Chapter 25

Why is the drug acyclovir effective against the herpes simplex virus?

Acyclovir is a guanine nucleoside with an incomplete ribose ring, which can be phosphorylated much more efficiently by the viral thymidine kinase than the host enzyme. Further conversion forms acyclo-GTP, which competitively inhibits the viral DNA polymerase more strongly than the host enzyme, and when incorporated into DNA is a chain terminator, because it lacks a 3' hydroxyl group.

E. coli DNA polymerase III: A) can initiate replication without a primer. B) is efficient at nick translation. C) is the principal DNA polymerase in chromosomal DNA replication. D) represents over 90% of the DNA polymerase activity in E. coli cells. E) requires a free 5'-hydroxyl group as a primer.

C) is the principal DNA polymerase in chromosomal DNA replication.

All known DNA polymerases catalyze synthesis only in the 5' to 3' direction. Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3' to 5' direction. Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase.

During DNA replication, one strand is synthesized continuously and the other is synthesized by a discontinuous mechanism. The daughter chain, which appears to be growing in the 3' to 5' direction (the "lagging strand"), is actually being synthesized by continual initiation of new chains and their elongation in the 5' to 3' direction.

At replication forks in E. coli: A) DNA helicases make endonucleolytic cuts in DNA. B) DNA primers are degraded by exonucleases. C) DNA topoisomerases make endonucleolytic cuts in DNA. D) RNA primers are removed by primase. E) RNA primers are synthesized by primase.

E) RNA primers are synthesized by primase.

Which mechanism is used to repair a chemically-modified base in DNA? A) mismatch repair B) base-excision repair C) nucleotide-excision repair D) direct repair E) more than one is used for this type of lesion

E) more than one is used for this type of lesion

Which of the following is not required for initiation of DNA replication in E. coli? A) DnaB (helicase) B) DnaG (primase) C) Dam methylase D) DNA ligase E) none of the above

E) none of the above

In a mammalian cell, DNA repair systems: A) are extraordinarily efficient energetically. B) are generally absent, except in egg and sperm cells. C) can repair deletions, but not mismatches. D) can repair most types of lesions except those caused by UV light. E) normally repair more than 99% of the DNA lesions that occur.

E) normally repair more than 99% of the DNA lesions that occur.

Which of the following statements is false? In vitro, the strand-exchange reaction: A) can include formation of a Holliday intermediate. B) is accompanied by ATP hydrolysis. C) may involve transient formation of a three- or four-stranded DNA complex. D) needs RecA protein. E) requires DNA polymerase.

E) requires DNA polymerase.

The proofreading function of DNA polymerase involves all of the following except: A) a 3' to 5' exonuclease. B) base pairing. C) detection of mismatched base pairs. D) phosphodiester bond hydrolysis. E) reversal of the polymerization reaction.

E) reversal of the polymerization reaction.

An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate, because: A) alternative modified nucleotides can be incorporated more readily. B) interference from the RecA and SSB proteins hinders the normal replication accuracy. C) replication proceeds much faster than normal, resulting in many more mistakes. D) the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III. E) the DNA polymerases involved lack exonuclease proofreading activities.

E) the DNA polymerases involved lack exonuclease proofreading activities.

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the Beta-subunit of bacterial DNA polymerase III in that it: A) facilitates replication of telomeres. B) forms a circular sliding clamp to increase the processivity of replication. C) has a 3' to 5' proofreading activity. D) increases the speed but not the processivity of the replication complex. E) participates in DNA repair.

B) forms a circular sliding clamp to increase the processivity of replication.

The role of the Dam methylase is to: A) add a methyl group to uracil, converting it to thymine. B) modify the template strand for recognition by repair systems. C) remove a methyl group from thymine. D) remove a mismatched nucleotide from the template strand. E) replace a mismatched nucleotide with the correct one.

B) modify the template strand for recognition by repair systems.

Briefly explain the difference between base-excision repair and nucleotide-excision repair.

Base excision involves removing only the defective base from the DNA by cleavage of the N-glycosidic linkage of the base to deoxyribose. This leaves an apurinic or apyrimidinic site, which must then undergo additional repair processes. Nucleotide excision involves removing the defective base together with its deoxyribose and phosphate (as well as some neighboring nucleotides) by cleavage of phosphodiester bonds in the DNA chain.

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell. Explain.

Base-stacking and base-pairing interactions in the polymerized DNA product stabilize it and tend to make the overall reaction more exergonic. In the cell, pyrophosphatase may make a contribution by coupling polymerization to the highly exergonic hydrolysis of the pyrophosphate product.

Prokaryotic DNA polymerase III: A) contains a 5' 3' proofreading activity to improve the fidelity of replication. B) does not require a primer molecule to initiate replication. C) has a subunit that acts as a circular clamp to improve the processivity of DNA synthesis. D) synthesizes DNA in the 3' 5' direction. E) synthesizes only the leading strand; DNA polymerase I synthesizes the lagging strand.

C) has a subunit that acts as a circular clamp to improve the processivity of DNA synthesis.

In the bacterial cell, what are catenated chromosomes, when do they arise, and how does the cell resolve the problem posed by their structure?

Catenanes are topologically interlinked circular chromosomes, which are the normal end result of DNA replication of the parental circular genome when the bidirectional replication forks meet. They are unlinked by the bacterial topoisomerase IV (a type II enzyme), and thus become free to segregate into daughter cells upon cell division.

An Okazaki fragment is a: A) fragment of DNA resulting from endonuclease action. B) fragment of RNA that is a subunit of the 30S ribosome. C) piece of DNA that is synthesized in the 3' 5' direction. D) segment of DNA that is an intermediate in the synthesis of the lagging strand. E) segment of mRNA synthesized by RNA polymerase.

D) segment of DNA that is an intermediate in the synthesis of the lagging strand.

In contrast to bacteria, eukaryotic chromosomes need multiple DNA replication origins because: A) eukaryotic chromosomes cannot usually replicate bidirectionally. B) eukaryotic genomes are not usually circular, like the bacterial chromosome is. C) the processivity of the eukaryotic DNA polymerase is much less than the bacterial enzyme. D) their replication rate is much slower, and it would take too long with only a single origin per chromosome. E) they have a variety of DNA polymerases for different purposes, and need a corresponding variety of replication origins.

D) their replication rate is much slower, and it would take too long with only a single origin per chromosome.

Describe the process of nucleotide-excision repair of lesions like pyrimidine dimers in E. coli.

DNA lesions such as pyrimidine dimers are repaired by the excision of a 12- or 13-nucleotide fragment of the defective strand. The ABC excinuclease makes single-strand cuts on both sides of the defect. The fragment between the cuts is removed by the UvrD helicase. This leaves a gap in the DNA, which is filled in by DNA polymerase I and sealed by DNA ligase.

List two proteins or enzymes, other than DNA polymerase III, that are found at the replication fork in E. coli; describe each of their functions with no more than one sentence.

The proteins are listed in Table 25-4, p. 962. They include (a) DNA polymerase I, which fills gaps and excises RNA primers; (b) primase (the DnaG protein), which synthesizes short RNA primers; (c) DNA ligase, which seals nicks; and (d) proteins that aid in DNA unwinding and supercoiling.

Name the three possible outcomes or consequences (at the DNA level) of a site-specific recombination event. For each of these explain concisely (in one sentence) how the relative location and orientation of the recombination sites determines the outcome of the recombination event. Do not describe specific examples of site-specific recombination systems.

When two sites on a single DNA have the same orientation, a piece of DNA will be deleted by recombination. When two sites on a single DNA have opposite orientations, inversion results. When two separate DNAs (one or both circular) recombine, an insertion will occur. (See Fig. 25-41, p. 1012.)

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

(1) Homologous chromosomes are aligned. (2) A double-strand break is enlarged by an exonuclease, leaving a single-strand extension with a free 3' hydroxyl end. (3) The exposed 3' ends invade the homologous intact duplex DNA, followed by branch migration to create a Holliday junction. (4) Cleavage of the two crossover products creates the two recombinant products.

Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli: (a) DNA helicase; (b) primase; (c) the 3' to 5' exonuclease activity of DNA polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5' to 3' exonuclease activity of DNA polymerase I.

(a) Helicase unwinds double-stranded DNA during replication. (b) Primase synthesizes short RNA primers during lagging strand replication. (c) The 3' to 5' exonuclease activity of DNA polymerase proofreads newly synthesized DNA, removing mismatched nucleotides. (d) DNA ligase seals nicks in the DNA at the boundaries between Okazaki fragments. (e) Topoisomerases relieves the topological stress produced by the unwinding of double-stranded DNA at the replication fork. (f) The 5' to 3' exonuclease activity of DNA polymerase I removes RNA primers.

DNA replication in E. coli begins at a site in the DNA called the (a) ___________. At the replication fork the (b) ___________ strand is synthesized continuously while the (c) _________ strand is synthesized discontinuously. On the strand synthesized discontinuously, the short pieces are called (d) ____________ fragments. An RNA primer for each of the fragments is synthesized by an enzyme called (e) __________, and this RNA primer is removed after the fragment is synthesized by the enzyme (f) ___________, using its (g) _____________ activity. The nicks left behind in this process are sealed by the enzyme (h) _____________.

(a) origin; (b) leading; (c) lagging; (d) Okazaki; (e) primase; (f) DNA pol I; (g) 5' 3' exonuclease; (h) DNA ligase

DNA synthesis on the lagging strand in E. coli is a complex process known to involve several proteins. Initiation of a new chain is catalyzed by the enzyme (a) _____________, and elongation is catalyzed by the enzyme (b)______________. Synthesis is discontinuous, yielding short segments called (c) _______________, which are eventually joined by the enzyme (d)______________, which requires the cofactor (e)___________.

(a) primase; (b) DNA pol III; (c) Okazaki fragments; (d) DNA ligase; (e) NAD+

Which of these enzymes is not directly involved in methyl-directed mismatch repair in E. coli? A) DNA glycosylase B) DNA helicase II C) DNA ligase D) DNA polymerase III E) Exonuclease I

A) DNA glycosylase

In homologous genetic recombination, RecA protein is involved in: A) formation of Holliday intermediates and branch migration. B) introduction of negative supercoils into the recombination products. C) nicking the two duplex DNA molecules to initiate the reaction. D) pairing a DNA strand from one duplex DNA molecule with sequences in another duplex, regardless of complementarity. E) resolution of the Holliday intermediate.

A) formation of Holliday intermediates and branch migration.

What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?

An Okazaki fragment is an intermediate in DNA replication in E. coli. It is a short fragment of newly synthesized DNA, attached to the 3' end of a short RNA primer. Such fragments are produced by the combined action of primase (part of the primosome) and DNA polymerase III during replication of the lagging strand.

In base-excision repair, the first enzyme to act is: A) AP endonuclease. B) Dam methylase. C) DNA glycosylase. D) DNA ligase. E) DNA polymerase.

C) DNA glycosylase.

The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis. B) DNA synthesis in E. coli proceeds by a conservative mechanism. C) DNA synthesis in E. coli proceeds by a semiconservative mechanism. D) DNA synthesis requires dATP, dCTP, dGTP, and dTTP. E) newly synthesized DNA in E. coli has a different base composition than the preexisting DNA.

C) DNA synthesis in E. coli proceeds by a semiconservative mechanism.

Which one of the following statements about enzymes that interact with DNA is true? A) E. coli DNA polymerase I is unusual in that it possesses only a 5' 3' exonucleolytic activity. B) Endonucleases degrade circular but not linear DNA molecules. C) Exonucleases degrade DNA at a free end. D) Many DNA polymerases have a proofreading 5' 3' exonuclease. E) Primases synthesize a short stretch of DNA to prime further synthesis.

C) Exonucleases degrade DNA at a free end

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor: A) coenzyme A. B) coenzyme Q. C) FADH-. D) pyridoxal phosphate (PLP). E) thiamine pyrophosphate (TPP).

C) FADH-.

The bacteriophage gamma can lysogenize after infecting a bacterium, i.e. integrate into the host bacterial chromosome by site-specific recombination, and may reside there for many generations before an excision event regenerates the viral genome in an infective form. Which one of the following is not a component of these events? A) Excision requires two host proteins and two virally-encoded proteins. B) Integration requires a viral-specific protein, called integrase. C) RecA protein is required to catalyze the insertional recombination event. D) The excision event relies on different sequences than the integration event. E) The virus and the host DNAs share a 15 bp "core" region of perfect homology.

C) RecA protein is required to catalyze the insertional recombination event.

In homologous recombination in E. coli, the protein that assembles into long, helical filaments that coat a region of DNA is: A) DNA methylase. B) DNA polymerase. C) histone. D) RecA protein. E) RecBCD enzyme.

D) RecA protein.

In homologous recombination in E. coli, the protein that moves along a double-stranded DNA, unwinding the strands ahead of it and degrading them, is: A) chi. B) DNA ligase. C) RecA protein. D) RecBCD enzyme. E) RuvC protein (resolvase).

D) RecBCD enzyme.

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system: A) cannot distinguish the template strand from the newly replicated strand. B) changes both the template strand and the newly replicated strand. C) corrects the DNA strand that is methylated. D) corrects the mismatch by changing the newly replicated strand. E) corrects the mismatch by changing the template strand.

D) corrects the mismatch by changing the newly replicated strand.

Which mechanism is used to repair a thymidine dimer in DNA? A) mismatch repair B) base-excision repair C) nucleotide-excision repair D) direct repair E) more than one is used for this type of lesion

D) direct repair

The Ames test is used to: A) detect bacterial viruses. B) determine the rate of DNA replication. C) examine the potency of antibiotics. D) measure the mutagenic effects of various chemical compounds. E) quantify the damaging effects of UV light on DNA molecules.

D) measure the mutagenic effects of various chemical compounds.

The ABC excinuclease is essential in: A) base-excision repair. B) methyl-directed repair. C) mismatch repair. D) nucleotide-excision repair. E) SOS repair.

D) nucleotide-excision repair.

The 5' to 3' exonuclease activity of E. coli DNA polymerase I is involved in: A) formation of a nick at the DNA replication origin. B) formation of Okazaki fragments. C) proofreading of the replication process. D) removal of RNA primers by nick translation. E) sealing of nicks by ligase action.

D) removal of RNA primers by nick translation.

When a DNA molecule is described as replicating bidirectionally, that means that it has two: A) chains. B) independently replicating segment. C) origins. D) replication forks. E) termination points.

D) replication forks.

What distinguishes the two mechanistic pathways for transposition in bacteria, and what is a cointegrate?

Direct transposition moves the transposon itself to a new location, leaving behind a double-strand break in the DNA from whence it came (which must be repaired). The transposing DNA is inserted into a staggered cut at the target site, and replication fills in the remaining gaps. Replicative transposition moves a copy of the element to a new site, leaving a copy behind at the old location; the cointegrate intermediate carries two complete copies of the transposon, with the donor region covalently linked to DNA at the target site.

Describe briefly how equilibrium density gradient centrifugation was used to demonstrate that DNA replication in E. coli is semiconservative.

Equilibrium density gradient centrifugation separates DNA molecules of slightly different buoyant density. For example, molecules containing 15N-labeled ("heavy") DNA are separable from identical molecules containing 14N ("light") DNA. Meselson and Stahl grew E. coli for many generations in a medium containing 15N, producing cells in which all DNA was heavy. These cells were transferred to a medium containing 14N, and the buoyant density of their DNA was determined (by equilibrium density gradient centrifugation) after 1, 2, 3, etc., generations. After one generation, all DNA was of a density intermediate between fully heavy and fully light, indicating that each double-stranded DNA molecule had one heavy (parental) and one light (newly synthesized) strand; replication was semiconservative.

All known DNA polymerases can only elongate a preexisting DNA chain (i.e., require a primer), but cannot initiate a new DNA chain. Nevertheless, during semiconservative DNA replication in the cell, entirely new daughter DNA chains are synthesized. Explain the process that occurs in the cell that allows for the synthesis of daughter chains by DNA polymerase.

In the cell, initiation of DNA chains occurs via the synthesis of an RNA primer by an RNA polymerase type of enzyme (primase). This primer is elongated by DNA polymerase to produce the daughter DNA chain. The RNA is removed by 5' exonucleolytic hydrolysis before replication is completed.

Explain how inheriting mutations in genes encoding DNA repair enzymes could lead to increased cancer risk.

Mutations in DNA repair genes would lead to increased mutation rate. Since cancers begin by mutations in oncogenes, an increased mutation rate would lead to an increased risk of cancer.

List three types of DNA damage that require repair.

The defects in DNA that require repair include (a) mismatches that occur during replication; (b) abnormal bases; (c) pyrimidine dimers produced by UV irradiation. Other answers are possible.

The high fidelity of DNA replication is due primarily to immediate error correction by the 3' to 5' exonuclease (proofreading) activity of the DNA polymerase. Some incorrectly paired bases escape this proofreading, and further errors can arise from challenges to the chemical integrity of the DNA. List the four classes of repair mechanisms that the cell can use to help correct such errors.

The four classes are listed in Table 25-5 (p. 994), and consist of (1) mismatch repair, (2) base-excision repair, (3) nucleotide-excision repair, and (4) direct repair.

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity

The genes for immunoglobin polypeptide chains are divided into segments, with multiple versions of each segment (which code for slightly different amino acid sequences). Recombination results in the joining of individual versions of each segment to generate a complete gene. Antibody diversity results from the very large number of different combinations that are possible

The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis. (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

The polarity of the strands indicates that the top strand is the template for lagging strand synthesis, and the bottom strand is the template for leading strand synthesis.

What distinguishes the simple from the complex class of bacterial transposon?

The simple class called insertion sequences contains only the information needed for transposition and the genes for proteins (transposases) that carry out the process. Those in the class of complex transposons carry additional genes, such as those for antibiotic resistance, a property they confer upon any host bacterium that harbors them.

Why does DNA damage that causes alkylation of nucleotides sometimes lead to transition mutations?

When guanine is alkylated to O6-methylguanine, it can base pair better with thymine than with guanine's normal partner, cytosine. This results in G-C to A-T transition mutations when this erroneous pairing is replicated into the daughter chromosomes.

Explain the role of DNA glycosylases in DNA repair.

When spontaneous deamination converts cytosine in DNA to uracil, or adenine to hypoxanthine, DNA glycosylase breaks the N-glycosidic bond to the defective base, creating an "abasic" or "AP" site. The region containing the AP site is then excised by AP endonuclease, and the resulting gap is closed by DNA polymerase I and sealed by DNA ligase. (See Fig. 25-25, p. 997.) Other DNA glycosylases recognize other types of modified or damaged bases.