DNA Mastering Biology
The bonds that hold tRNA molecules in the correct three-dimensional shape are _____.
Hydrogen bonds
which bases are purine
adenine and guanine
Your cousin is a xenobiologist working to insert synthetic DNA into a virus with the goal of creating a vaccine for H.I.V. If she follows similar methods to those already used, which of the following will she need to aid her in this process?
algae gene
a promoter is a specific binding site for
the enzyme RNA polymerase
The "one gene-one polypeptide" theory states that
the function of an individual gene is to dictate the production of a specific polypeptide.
events of RNA processing
1. A modified guanine nucleotide is added to the beginning of the RNA strand as a cap. 2. Segments of the RNA strand that do not actually code for the protein are removed. 3. Segments of the RNA that do code for the protein are reconnected. 4. Extra adenine nucleotides are added to the end of the RNA strand, forming a tail. 5. The completed messenger RNA (mRNA) leaves the nucleus.
Drag the labels onto the diagram to identify the stages in which the lagging strand is synthesized.
1.) DNA polymerase begins synthesizing the lagging strand by adding nucleotides to a short segment of RNA 2.) After each piece of the lagging strand is complete, it is released from DNA polymerase 3.) A differnet DNA polymerase replaces the RNA segments with DNA 4.) DNA ligase seas the gaps between the ieces, and eventually forms a continuous strand.
Nucleic acids are assembled in the _____ direction.
5' to 3' New nucleotides are added to the 3' end of a growing polynucleotide.
Which of the following events occurs during transcription?
A molecule of RNA is formed based on the sequence of nucleotides in DNA. During transcription, RNA nucleotides line up with their complementary DNA partners, transcribing the information in DNA into RNA.
tRNA is held by the
A site
In order for bacterial cells to be able to produce the human insulin protein, which of the following do not have to be true? Bacterial RNA polymerases have to recognize human promoters.Bacteria and humans have to use the same genetic code.Bacteria have to have a gene for a bacterial form of insulin.Bacterial ribosomes have to recognize human start and stop codons
Bacteria have to have a gene for a bacterial form of insulin.
What is the transcription product of the sequence GCTAGCGATGAC?
CGAUCGCUACUG
Which of the following has yet to be shown? Which of the following has yet to be shown? DNA with synthetic nucleotides can be replicated. DNA with synthetic nucleotides can be inserted into living cells. Cells with synthetic nucleotides are able to reproduce. Cells with synthetic nucleotides make new proteins.
Cells with synthetic nucleotides make new proteins. Submit
You are a molecular biologist and wish to change the proteins that cells make. Which of the following should you do? Change the sequence of the nucleotides.Add a new protein to a cell.Remove a protein from a cell.Create a new amino acid.
Change the sequence of the nucleotides.
You are interested in designing an experiment to test the hypothesis that frogs use the same genetic code as humans. Which of the following experiments would not give you useful data to test this hypothesis?
Compare nucleotide sequences of promoters from similar frog and human genes.
Frederick Griffith was one of the leading scientists looking at the genetic role of DNA. He was working on two strains of Streptococcus pneumoniae: The rough strain (R) did not cause pneumonia, but the smooth strain (S) did. When Griffith heat-killed the S strain and gave both the heat-killed S strain and the R strain to mice, the mice developed pneumonia and died. What happened in this experiment that caused the mice to develop pneumonia?
DNA from the S strain transformed the R strain into the more disease-promoting S strain.
Which of the following enzymes catalyzes the elongation of a new DNA strand?
DNA polymerase
Elongation of new DNA is catalyzed by
DNA polymerases
Which of the following statements about the genetic code is correct?
Each amino acid in a polypeptide is coded for by three bases in the DNA. The mRNA base triplets are called codons, each of which codes for the incorporation of a single amino acid, and there is no ambiguity in the code.
Which of the following is true of tRNAs? There are four types of tRNA.Each tRNA binds a particular amino acid.tRNAs are extremely small molecules.tRNAs carry special sequences known as codons.
Each tRNA binds a particular amino acid. A tRNA with a particular anticodon will bind to a particular amino acid and carry it to the ribosome.
Transcription occurs in the cytoplasm of eukaryotic cells. Submit
False
You work for Synthorx, creating synthetic DNA. You create a sequence on one strand of CTXAGGC. What is its complimentary strand?
GAYTCCG
The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a tRNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?
GUA The DNA sequence GTA is complementary to the mRNA sequence CAU, which is complementary to the tRNA sequence GUA.
Rheumatoid arthritis, celiac disease, and multiple sclerosis are all autoimmune diseases. Which of the following is true?
Gene switches likely play a role in these diseases.
Which of the following people conducted the experiments that demonstrated that DNA is the genetic material of bacteriophages?
Hershey and Chase
Who demonstrated that DNA is the genetic material of the T2 phage?
Hershey and Chase did a series of classic experiments demonstrating that DNA is the genetic material of the T2 phage.
Hershey and Chase used _____ to radioactively label the T2 phage's proteins.
Hershey and Chase used radioactive sulfur to label the phage's proteins.
Below are three statements. Which of the following choices properly matches the statements with the correct biological processes?I. This occurs in the nucleus of eukaryotic cells.II. Transfer RNAs bind amino acids in the cytoplasm.III. A polymerase enzyme is required.
I: replication; II: translation; III: transcription
How does RNA polymerase know where to start transcribing a gene into mRNA?
It starts at a certain nucleotide sequence called a promoter.
DNA polymerase can only add to the 3′ end of the molecule, which has an ___. The molecule therefore grows 5′ to 3′.
OH group
The initiator tRNA attaches at the ribosome's _____ site.
P The initiator tRNA attaches to the ribosome's P site.
Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. Which of the following is the most probable reason for this observation?
Prokaryotic DNA is much smaller than eukaryotic DNA. The prokaryotic DNA is much smaller. Eukaryotes must have multiple origins of replication to efficiently replicate their DNA.
Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins?
Proteins contain sulfur, but nucleic acids do not.
The synthesis of a new strand begins with the synthesis of a(n) _____.
RNA primer complementary to a preexisting DNA strand The synthesis of a DNA strand begins with the formation of an RNA primer.
Which of the following statements regarding RNA is false? RNA uses the sugar dextrose.One RNA molecule can include four different nucleotides in its structure.RNA uses the nitrogenous base uracil.RNA molecules have a sugar-phosphate backbone
RNA uses the sugar dextrose.
Which of the following is found in RNA but not in DNA? four different nucleotidesa covalently bonded backbonetwo purines and two pyrimidinesan additional hydroxyl group
RNA's sugar, ribose, has an additional OH group in the 2′ position (lower right on Figure 10.2C). This OH group is missing in deoxyribose.
Who formulated the one gene-one enzyme hypothesis?
Restating Beadle and Tatum's idea as one gene-one polypeptide reflects the current belief that each polypeptide is specified by one gene.
After allowing phages grown with bacteria in a medium that contained 32P and 35S, Hershey and Chase used a centrifuge to separate the phage ghosts from the infected cell. They then examined the infected cells and found that theycontained _____, which demonstrated that _____ is the phage's genetic material.
Since the phage DNA entered the infected cell, it makes sense that DNA is the genetic material.
when is a cap added to the RNA molecule
The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a modified guanine (G) nucleotide, and it protects the transcript from being broken down. It also helps the ribosome attach to the mRNA and start reading it to make a protein.
How would the shape of a DNA molecule change if adenine paired with guanine and cytosine paired with thymine?
The DNA molecule would have irregular widths along its length.
what is RNA processing
The RNA strand is processed so that its introns are removed and the exons are pushed together to make a continuous, shorter strand. This process is called RNA splicing. ... RNA splicing is the removal of introns and joining of exons in eukaryotic mRNA. It also occurs in tRNA and rRNA.
The radioactive isotope 32P labels the T2 phage's _____.
The T2 phage consists of a protein coat and DNA. It is the DNA that contains P.
Which of the following statements regarding a DNA double helix is true?
The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.
function of the cap and tail of a an RNA molecule
The cap and tail have many functions, which include assisting with the export of the molecule from the nucleus, helping it resist attack from cellular enzymes, and directing ribosome binding.
Which of the following is true about double-stranded DNA?
The deoxyribose sugars bind to the phosphate groups and form the backbone of each DNA strand, whereas the nitrogenous bases stick out toward the center.
Which of the following is NOT true about the genetic code? The genetic code is redundant.The genetic code is ambiguous.The genetic code is almost universal.The nucleotides making up the codons occur in a linear order along the DNA and RNA with no gaps or punctuation separating the codons.
The genetic code is ambiguous. This is false. The genetic code is unambiguous. Each codon specifies either a single amino acid or represents a stop signal.
Consider the following sequence and explain what effect the mutation has on the protein that is translated.UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type)UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant) complete change in amino acid sequence after the mutationsingle amino acid changeprematurely stops the translation of the proteinno effec
The mutation causes the insertion of a stop codon, and this would prematurely terminate the translation of the protein.
A single base mutation occurs in a gene that codes for a protein due to an error in DNA replication. Which of the following outcomes would possibly not occur?
The mutation results in mRNA being made from the protein. Submit
In a nucleotide, the nitrogenous base is attached to the sugar's _____ carbon and the phosphate group is attached to the sugar's _____ carbon.
The nitrogenous base is attached to the sugar's 1' carbon and the phosphate group is attached to the sugar's 5' carbon.
Normal genes have a promoter followed by a start codon. In a mutant gene, the "A" in the start codon has been deleted. Which of the following is not a possible outcome?
The normal protein will be produced. Submit
Which of the following statements about ribosomes is false?
The ribosomes of prokaryotes and eukaryotes are the exactly the same in structure and function.
Which of the following statements regarding the structure of DNA is false?
The sequence of nucleotides along the length of a single DNA strand is restricted by the base-pairing rules.Watson and Crick received a Nobel Prize for their description of the structure of DNA.In a DNA molecule, adenine bonds to thymine and guanine to cytosine.The DNA molecule has a uniform diameter. The sequence of nucleotides along the length of a single DNA strand is restricted by the base-pairing rules.
Which of the following statements is false?
The start codon can be different depending on what kind of protein is to be translated. Submit
If Hershey and Chase had used radioactive oxygen in their experiments instead of phosphorus and sulfur, what results would they have likely obtained?
They would have observed a radioactive signal in both the pellet and the liquid.
Which of the following statements regarding the flow of genetic information is false?
Transcription occurs in the cytoplasm of eukaryotic cells. Submit
The translation process requires all of the following: _____.
Transfer RNA, ribosomes, and AUG codons all play important roles in translation.
Eukaryotic mRNA is processed in several ways before export out of the nucleus.
True
Polypeptides form proteins that determine the appearance and function of the cell and organism. T or F
True
Ribosomes function as factories that coordinate the functioning of mRNA and tRNA.
True
A uracil nucleotide is a __________ nitrogenous base attached to the __________, with the 5′ carbon of the sugar attached to a phosphate group.
Uracil is found only in RNA, so the sugar is ribose, which has an OH group at the 2′ carbon. Also, uracil is a pyrimidine and has only one ring.
Your identical twin is diagnosed with Crohn's disease. Which of the following is true?
You may or may not get Crohn's disease.
Any change in the nucleotide sequence of DNA is called
a mutation. Submit
Ultraviolet (UV) radiation is damaging because it _____.
causes mutations in DNA
The most likely method by which the mutated CCR5 gene prevents AIDS is by
coding for a protective protein in the cell membrane.
Which of the following options most accurately lists the sequence of events in translation?
codon recognition → peptide bond formation → translocation → termination
Rather than "junk" DNA, such material is now referred to as what?
dark matter
The function of tRNA during protein synthesis is to _____.
deliver amino acids to their proper site during protein synthesis Each tRNA molecule is used repeatedly, picking up its designated amino acid in the cytosol, depositing this cargo at the ribosome, and leaving the ribosome to pick up another load.
After DNA replication is completed, _____.
each new DNA double helix consists of one old DNA strand and one new DNA strand
The RNA segments spliced to one another during RNA processing are _____.
exons
Which of the following statements about eukaryotic RNA is true? Introns are added to the RNA.The modified RNA molecule is transported into the nucleus.A small cap of extra nucleotides is added to both ends of the RNA.Exons are spliced together.
exons are spliced together
RNA processing involves the addition of ________ to the ends of the RNA transcript.
extra nucleotides
The first step in the replication of DNA is catalyzed by _____.
helicase
Shown below is a ribosome in the process of translation. The P site of a ribosome _____.
holds the growing polypeptide chain The P site (peptidyl-tRNA site) holds the tRNA carrying the growing polypeptide chain, whereas the A site (aminoacyl-tRNA site) holds the tRNA carrying the next amino acid to be added to the chain.
In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____.
includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns
Which of the following is a function of a tRNA molecule?
joining to only one specific type of amino acid
Which of the following does not occur during RNA processing? Segments of the RNA strand that do not actually code for the protein are removed.mRNA attaches to the small subunit of a ribosome.A modified guanine nucleotide is added to the beginning of the RNA strand as a cap.Adenine nucleotides are added to the end of the RNA strand, forming a tail.Segments of RNA that do code for the protein are reconnected.
mRNA attaches to the small subunit of a ribosome. mRNA attaches to the small subunit of a ribosome at the beginning of translation.
During the transcription of a given portion of a DNA molecule, _____.
mRNA is synthesized on only one of the strands Submit
Which of the following is a correct statement about mRNA?
mRNA moves from the nucleus to the cytoplasm following RNA processing.
A virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout the organism's chromosomes. This will probably cause _____.
manufactured proteins to be short and defective Alterations that change an existing codon or insert a stop codon cause a premature termination of the polypeptides.
In the genetic code,
many amino acids are specified by more than one codon.
A physical or chemical agent that changes the nucleotide sequence of DNA is called a(n)
mutagen
Which of the following is in the correct order from simplest to most complex?
nucleotide, amino acid, protein
The monomers of DNA and RNA are
nucleotides.
replication occurs in the
nucleus
When a T2 bacteriophage infects an Escherichia coli cell, which part of the phage enters the bacterial cytoplasm?
only the DNA
DNA does not
play a role in translation
The action of helicase creates _____.
replication forks and replication bubbles
Which of the following enzymes does HIV use to synthesize DNA on an RNA template?
reverse transcriptase
Multiple origins of replication on the DNA molecules of eukaryotic cells serve to
shorten the time necessary for DNA replication.
At the start of translation, where does the initiator tRNA bind?
start codon on the mRNA molecule
You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a _____.
sugar with two, and not three, oxygen atoms DNA nucleotides are composed of deoxyribose sugars, whereas RNA nucleotides are composed of ribose sugars.
An old DNA strand is used as a _____ for the assembly of a new DNA strand.
template
In an important experiment, radioactively labeled bacteriophages were allowed to infect bacteria. In the first trial, the phages contained radioactive DNA, and radioactivity was detected in the bacteria. Next, other phages containing radioactive protein were allowed to infect bacteria, and radioactivity was not detected in the bacteria. These experiments led to the conclusion that _____.
the genes of this phage were made of DNA Submit In order to replicate, viral material with genetic information must enter a bacterial cell. This experiment showed that the viral DNA -and not the viral protein- had entered the bacterial cell.
A gene is usually _____.
the information for making a polypeptide Submit
The information carried by a DNA molecule is in _____.
the order of the nucleotides in the molecule
Experiments have demonstrated that the "words" of the genetic code (the units that specify amino acids) are
three-nucleotide sequences.
In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.
thymine ... cytosine This is referred to as specific base pairing.
which bases are pyrimidine?
thymine and cytosine
What is the proper order of the following events in the expression of a eukaryotic gene?
transcription, RNA processing, translation
In humans, less DNA is used for genes than gene switches.
true
Life on Mars is finally discovered and a new organism that has six different nucleotides that encode 30 different amino acids is found on this planet. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism?
two-nucleotide sequence (62 combinations) A two-nucleotide sequence would encode a maximum of 36 amino acids (62), which would cover the 30 needed by this organism.
Hershey and Chase's experiment allowed them to discern whether DNA or proteins contain genetic information because __________.
viruses consist only of proteins and DNA and only the DNA was injected into the host cells