Chapter 17- MUTATION AND DNA REPAIR (final)

what is the significance of a mutation in germ cells

- can be passed onto offspring - passed onto the offspring then every cell of the offspring will contain that mutation

what type of mutation occurs in sickle cell disease

missense mutation codes for valine instead of glutamic

explain nucleotide excision repair in E.coli

(1) A complex of UvrA and UvrB searches the DNA for damage (2) After damage is detected the UvrAs are released and UvrC binds to UvrB (3) UvrC cuts the strand of DNA on either side of the damage (4) UvrC is released and then UvrD binds to UvrB and then UvrB is released (5) UvrD is a helicase that removes the damaged segment of DNA, then UvrD is released (6) A DNA polymerase then fills in the missing nucleotides and DNA ligase will connect the new strand to the original strand

what is the significance of a mutation in somatic cells

- can't be passed onto offspring - can lead to diseases like cancer

how could a mutation in a region of DNA that does not code for a protein affect gene expression

-Mutations in the promoter region can result in either a decrease or an increase in the rate of transcription, which could result in a decrease in the amount of protein produced or in increase in the amount of protein produced, respectively. - Mutations can also occur in regulatory segments of DNA (these segments regulate the transcription of genes). Mutations in these regions can alter the transcription of a gene resulting in either a reduced amount of the protein being made or an increased amount of the protein being made.

explain how a base substitution could lead to a nonsense mutation

the replacement of a nucleotide base pair could result in a STOP codon

A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? A) nonsense mutation B) missense mutation C) silent mutation D) sense mutation E)none of the above

A) nonsense mutation

A mutation in a gene in the fruit fly Drosophila was found to affect eye color. The protein affected was found to be completely normal in its molecular weight and amino acid sequence, although much less of the protein is made in mutant flies. The most likely reason for the change in levels of protein is that the mutation: A) occurs in the promoter of the gene, within several hundred base pairs of the start of transcription. B) is a change of a codon for serine into another codon for serine. C) is a frame shift mutation near the start of the coding region. D) affects the splicing of the mRNA. E) causes the stop codon to be replaced by a sense codon.

A) occurs in the promoter of the gene, within several hundred base pairs of the start of transcription.

Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the b-globin gene? A)silent B) missense C) nonsense D) frameshift E) sense

B) missense

What type of gene mutation occurred to produce the following protein sequence? The protein sequences written below are written using the one letter abbreviations for amino acids. Each letter represents a particular amino acid. Normal: JAYBIRDCATPAW Mutated: JAYBIRDBATPAW A) nonsense B) missense C) silent D) sense E) frameshift

B) missense

Which of the following would occur from a mutation in the gene's promoter region? A) The sequence of the mature mRNA would change. B) The ability of pre-mRNA to be properly spliced would change. C) The ability of mRNA to be translationally regulated would change. D) The amino acid sequence of the translated protein would be altered. E) The rate of transcription may increase or decrease.

E) The rate of transcription may increase or decrease.

explain how a deletion can cause a frameshift mutation

a deletion can remove nucleotide base pairs into the reading frame which would cause it to shift and become a frameshift mutation

explain how a base substitution could lead to a silent mutation

a base substitution would replace one of the codons which would result in a silent mutation because the codon would code for the same amino acid

explain how a base substitution could lead to a missense mutation

a missense mutation is a base substitution -the replacement of a nucleotide base pair would result in a single amino acid being changed

point mutation

a mutation that affects a single nucleotide base pair

explain how an insertion can cause a frameshift mutation

an insertion can add nucleotide base pairs into the reading frame which would cause it to shift and become a frameshift mutation

Somatic cell mutations are heritable a. True b. False

b. False

Based on the gene and protein sequences that follow, what type of mutation has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

base additional- frameshift

missense mutation

is a base substitution that results in a single amino acid being changed in the protein

nonsense mutation

is a mutation that causes a normal codon to be changed into a stop codon. -This will result in the production of a shortened protein

silent mutation

is a mutation that does not result in a change in the amino acid sequence of the protein. - This can happen because the genetic code is degenerate, so you can have a mutation that changes one of the codons into a codon that codes for the same amino acid

frameshift mutation

is a mutation that results in shifting the reading frame that is used in translation. - Can be caused by an insertion or a deletion

base substitution

is a mutation where a different nucleotide base pair replaces the original nucleotide base pair. -So one nucleotide base pair is substituted for another nucleotide base pair

insertion

is the addition of one or more nucleotide base pairs

deletion

is the removal of one or more nucleotide base pairs

nucleotide excision repair

pathways for DNA repair, using different enzymes that act upon different kinds of lesions. - removes DNA damage induced by ultraviolet light (UV). -UV DNA damage results in bulky DNA adducts - these adducts are mostly thymine dimers and 6,4-photoproducts.

base excision repair

pathways for DNA repair, using different enzymes that act upon different kinds of lesions. - repairs damaged DNA throughout the cell cycle. -It is responsible primarily for removing small, non-helix-distorting base lesions from the genome