell walls of archaea do not contain _______________ but can also be gram-positive or gram-negative

peptidoglycan

a polymer of complex sugars cross-linked by short polypeptides; a material unique to bacterial cell walls

peptidoglycan

Archaea do not have _________________ but can stain __________-__________ or ____________-_______________

peptidoglycan gram positive gram negative

Examples of ________________ isolation are the different seasons and day versus night

temporal

Flowing water includes

rivers and streams

Pollination is only effective if pollen transfer occurs between the ___________ species

same

In what substances can organisms fossilize?

sap, tar, sedimentary rock

hagfish: -deep sea __________ that produce __________ as a defense -have ___________ but are not _____________-________less -no paired _______ -no ___________ -4 sets of ___________ on their tongue

scavengers slime skulls vertebrates jaw fins scales teeth

Insects and bats are largely drawn to flowers based on _________ while birds are more attracted based on bright __________

scents color

the anterior end of a tapeworm that has suckers and hooks for attachment

scolex

The _______________ are a result from the permanent tilt of the planet on its axis as it orbits the sun

seasons

Most ecosystems have _________________ and ________________ consumers

secondary tertiary

embryo packaged with a food supply within a protective covering

seed

the amniotic egg can be related to a _________ (land plant evolution)

seed

subdivision along the length of an animal body into a series of repeated parts called segments; allows for greater flexibility and mobility

segmentation

Outer layer encircling the flower -enclose the flower before it blooms

sepals

Sponges are ___________ which means they don't move

sessile

Many lakes and ponds receive large inputs of nitrogen and phosphorus from ____________ and runoff from ______________ lawns and farms -these nutrients may produce ____________ ____________ which reduce ___________ penetration -when the algae die and decompose, a pond or lake can suffer severe _________________ depletion

sewage fertilized algae blooms light oxygen

Distinction in appearance between males and females

sexual dimorphism

Form of natural selection in which individuals with certain traits are more likely than others to obtain mates

sexual selection

Absence of lignin in mosses and other plants that lack vascular tissue=_______________ plant height

shorter

Sponges can be ____________ and regrow

shredded

A _________ mutation happens because many amino acids have more than 1 codon for that amino acid

silent

open circulatory systems are found in __________, ____________ organisms

slower simpler

In the temperate zones, the ___________ moving surface produces the ______________ (winds that blow from west to east)

slower westerlies

____________ is responsible for the majority of the editing in mRNA splicing

snRNA

What is an example of a tertiary consumer?

snakes that eat mice and other secondary consumers

while polyps are mostly ____________, medusae move freely about in the __________

stationary water

Primitive Earth could have gotten us to which step of life?

step 1

Opening of the carpel in which pollen lands to start germination

stigma

spherical shaped bacteria in chains

streptococci

Layered rocks that resulted from the activities of prokaryotes that bind thin films of sediment together

stromatolites

what is the female gametophyte in gymnosperms

structure inside of the cone (ovule)

Long tube that supports the stigma

style

Silent mutations are results of ____________

substitution

Ecosystems are supplied with a continual influx of energy from the __________ and the _____________ _____________

sun Earth's interior

animals that collect food particles from water passed through some type of food-trapping equipment

suspension feeders

gas filled sac (lung derivative) that helps fish keep buoyant

swim bladder

sharks haven't adapted because of the lack of a _________ ___________

swim bladder

Close association between organisms of two or more species

symbiosis

a relationship between two different organisms in which at least one organism benefits

symbiosis

The discipline of biology, including taxonomy, that focuses on classifying organisms and determining their evolutionary relationships

systematics

A type of RNA that functions as an interpreter in translation. Each _________ molecule has a specific anticodon, picks up a specific amino acid, and conveys the amino acid to the appropriate codon on mRNA

tRNA

Science of naming and classifying species

taxonomy

How do temperate grasslands and tropical savannas differ?

temperate grasslands are -mostly treeless except along rivers and streams -have cold winters

Latitudes between the tropics and the Arctic Circle in the north and the Antarctic Circle in the south -regions with milder climates than the tropics or polar regions

temperate zones

What facilitates the export of mRNA from the nucleus, protects the mRNA from degradation, and helps ribosomes bind to the mRNA?

the cap and tail

Why are our senses in our head?

the first part of our body to enter new environments are our heads

In silent mutation, what letter is most commonly changed?

the last letter

In the cichlids, what feature was changed per differing food source?

the mouth

On land, ________ is often an important abiotic factor

wind

Do flatworms have tissue layers, if so, how many/which ones?

yes: ectoderm, endoderm, and mesoderm

Do roundworms (nematoda) have tissue layers? If so, which kinds

yes: ectoderm, endoderm, mesoderm

Do segmented worms (annelida) have tissue layers? If so, which kinds?

yes: ectoderm, endoderm, mesoderm

the _________ ________ contains a rich store of nutrients for the developing embryo

yolk sac

in lampreys, the __________ don't have vertebrae but the ____________ do

young adults