ch 11 homework-genetics

Arrange the components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis, from first to last.

fMet-tRNA^fMet initiation factor 3 30S Initiation complex 70S initiation complex Elongation factor Tu Elongation factor G Release factor 1

Certain amino acids are encoded by more than one codon. The table shows the number of different codons in the second column that encode a particular amino acid. The third column of the table shows the frequency of each amino acid in all protein‑coding regions of DNA for a hypothetical bacterial species. What is the correlation between the number of different codons of an amino acid and the frequency of the amino acid in proteins for this bacteria? a) no correlation b) perfect correlation c) positive correlation d) negative correlation What information would best further the understanding of the relationship between the number of amino acid codons and their frequency in proteins? a) the bacterial mRNA transcript sequences b) the complete bacterial proteome c) the frequencies of each individual codon d) the number of bacterial chromosomes

negative correlation the bacterial mRNA transcript sequences the frequencies of each individual codon

The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase or term as relating to replication, transcription, or translation.

replication: both DNA strands are duplicated, described as semi-conservative, DNA polymerase transcription: single DNA strand is used to produce mRNA translation: amino acids added to peptide chain, requires tRNA, ribosome

Use the Transcription Translation interactive to answer the question. Arrange the amino acids coded for in the translation portion of the transcription translation interactive in the correct order, starting with the first amino acid at the top. start----> stop methionine, glycine, threonine, histidine, glutamine, arginine, leucine

start: methionine threonine glutamine arginine leucine histidine glycine stop

George Beadle and Edward Tatum used mutant strains of Neurospora to formulate the one-gene-one-enzyme hypothesis. Researchers later updated this hypothesis to propose that one gene encodes one polypeptide because proteins can have multiple subunits. Consider a homodimeric protein. How many genes are required to form this protein? a) six b) three c) two d) four e)one

1

Imagine discovering three different bacterial species on a meteorite. Each species contains genetic material that is not DNA, but the genetic material of each species contains four bases. Each species has a different number of amino acids. Use the total number of amino acids per species to determine the minimum codon length for each species. Species A has 2 amino acids. minimum codon length:_______ Species B has 47 amino acids. minimum codon length: ______ Species C has 83 amino acids. minimum codon lengt: _____

1 3 4

Place the events that take place during translation and protein synthesis in the correct order. first event------>last event the tRNA molecules that have contributed amino acids to the protein chain leave the ribosome. a codon on the mRNA strand binds with the complementary anticodon on a tRNA molecule carrying an amino acid. the smaller subunit of the ribosome attaches to the mRNA strand and moves along it. the ribosome adds a new amino acid to the growing polypeptide.

1. the smaller subunit of the ribosome attaches to the mRNA strand and moves along it. 2. a codon on the mRNA strand binds with the complementary anticodon on a tRNA molecule carrying an amino acid. 3.the ribosome adds a new amino acid to the growing polypeptide. 4. the tRNA molecules that have contributed amino acids to the protein chain leave the ribosome.

The images shown depict the initiation and elongation steps in protein translation. Image A Image B Image C Image D Arrange the image names in the order in which these steps occur.

BDCA

How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met‑Leu‑Arg? Include the stop codon in the mRNA sequence. Use the codon table to identify the codons. number of mRNA sequences:

From the Codon Table, we can determine that leucine and arginine each have six different potential codons. There are also three potential stop codons. As for methionine, only one codon, AUG, is typically found as the initiation codon. (However, UUG and GUG have been shown to serve as start codons on occasion. For this problem, we will ignore these rare cases.) Therefore, the number of potential sequences is the product of the number of different potential codons for this tripeptide, which gives us a total of (1 × 6 × 6 × 3) = 108 different mRNA sequences that can code for the tripeptide Met-Leu-Arg.

For each of the following sequences indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).-10 consensus sequence in bacteria - transcription

In bacteria, the -10 sequence is an important component of the promoter. Deletion of the -10 sequence will prevent transcription initiation from occurring

When researchers obtain genomic sequence data from organisms with little known genetic information, they often search for open reading frames (ORFs) to classify potential genes. Suppose scientists have collected the sequence 5'−TAATGCCTAGTACCGGACTGAGTCAGTGTCTA−3′ 3'−ATTACGGATCATGGCCTGACTCAGTCACAGAT−5′ Select the reading frame that corresponds to each translational product. You may want to use the Codons table and the Amino Acid Abbreviations table. Stop codons are noted as a dash (-). MPSTGLSQCL NA−YRTESVS −TLTQSGTRH −CLVPD−VSV RH−LSPVLGI DTDSVRY−AL Which reading frame is most likely a part of a larger ORF? reading frame four reading frame three reading frame five reading frame one reading frame two reading frame six

MPSTGLSQCL--reading frame 3 NA−YRTESVS--reading frame 2 −TLTQSGTRH--reading frame 4 −CLVPD−VSV--reading frame 1 RH−LSPVLGI--reading frame 5 DTDSVRY−AL---reading frame 6 reading frame 3

match each definition to the level of protein structure match each example to the level of protein structure

Primary structure: amino acid chain Secondary structure: local h-bond pattern Tertiary structure: 3-dimensional structure Quaternary structure: protein-subunit interactions Primary structure: N-terminal to C-terminal sequence Secondary structure: Beta-sheets Tertiary structure: immunoglobulin domain Quaternary structure: microtubule complex

Both prokaryotes and eukaryotes use the information encoded on the genes in their DNA to synthesize proteins. How does the process of translation in prokaryotes differ from translation in eukaryotes? Prokaryotic translation, eukaryotic translation

Prokaryotic translation -Only free-floating ribosomes in the cytoplasm are involved -The entire RNA transcript is used without any modifications -Translation starts once the 5' end of the mRNA detaches from the DNA Eukaryotic translation -Ribosomes are located both in the cytoplasm and attached to the endoplasmic reticulum -Introns are removed from pre-mRNA before ribosomes can cause the RNA -Mature mRNA has a cap on one end and poly-A tail on the other end

identify the general features of an amino acid Which part is responsible for the unique properties of each amino acid?

R group

For each of the following sequences indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).3' splice site consensus sequence - RNA processing

The 3' splice site is necessary for proper excision of the intron. Therefore, RNA processing events will be affected.

For each of the following sequences indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).Shine-Dalgarno sequence - translation

The Shine-Dalgarno sequence or ribosome-binding site is bound by the 30s subunit during the initiation of translation. If the sequence is deleted, then the ribosome will not bind to the mRNA molecule and translation will not occur.

A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode a chemokine receptor gene. The scientist is examining the sequence to identify potential open reading frames (ORFs), which contain both a start and stop codon. Using the partial sequence of chimpanzee DNA below, identify the total number of ORFs. 5' CCATGCACCAGATCGCTTATTAAAT 3' 3' GGTACGTGGTCTAGCGAATAATTTA 5 Genetic Code: codon amino acid ATG Met-start TAA stop TAG stop TGA stop

The number of Open reading frames in the given sequence is 1. An open reading frame should have the capacity to be transcribed into RNA and translated to a protein. An ORF is a continuous sequence of DNA from start codon followed by a subsequent region of length which is a multiple of 3 nucleotides and ending wiith a stop codon. In the given region, 5' C C ATG CAC CAG ATC GCT TAT TAA A T 3' , the ORF is starting with ATG in bold, and ends with TAA in bold.

For each of the following sequences indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).Ori site- DNA replication

The ori site or origin of replication is necessary for the initiation of replication.

For each of the following sequences indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).poly(A) tail - translation

The poly(A) tail is involved in mRNA stability and initiation of translation. If the tail is missing, then the mRNA will be degraded more rapidly thus affecting translation.

For each of the following sequences indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).start codon - translation

The start codon is necessary for translation initiation.

Define the following terms as they apply to the genetic code:Termination codon

The termination codon signals the termination or end of translation and the end ofthe protein molecule. There are three termination codons—UAA, UAG, andUGA—which can also be referred to as stop codons or nonsense codons. Thesecodons do not code for amino acids.

The table shows the genetic code common to nearly all organisms. Using the codon table, what conclusions can be drawn about the genetic code? a) Many amino acids are encoded by multiple codons. b) Three codons do not code for amino acids. c) The 64 codons are roughly evenly distributed between amino acid codons and stop codons. d) The sequence 5′ AUGAGAUCGUGA 3′ contains ten overlapping codons.

Three codons do not code for amino acids and many amino acids are encoded by multiple codons.

Consider an image of an mRNA being translated. What is the sequence of the anticodon, from the 3' to 5' end, of the tRNA in the A site? a) UGC b) ACG c) UAC d) AUG What is next amino acid added to the growing polypeptide chain? Use the codon and codon table. a) Cys b) Met c) Tyr d) Thr

UGC Thr

The codon table identifies the amino acid sequence that can be translated from a human mRNA sequence. This chart can also be used to identify amino acid sequences for other organisms. Select all of the organisms that use the codon assignments shown in the codon table. a) poison ivy b) white shark c) whale d) turtle e) Escherichia coli

all