Exam 2: Ch 4-10

which of the following PCR ctrl ensures that the rxn mix isn't contaminated w/ amplicons from a previous PCR procedure and must not have a PCR product detected in order to be valid. + ctrl sensitivity ctrl rgt blank amp ctrl

rgt blank

the most abundant form of RNA in all cells is:

ribosomal

a PCR assay is performed, and the results are being analyzed. the + ctrl has a band at the expected size; the - template ctrl has band at the same size as the + ctrl; the contamination ctrl has no band; and the amp ctrl has a band of expected size. all of the patient samples that were run had a band the same size as the band seen in the + and - template ctrl wells. how are these results interpreted?

run isn't acceptable b/c the - template ctrl should not have a band

Which of the following is the most widely used method of DNA seq in clin labs today? pyroseq maxam-gilbert seq sanger seq array seq

sanger seq

which of the following molec will migrate fastest in capillary electrophoresis?

small and negatively charged

the entire human genome can be analyzed at 1 time by which of the following methods? northern southern slot microarray

southern

nucleic acid [ ] can be assessed relatively simply and quickly by which of the following procedure? electrophoresis enz immunoassay sequencing spectrophotometry @ 260 nm

spectrophotometry @ 260 nm

To incr the density of a sample relative to the density of the buffer prior to loading the sample into a gel, which of the following is added to the sample? sucrose EtBr formaldehyde tris acetate EDTA

sucrose

a description of this enz is 1 that lengthens DNA at the ends of chromos by adding repetitive NT seq to the ends of eukaryotic chromos. this permits germ cells and stem cells to avoid the hayflick limit on cell division. this enz is: topoisomerase gyrase primase telomerase

telomerase

Name two ways to permanently bind nucleic acid to nitrocellulose following transfer.

Bake the filter @ 80C for 30 mins Nucleic acid will be cross-linked to nitrocellulose upon exposure to UV light Bake the membrane in a vacuum oven at 80C for 30-60mins UV cross-linking → UV light to covalently attach DNA to nitrocellulose membrane

Calculate the RNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:100 dilution = 0.088 If the V of the above DNA sol was 0.5 mL, calc yield.

0.088 x 40 ug/mL x 100 (dilution factor) = 352 ug/mL 352 ug/mL x 0.5mL = 176 ug

Calculate the RNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:100 dilution = 0.172 If the V of the above DNA sol was 0.5 mL, calc yield.

0.172 x 40 ug/mL x 100 (dilution factor) = 688 ug/mL 688 ug/mL x 0.5mL = 344 ug

Calculate the RNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:100 dilution = 0.307 If the V of the above DNA sol was 0.5 mL, calc yield.

0.307 x 40 ug/mL x 100 (dilution factor) = 1228 ug/mL 1228 ug/mL x 0.5mL = 614 ug

Calculate the RNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:50 dilution = 0.307 If the V of the above DNA sol was 0.5 mL, calc yield.

0.307 x 40 ug/mL x 50 (dilution factor) = 614 ug/mL 614 ug/mL x 0.5mL = 307 ug

a circular molec w/ 1 RE recog site will yield how many frag when digested by the RE? 1 2 3 4

1

The final concentration of Taq pol is to be 0.01 units/uL in a 50uL PCR. If the enzyme is supplied as 5 units/uL, how much enzyme would you add to the reaction? 1 uL 1 uL of a 1:10 dil of Taq 5 uL of a 1:10 dil of Taq 2 uL

1 uL of a 1:10 dil of Taq Use C1V1=C2V2 0.01 units/uL x 50 uL = 5 units/uL x ? uL ? = 0.1 uL

Name two dyes used to monitor the migration of nucleic acid during electrophoresis

Bromophenol Blue and xylene cyanol green

Which whole blood fraction is the most abundant source of genomic DNA?

Buffy Coat

a sanger seq procedure has been performed on a 300-bp piece of DNA. When the frag were resolved on the gel, there were bands distrib throughout the T, C, and A lanes, but in the G lane, there was 1 thick band at the top of the gel. what is the likely cause of these results? no dGTP was added to the G rxn mix no ddGTP was added to the G rxn mix there was only 1 G in the whole 300-bp piece of DNA the 300-bp pice of DNA contained Gs only

no ddGTP was added to the G rxn mix

what is star activity?

nonspecific digestion of DNA by RE

a medical lab scientist performs fluorescence in situ hybridization (FISH) on interphase chromos using a probe to chromos 21. in all cells examined, 2 signals were seen. these results are interpreted as:

normal

the matrix in capillary electrophoresis through which nucleic acids pass is: silica agarose agarobiose optimized polymer

optimized polymer

the short arm of the chromos is designated as which of the following?

p

Interphase FISH has been performed on a patient sample. With a chromosome 8 centromeric (CEP 8) probe, two signals are observed in each spread examined. A probe for the immunoglobulin heavy chain region on chromosome 14 gives two distinct signals per nucleus, and a probe for the myc gene on chromosome 8 gives two distinct signals per nucleus. What is the interpretation?

patient is normal

which of the following molec polymerize to form a support medium through which nucleic acids move? EtBr ethylenediaminetetraacetic acid Na dodecyl sulfate polyacrylamide

polyacrylamide

Why is SyBr green less toxic than EtBr?

SyBr green is a minor groove-binding dye that won't disrupt the DNA sequence EtBr is mutagenic because it's an interchelating agent that will disrupt the DNA sequence

Dye terminator sequencing has been performed using capillary electrophoresis to separate the fragments. ddATP has been labeled with a "green" fluor, ddTTP with "red," ddCTP with "blue," and ddGTP with "black." The colors are detected in the following order: red, green, black, red, green, blue, red, black, black, green, blue. What is the sequence of this fragment?

TAGTACTGGAC

in the sanger seq method, which of the following when incorporated into the growing strand are used to determine the identity of the base at a particular position in a piece of DNA? riboNT deoxyriboNT dideoxyriboNT AA

dideoxyriboNT

Restriction endonucleases are enz that are produced by bact and _________. degrade viral prot digest DNA have no lab app degrade lipids

digest DNA

which of the following methods is best suited for qualitative analysis of DNA, such as mutational analysis, where many samples are compared simultaneously? dot blot traditional southern blot western blot northern blot

dot blot

Incomplete cleaning of the fluorescently labeled sequencing ladder will result in what effect? dim bands / peaks unequal signal from lane to lane dye blobs equally spaced bands in every lane

dye blobs

nucleic acids are injected into the capillary in capillary electrophoresis by which of the following injection methods? hydrostatic electrokinetic pneumatic vacuum

electrokinetic

which is the output from capillary electrophoresis of a fluorescent product? autoradiogram electropherogram pictogram nomogram

electropherogram

Phenol/chloroform and an aqueous sol will form what type of mixture?

emulsion

which of the following types of chromatin are open and actively involved in gene expression (transcrption)?

euchromatin

the goal of the hapmap project is which of the following? find blocks of SNPs that are inherited together complete the human genome seq compare human and primate genomes seq all bacterial genomes

find blocks of SNPs that are inherited together

in spectral karyotyping, each of teh 23 chromos is distinguished by: size degree of staining fluorescent color position

fluorescent color

which of the following molec is added to an electrophoresis buffer for the purpose of denaturing DNA? ethylenediaminetetraacetic acid polyacrylamide formamide tris borate

formamide

which of the following mutations is more likely to result in a phenotypic change? -frameshift mutation at the beginning of the coding seq -nonconservative mutation at the end of the coding seq -silent mutation in the middle of the coding seq -conservative mutation at the end of the coding seq

frameshift mutation at the beginning of the coding seq

what is the next step in the southern blot procedure after RE digestion?

gel electrophoresis

to incr the density of a sample relative to the density of the buffer prior to loading the sample into a gel, which of the following is added to the sample? glycerol ethidium bromide formaldehyde tris acetate EDTA

glycerol

cycle seq was made possible through the devel of what rgts? fluor dyes dITP labeled primers heat-stable pol

heat-stable pol

a DNA-specific dye that is used in fluorometry procedures to meas [ DNA ] is:

hoechst 33258

which of the following assays can be used in high-throughput app? melt curve assay heteroduplex analysis PCR-RFLP homogenous mass extend

homogenous mass extend

in which of the following nucleic acid amp procedures is a hybrid nucleic acid labeled with detectable signal? PCR strand displacement amp transcription-med amp hybrid capture assay

hybrid capture assay

when 2 seq are found to be exactly the same, they have which of the following? heterology identity alignment motif

identity

diethyl pyrocarbonate (DEPC) is a chem that is used to:

inactivate RNAses

a hybridization assay is run under the following conditions:40% formamide w/ 0.5X SSC @ 70oC. when the bands were visualized, there were many more bands than expected in all wells on the mb. Which of the following changes should be made to the hybridization conditions to get results that are closer to those expected? decr formamide incr T incr [SSC] decr T

incr T

in organic iso of RNA procedures, GITC is added to:

inhibit RNAses

colcemid is used in the procedure of preparing a chromos spread for karyotpe analysis to do which of the following ? spread th echromos out w/i the cell inhibit microtubule formation induce cells to enter mitosis fix cells to the slide prior to staining

inhibit microtubule formation

which of the following properties is true for EtBr? emits green light when excited @ 200 nm level of detection is 5 pg of DNA intercalates b/t nitrogen bases has no bg fluoresence in agarose

intercalates b/t nitrogen bases

the intron that follows exon 4 is named:

intron 4

What part of the human genome accounts for encoded proteins?

2%

You wish to perform electrophoretic resolution of your restriction enzyme-digested DNA. The size of the expected fragments ranges from 100-500 bp. You discover two agarose gels polymerizing on the bench. One is 0.5% agarose; the other is 2% agarose. Which one might you use to resolve your fragments?

2%! → 100 - 3k bp range 0.5% → for larger frag, ~2k - 50k bp

a nucleosome consists of DNA and which of the following combo of histone prot?

2(H2A), 2(H2B), 2(H3), 2(H4)

how do you prepare a 2% agarose gel? mix 0.01 g agarose/mL running buffer and heat mix 0.02 g agarose/mL running buffer and heat mix 2 g agarose/mL running buffer and heat mix 1 g agarose/mL running buffer and heat

mix 0.02 g agarose/mL running buffer and heat

Hybrid capture

Amplification type: Hybridization target nucleic acid: RNA, DNA amplicon type: Signal major enzyme(s): Alkaline phosphatase

bDNA

Amplification type: Hybridization target nucleic acid: RNA, DNA amplicon type: Signal major enzyme(s): Alkaline phosphatase

LCR

Amplification type: Probe ligation target nucleic acid: DNA amplicon type: Probe major enzyme(s): DNA ligase

Qbeta replicase

Amplification type: RNA synthesis target nucleic acid: DNA, RNA amplicon type: Probe major enzyme(s): Qbeta replicase

TMA

Amplification type: RNA synthesis target nucleic acid: RNA, DNA amplicon type: RNA major enzyme(s): RNA polymerase

to separate a mixture of oligoNT w/ a resolution b/t bands of 1 bp, which of the following methods should be used? contour-clamped homogenous electric field rotating gel electrophoresis polyacrylamide gel electrophoresis traditional agarose gel electrophoresis

polyacrylamide gel electrophoresis

which of the following is not an example of PFGE? FIGE contour-clamped homogenous electric field polyacrylamide gel electrophoresis transverse alternating field electrophoresis

polyacrylamide gel electrophoresis

a change-in DNA seq that is present in at least 1-2% of the population called: phenotype polymorphism aneuploid mutation

polymorphism

which of the following describes size-exclusion HPLC? -porous beads trap smaller molec and exclude larger ones -tiny beads trap larger molec and exclude smaller ones -molec are retained by immobilized charged groups -particles are resolved in an inert gas mobile phase

porous beads trap smaller molec and exclude larger ones

which of the following molec comprises most mb that bind to nucleic acids in blotting procedures? positively charged mb agarose acrylamide formamide

positively charged mb

SYBR Green fluorescence is detectable at which stage of the PCR amp process? template denaturation cycle 1 primer annealing and extension prior to amp

primer annealing and extension

in inorganic DNA iso, or "salting out" procedures, in the presence of low-pH and high-salt [ ] , which intracellular component precip out of sol?

prot

western blot probes are what type of molec?

prot

which enz is used during the lysis step of plasma ext in Natera's clin lab for NIPT? kinase proteinase k polymerase nuclease

proteinase k

TaqMan, molecular beacons, and scorpion-type primers are all used in which procedure? branched DNA assays quantitative PCR transcription-mediated amp multiplex PCR

quantitative PCR

in bioinformatics, when a seq is entered and compared w/ all other seq in a database, which of the following is being performed?? algorithm query motif annotation

query

the + pole in electrophoresis is indicated by which color?

red

the 260 nm/280 nm ratio for isolated DNA was determined to be 1.2. what should be done next w/ this sample?

reprecipitate the DNA to remove excess prot

which of the following is an advantage of interphase FISH as compared w/ metaphase FISH? -examination of 20 spreads in interphase FISH has incr sensitivity -1 can identify mutations anywhere in the chromos in interphase FISH -interphase FISH allows identification of all chromos -results are available faster in interphase FISH procedures than metaphase FISH procesures

results are available faster in interphase FISH procedures than metaphase FISH procesures

the microarray / chip is an Ex of which of the following blotting procedures? southern dot reverse dot western

reverse dot

which of the following PCR mod was developed to allow for the amp of an RNA template? multiplex nested reverse transcriptase real-time

reverse transcriptase

a linear molec w/ 1 RE recog site will yield how many frag when digested by the RE? 1 2 3 4

2

which of following PCR ctrl ensures that the enz is active, the buffer is optimal, and the primers are priming the correct target seq and must have a PCR prod detected in order to be valid. + ctrl - template ctrl contamination ctrl amp ctrl

+ ctrl

if you wanted to store RNA for 6 months, you would use: -70C diethylpyrocarbonate -70C EtOH -20C EDTA -20C water

-70C EtOH

A gel separation of RNA yields aberrantly migrating bands and smears. Suggest two possible explanations for this observation

-Bad gel Improper gel conditions used to separate RNA → gel solution was not made with appropriate concentrations Degraded RNA (just 1 look and it's done for?!?!) RNA could be too degraded producing very small fragments that don't resolve clearly

What is the purpose of denaturing double stranded target DNA after electrophoresis and prior to transfer in Southern Blot?

-Ds target DNA is denatured to allow hybridization of the probe -Also, ss DNA binds to nitrocellulose filters -Double stranded DNA will not be able to bind to the nitrocellulose membrane or to the probe

what [agarose] should be used for optimal separation of DNA frags of 100, 250, and 350 bp length? 0.5% 0.7% 2 % 12 %

2 %

At the end of the Southern blot procedure, what would the autoradiogram show if the stringency was too high?

-If stringency is too high → faint / no bands will be present on the autoradiogram -There would be faint or no bands visible because the target wouldn't be able to bind to the probe -If the target doesn't bind the probe, there wouldn't be any fluorescence detected

Does an increase in temperature from 65C to 75C during hybridization raise or lower stringency?

-Incr T raises stringency -Heat promotes separation of the H bonds holding the 2 ss of ds DNA together -Strands have a harder time of reannealing under high temperatures

Why does DNA not resolve well in solution (without a gel matrix)?

-Particles move based on charge/mass ratio -As mass incr → slowing migration, it's - charge incr → counteract mass -Because of the charge/mass ratio of DNA its mobility in solution is fast due to its negative charge, but its mass also slows it down → contradictory

After completion of the electrophoresis of DNA fragments along with the proper molecular weight standard on an agarose gel, suppose the following observations were made. What might be the explanation?

-The gel is blank (no bands, no molecular weight standard) -Since you can't see the molec wgt std either then there could be something wrong w/ the general electrophoresis process -Ex: no staining dye used (EtBr*** / SyBr Green) -Only the molecular weight standard is visible -Something could've gone wrong when trying to produce frags -No frags → can't move through gel (too big) -Electrophoresis and staining was successful because the molecular weight standard is visible on the gel -Digested DNA sample may not have been loaded

A northern blot is performed on an RNA transcript with the sequence GUAGGUATGUAUUUGGGCGCGAACGCAAAA. The probe sequence is GUAGGUATGUAUUUGGGCGCG. Will this probe hybridize to the target transcript?

-The probe will not bind to the target transcript -Seq are identical, not complementary -Since RNA doesn't have a complementary partner, the probe must be complementary to the transcript seq

Name three factors that will affect yield of RNA from a paraffin-embedded tissue sample.

1. Fixation method -Acetone and 10% buffered neutral formalin is the best method as sample fragmented is less severe 2. Sample handling prior to fixation -Treated to denature/inactivate RNases, DEPC 3. Age / length of the stored sample -Sample degrades over time

iso DNA has an absorbance @ 260 nm of 0.268 and an absorbance @ 280 nm of 0.191. what is the 260 nm/280 nm ratio?

1.4 0.268/0.191 = 1.4

What is a frameshift mutation?

1/2 base deletion/insertion

the Tm of nucleic acid is the T when: all of the ds DNA is ss 1/2 of the ds DNA is ss 1/4 of the ds DNA is ss all of the ss DNA is ds

1/2 of the ds DNA is ss

what is the yield of RNA from the sample w/ [ 450 ug/mL ] and a V = 0.3 mL?

135 ug 450 ug/mL x 0.3 mL = 135 ug

What is the yield of DNA from a sample with concentration of 280 ug/mL and a volume of 0.5 mL?

140 ug 280 ug/mL x 0.5 mL = 140 ug

what is the [ RNA] whereby a 1:10 dil has an absorbance reading of 0.675 @ 260 nm?

270 ug/mL 0.675 x 40 ug/mL x 10 = 270 ug/mL

How many copies of a target are made after 30 cycles of PCR? 2 x 30 2^30 30^2 30/2

2^30

a gene was mapped to region 3, band 1, subband 1 of the short arm of chromos 2. how wouldyou express this location from an ideogram?

2p31.1

a circular molec has 2 sites for the RE Pst1 and 1 site for the enz BamH1. How many frag will result when digested w/ both enz? 1 2 3 4

3

which DNA seq is complementary to 5' CTAAGAGTTTCCTGA 3'?

3' GATTCTCAAAGGACT 5'

Primer dimers result from: High [primer] Low [primer] High GC content in the primer seq 3' complementarity in the primer seq

3' complementarity in the primer seq

a linear molec has 2 sites for the RE Pst1 and 1 site for the enz BamH1. How many frag will result when digested w/ both enz? 1 2 3 4

4

when measuring the [ RNA] by spectrophotometry @ 260 nm, the absorbance reading is multiplied by the dil and a conversion factor of:

40

which of the following conditions are the least stringent? 40% formamide, 1X SSC (salt), 50oC 50% formamide, 1X SSC (salt), 55oC 50% formamide, 0.5X SSC (salt), 55oC 40% formamide, 0.2X SSC (salt), 60oC

40% formamide, 1X SSC (salt), 50oC less stringent: less: formamide, T more: salt

the karyotype of a normal female is designated by which of the following?

46, XX

A reference segment of DNA has the following sequence: GCTCACCATGG. The fourth nucleotide is changed to an A in a particular genetic disease. How would this mutation be denoted?

4C>A

which end of the seq DNA is found at the bottom of a seq gel? 5' 3' 2' 1'

5'

a portion of a seq gel is described as follows: the 1st band @ the bottom of the gel was in the ddATP lane; the next band going up the gel was in the ddTTP lane, ddCTP, ddGTP, ddATP,ddTTP, ddCTP, ddCTP, ddATP, ddGTP. what is the correct seq as determined on this gel?

5' ATCGATCCAG 3'

a mod that protects nascent RNA is: AAUAAA terminal transferase polyuridine 5' cap

5' cap

which of the following sol has the highest stringency? 0% formamide 10 % formamide high-salt buffer 50% formamide

50% formamide

what is the melting T (Tm) of the following hybrid: AGCTATGCCGGCTAGCA TCGATACGGCCGATCGT

54oC

PCR

Amplification type: DNA synthesis target nucleic acid: DNA amplicon type: Target major enzyme(s): DNA Polymerase

what is the [ ] of DNA whereby 1:100 dil has an absorption reading of 0.015 @ 260 nm?

75 ug/mL 0.015 x 50 ug/mL x 100 = 75 ug/mL

A reference segment of DNA has the following sequence: GCTCACCATGG. insertion of AG occurs b/t positions 7 and 8 in a particular genetic dz. how is this mutation denoted by accepted nomenclature?

7_8insAG

In Maxam-Gilbert seq, a band that is present in the lane from the tube treated w/ formic acid (G / A) but not the tube treated w/ dimethyl sulfate (G) is read as which of the following NT?

A

Calculate the DNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:100 dilution = 0.088 If the V of the above DNA sol was 0.5 mL, calc yield.

A = Ebc A: absorbance E: molar absorptivity (L/mol cm) B: path length (cm) C: concentration (mg/L) Optical Density @ 260 nm: DNA: 50 ug/mL 0.088 x 50 ug/mL x 100 (dilution factor) = 440 ug/mL 440 ug/mL x 0.5mL = 220ug

Calculate the DNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:100 dilution = 0.172 If the V of the above DNA sol was 0.5 mL, calc yield.

A = Ebc A: absorbance E: molar absorptivity (L/mol cm) B: path length (cm) C: concentration (mg/L) Optical Density @ 260 nm: DNA: 50 ug/mL 0.172 x 50 ug/mL x 100 (dilution factor) = 860 ug/mL 860 ug/mL x 0.5mL = 430 ug

Calculate the DNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:100 dilution = 0.307 If the V of the above DNA sol was 0.5 mL, calc yield.

A = Ebc A: absorbance E: molar absorptivity (L/mol cm) B: path length (cm) C: concentration (mg/L) Optical Density @ 260 nm: DNA: 50 ug/mL 0.307 x 50 ug/mL x 100 (dilution factor) = 1535 ug/mL 1535 ug/mL x 0.5mL = 767.5 ug

Calculate the DNA concentration in ug/mL from the following information: Absorbance reading at 260nm from a 1:50 dilution = 0.307 If the V of the above DNA sol was 0.5 mL, calc yield.

A = Ebc A: absorbance E: molar absorptivity (L/mol cm) B: path length (cm) C: concentration (mg/L) Optical Density @ 260 nm: DNA: 50 ug/mL 0.307 x 50 ug/mL x 50 (dilution factor) = 767.5 ug/mL 767.5 ug/mL x 0.5mL = 383.75 ug

a seg of DNA has been seq and noted as the following: AYKWHT. what is the correct interpretation of this notation?

A, T/C, G/T, A/T, A/C/T, T

the specificity of western blots depends on what interaction? DNA/RNA complementarity RNA/RNA complementarity DNA Ag Ag/Ab recog

Ag/Ab recog

how do gene expression arrays from comparative genome hybridization (CGH) arrays? CGH arrays detect gain / loss of DNA regions; gene expression arrays detect changes in gene expression CGH arrays can interrogate hundreds of genes, while gene expression arrays test thousands CGH arrays are simpler to perform than gene expression arrays CGH arrays req co-hybridization w/ comparative reg nucleic acid, while gene expression arrays do not

CGH arrays detect gain / loss of DNA regions; gene expression arrays detect changes in gene expression

What are two differences between CGH arrays and expression arrays

CGH arrays: -Performed on DNA -Detect deletion and amps of chromosomal regions Expression arrays: -Performed on RNA -Detect changes in RNA levels of specific genes

transcription-mediated amp obtains: DNA from RNA RNA from DNA DNA from DNA DNA from RNA and RNA from DNA

DNA from RNA and RNA from DNA

What are the three steps of a standard PCR cycle?

Denaturation → double stranded templates denature to single stranded samples Annealing → primers hybridize target sequences Extension → target sequences are extended from primer sequences

What are the general components of loading buffer used for introducing DNA samples to submarine gels?

Density agent → (Ficoll, sucrose or glycerol) increases the density of the sample so it sinks into the well instead of diffusing in the buffer Tracking dye → (Bromophenol Blue, xylene cyanol green) added to monitor progress of the electrophoresis run -Not associated with the sample and runs slightly ahead of the smallest fragment

Which of the following will yield the best DNA prep? A. fixed tiss B. hemolyzed blood C. fresh blood D. stool

Fresh blood

what is the proper order for the 4 phases of the cell cycle?

G1, S, G2, M

which of the following is a type 2 RE recog site? GAATTC CAATTG GAAAAG GATCAG

GAATTC

which of the following is a genetic seq database that is sponsored by the national institutes of health? PubMed Swiss-Prot GenBank Interface

GenBank

How does nested PCR differ from multiplex PCR?

Nested PCR: Req 2 rounds of rep Multiplex PCR: Single PCR rxn where >1 product is made using multiple primer sets

What does the g designate in g.225A>C?

Genomic sequence

in order to depurinate DNA after electrophoresis, the gel should be soaked in which of the following? NaOH HCl Saline Na citrate formamide

HCl

What replaces heat denaturation in strand displacement amplification?

In SDA, a nick in the ds product is used to prime rep, rather than denaturation and primer binding A nick in the double stranded template is used to prime synthesis instead of having a separate primer sequence annealing to the target strand

a prot w/ the seq DAILMNCST is mutated such that AA L and M are deleted. how is this mutation noted by accepted nomenclature?

L4_M5del2

Which of the following is the 1st step in DNA isolation from cells in a clinical sample? A. DNA precip B. precip of prot, C. lysis of cells D. eluting DNA from a spin column

Lysis of cells

Nonspecific extra PCR products can result from: Mispriming High annealing T High [agarose gel] Omission of MgCl2 from the PCR

Mispriming

what is the advantage of a nested PCR procedure?

Nested PCR offers incr specificity and yield of prod

After Agarose gel electrophoresis, 0.5 ug aliquot of DNA isolated from bacterial culture produces a faint smear at the bottom of the gel lane. Is this sample acceptable?

No, because smears mean the sample is too digested/fragmented to be of use A good prep of DNA will yield bright bands (near top of gel)

which of the following tech is a primer-directed in vitro enzymatic rxn for the prod of multiple copies of a specific DNA frag found in a clinical sample? strand displacement amp PCR cleavage-based amp hybrid capture assay

PCR

which of the following is the most likely source of PCR contamination? unfiltereddust particles enviromental fungi eyelashes PCR products from a previous rxn

PCR products from a previous rxn

which of the following methods has the highest sensitivity, specificity, and accuracy as far as detecting DNA mutations in clinical app? ELISA high-density oligoNT array PCR-RFLP ss conformation polymorphism

PCR-RFLP

How does PFGE separate larger fragments more efficiently than standard electrophoresis?

PFGE = pulsed field gel electrophoresis → enhances large fragment migration by applying the current to the gel in alternating dimensions -Samples move to spaces -Helping the large fragment adjust position and move through the gel matrix -Changing the direction of the current re-aligns the fragment within the gel matrix spaces

A master mix of all components (except template) necessary for PCR contains what basic ingredients?

Primer (oligoNT) Buffer (@ proper pH) Polymerase dNTPs Cations Mono & Di (KCl & MgCl2)

which of the following bind specifically to a seq of interest, this facilitating the analysis of that seq? RE Probes Hybridomas digoxigenin

Probes

Which of the following is a method for purifying a PCR product? Treat w/ uracil N glycosylase Add divalent cations Putting the reaction mix through a spin column Add DEPC

Putting the reaction mix through a spin column

which of the following amp procedures uses an RNA pol to generate amplicons? Q beta replicase real-time PCR ligase chain rxn strand displacement amp

Q beta replicase

In contrast to standard PCR, real-time PCR is . Quantitative Qualitative Labor-intensive Sensitive

Quantitative

which of the following is the correct order of steps when performing a southern blot after isolation of DNA? probe hybridization RE digestion denaturation electrophoresis

RE digestion, electrophoresis, denaturation, probe hybridization

ELISA is based on what earlier method first used to detect insulin in plasma PCR northern blot RIA EIA

RIA

RT PCR differs from standard PCR in which way?

RT PCR is quantitative

Which control is run to detect contamination? Negative ctrl Positive ctrl Molecular wgt marker Reagent blank

Reagent blank

which of the following methods can be used to screen for the presence of unknown mutations? SSP-PCR allele-specific oligomer hybridization high-density array PCR-RFLP

SSP-PCR

which of the following can be used to detect the location of DNA bands in a gel after electrophoresis? SYBR Green xylene cyanol green bromophenol blue hematoxylin

SYBR Green

Compare and contrast measurement of DNA concentration by spectrophotometry with analysis by fluorometry with regard to staining requirements and accuracy

Spectrophotometry : -Doesn't need DNA staining -Abs ration doesn't necessarily predict successful amp / hybridization rxns -Light is absorbed by: single NT, frag/degraded DNA -Better method of determining quality because specific double strand or single strand-specific dyes may be used which will suggest the sample quality Fluorometry: -Needs DNA staining -→ generate fluorescent signal -May be more accurate than spectrophotometry -ds-DNA must be intact to stain and generate signal

How is high-resolution banding achieved?

Stain the chromosomes before maximal condensation

If a high concentration of NaCl were added to a hybridization solution, how would the stringency be affected?

Stringency decr since high [salt] excludes nucleic acids, forcing them close together and promoting hybridization Stringency is lowered because NaCl (salty conditions) actually facilitates hybridization

If a probe for Southern blot was dissolved in a hybridization buffer that contains 50% formamide, is the stringency of hybridization higher or lower than if there were no formamide?

Stringency is higher, since formamide facilitates denaturation of ds DNA -Stringency is higher because the presence of formamide facilitates denaturation → hard for target and probe to hybridize -Higher stringency → conditions that make it harder for target and probe hybridization -Lower stringency → conditions that make it easier for target and probe to hybridize

Three DNA preparations have the following A260 and A280 readings, based on the A260/A280 is each suitable for further use or is it contaminated Sample 1 OD260: 0.419 OD280: 0.230 OD260/OD260: 1.82 Sample 2 OD260: 0.258 OD280: 0.225 OD260/OD260: 1.15 Sample 3 OD260: 0.398 OD280: 0.174 OD260/OD260: 2.29

Suitable? 0.419 / 0.230 = 1.82 Within expected range for DNA → ok for use 0.258 / 0.225 = 1.15 Contaminated with protein 0.398 / 0.174 = 2.29 Contaminated with RNA, will need to use RNase before continuing A 260 / A 280 ratio: 1.6-2.00: good, DNA range <1.6: prot contam > 2.0 RNA range 2.0 - 2.3: RNA range

the fx of which of the following include carrying the current and protecting the sample nucleic acids during electrophoresis? glycerol formaldehyde ammonium persulfate tris borate EDTA

tris borate EDTA

In real-time PCR, fluorescence is not generated by which of the following? FRET probe TaqMan probe SYBR green Tth polymerase

Tth polymerase

6% solution of 19:1 acrylamide is mixed, deaerated, and poured between glass plates for gel formation. After an hour, the solution is still liquid. What might be one explanation for the gel not polymerizing?

Unlike agarose, PAGE gels req a catalyst (nucleating agent) + light activation to polymerize Ex: APS, TEMED APS produces free oxygen radicals in the presence of TEMED so the gel solution must be deaerated before adding nucleating agents

Calculate the melting temperature of the following DNA fragments using the sequences only (only listing 1 strand for convenience). CATCGCGATCTGCAATTACGACGATAA

Use formula: Tm = 4C x (# of GC pairs) + 2C x (# of AT pairs) 12 GC pairs and 15 AT pairs T = (4C x 12) + (2C x 15) → 78C

Calculate the melting temperature of the following DNA fragments using the sequences only (only listing 1 strand for convenience). AGCTAAGCATCGAATTGGCCATCGTGTG

Use formula: Tm = 4C x (# of GC pairs) + 2C x (# of AT pairs) 14 GC pairs and 14 AT pairs T = (4C x 14) + (2C x 14) → 84C

Calculate the melting temperature of the following DNA fragments using the sequences only (only listing 1 strand for convenience). AGTCTGGGACGGCGCGGCAATCGCA

Use formula: Tm = 4C x (# of GC pairs) + 2C x (# of AT pairs) 17 GC pairs and 8 AT pairs T = (4C x 17) + (2C x 8) → 84C

Calculate the melting temperature of the following DNA fragments using the sequences only (only listing 1 strand for convenience). TCAAAAATCGAATATTTGCTTATCTA

Use formula: Tm = 4C x (# of GC pairs) + 2C x (# of AT pairs) 6 GC pairs and 20 AT pairs T = (4C x 6) + (2C x 20) → 64C

Using which of the following is an appropriate way to avoid PCR contamination? High-fidelity pol Hot-start PCR Using a separate area for PCR set up Fewer PCR cycles

Using a separate area for PCR set up

10 equivalents of a genome were cut into small pieces and sequenced. Computers were used to put the sequence of the pieces together to determine the sequence of the intact genome. The method described is which of the following? Basic logical alignment search tool Hierarchal shotgun sequencing Whole genome shotgun sequencing Gene recognition and assembly

Whole genome shotgun sequencing

DNA is isolated from a clinical sample. the absorbance @ 260 nm is 0.489, and the absorbance @ 280 nm is 0.257. Is this sample of sufficient quality for use in subsequent analyses?

Yes

An RNA preparation has the following absorbance: A260 = 0.208 and A280 = 0.096. Is this RNA prep satisfactory for use?

Yes, because A260 /A280 = 2.167 RNA ratios should be between 2.0 and 2.3

which of the following will not inhib RNAses? guanidine isothiocyanate GITC tris strong reducing agents high-salt buffers

tris buffer

When a DNA fragment is resolved by slab gel electrophoresis, a single sharp band is obtained. What is the equivalent observation had this fragment been fluorescently labeled and resolved by capillary electrophoresis?

You would observe a single peak on the electropherogram

what is TaqMan?

a qPCR probe syst

the ddNTP:dNTP ratio is too high (too much ddNTP). how will this affect seq results? no effect a seq ladder of only short frag a seq ladder of only long frag equally spaced bands in every lane

a seq ladder of only short frag

what is MALDI-TOF?

a type of mass spectrometry

which of the following would be most difficult to identify by karyotype? microdeletion reciprocal translocation aneuploid polyploid

microdeletion

which mod of PCR uses short primers w/ random seq that generate the amp of many diff products? reverse transcriptase real-time nested arbitrarily primed

arbitrarily primed

what was the great advantage to molecular analysis offered by southern blot? ability to analyze specific regions of DNA w/o cloning them a rapid method to eliminate DNA contaminants a more efficient buffer syst ability to analyze nanogram amts of DNA

ability to analyze specific regions of DNA w/o cloning them

which is an important property of gel running buffer? solubility @ low T ability to maintain constant pH capacity to heat up quickly high UV light absorption

ability to maintain constant pH

poly(A) pol adds:

adenine to the 3' ends of RNA

Before its conversion to a microarray technique, CGH was performed by hybridizing labeled DNA to what support? immobilized PCR prod normal chromos spread nitrocellulose mb agarose gel

agarose gel

what is an advantage of agarose over polyacrylamide gels? agarose is more stable than polyacrylamide agarose monomers are not toxic acrylamide takes a long time to polymerize polyacrylamide gels must be used immediately after polymerization

agarose monomers are not toxic

what is 1 reason that polyacrylamide gels have higher resolution than agarose gels for small frags? agarose polymer spaces are bigger than those of polyacrylamide agarose polymers are very fragile agarose won't separate molec over a certain size agarose is a synthetic polymer in which sieving prop can be precisely controlled

agarose polymer spaces are bigger than those of polyacrylamide

which of the following ctrls are crit for ensuring that amp is occurring in a patient sample and the lack of PCR prod isn't due to the pres of polymerase inhibitors? rgt blank sensitivity ctrl - ctrl amp ctrl

amp ctrl

comparative genome hybridization detects which type of genetic abnormalities? amp relative to reference DNA absolute gene # inversions AA sub

amp relative to reference DNA

nucleic acids migrate toward which pole in electrophoresis?

anode (-)

which of the following is a method of signal amp? transciption-mediated amp (TMA) PCR LCR bDNA

bDNA

seq ladders resolved by gel electrophoresis are read in which of the following directions?

bottom to top

a method that detects nucleic acid seq via signal amp and that uses alkaline phosphatase is: branched DNA ligase chain rxn PCR transcription mediated amp

branched DNA

to monitor the progress of electrophoresis, which of the following is added to a sample that doesn't associate w/ DNA and runs ahead of the smallest frag in the sample? EtBr acrylamide bromophenol blue SYBR Green

bromophenol blue

which fixative is the least dmging to nucleic acids? A. b5 B. bouin's C. all mercury-based fixatives D. buffered formalin

buffered formalin

a very limited amt of nucleic acid, 500-1500 bp in size, is to be analyzed in a short time (same day) with the results available immediately. Which of the following electrophoresis procedures will satisfy those conditions? capillary electrophoresis PFGE, pulse field gel electrophoreiss FIGE, field inversion gel electrophoresis contour-clamped homogenous electric field

capillary electrophoresis

which of the following is used to optimize yield of nucleic acid by precip / column purification? A. carrier molec B. detergent C. tris buffer D. isotonic saline

carrier molec

in c banding pattern, what part of the chromos stains? whole chromos heterochromatin euchromatin centromere

centromere

chromosomes are divided into different parts, and locations are denoted by # corresponding to the diff part in which of the following orders?

chromos, region, band, sub band

a reciprocal translocation is which type of mutation?

chromosome

which of the following are used to make wells in a solidying gel into which samples are loaded?

combs

an analysis that takes place in silico is happening in which of the following places? computer lab biological organism tissue

computer

sub of leucine w/ valine in an AA acid seq is what type of mutation? conservative non-conservative silent nonsense

conservative

as compared w/ traditional slab elctrophoresis, which of the following is not an advantage of capillary electrophoresis? analyze smaller amts of samples ability to run >1 sample together cost of instrumentation and labels real-time sample detection and analysis

cost of instrumentation and labels

what enz syst is used to avoid contamination in RT PCR? dUTP-UNG SSP-PCR UV-psoralen SAP-Exol

dUTP-UNG

Dideoxycytidine is added to one of four sequencing reactions. All of the DNA fragments produced in that reaction end with which nucleotide? dG ddC dC ddG

ddC

which of the following are included in seq rxns to deter 2o struct in the template and synth frag? deaza-GTP Mn Mg extra dNTPs

deaza-GTP

a southern blot procedure has been performed, but the molecular wgt markers are the only bands seen on the gel. apparently, the probe didn't bind to its target on the mb. how might the stringency be adjusted so that the probe will bind? decr the incubation T decr the [salt] incr the [formamide] incr the incubation T

decr the incubation T

which of the following lab methods used to detect mutations relies on differences in dissociation of ds DNA into ss DNA at different pts in a gel? denaturing gradient gel electrophoresis HPLC allele-specific oligomer hybridization inversion probe assay

denaturing gradient gel electrophoresis

what process facilitates denaturation of long DNA frag? precipitation removal of bases from the ends of molec dephosphorylation depurination

depurination

a chromos formed when parts of 2/> chromos are joined to a 3rd normal chromos is called: ring chromos isochromos derivative chromos balanced translocation

derivative chromos

which of the following is the fx of SYBR Green in quantitative PCR? detection of the PCR prod facilitates amp prevents contamination minimizes mis-priming

detection of the PCR prod

in PCR, an instrument is used to incr and decr the T @ set intervals as programmed by the technologist in order to: prevent the Taq pol from being denatured avoid the formation of primer dimers on a post-PCR gel image determine the rxn that is occurring in the sample neutralize potential contamination from previous amplicons

determine the rxn that is occurring in the sample

which of the following methods used to detect mutations is a seq (polymerization)-based method? restriction frag length polymorphisms ss conformation polymorphisms dideoxy DNA fingerprinting invader assay

dideoxy DNA fingerprinting

patient DNA has been mixed in sep wells w/ a probe that detects the 1691G>A mutation assoc w/ factor V Leiden and a probe that detects the normal seq. Cleavase is added to all wells, and the fluorescence is meas in each well. Fluorescence was detected in the well that included the normal probe, and no fluorescence was detected in the well containing the mutant probe. which of the following assays was performed? invader assay nonisotopic RNase cleavage assay chem cleavage assay high-density oligoNT array

invader assay

which of the following methodologies was used in the human haplotype mapping project? melt curve analysis denaturing gradient gel electrophoresis prot truncation test inversion probe assay

inversion probe assay

which of the following isn't a method of transferring nucleic acids from a gel to a mb substrate? capillary vacuum eletrophoretic ionic

ionic

mass spectrometry detects what type of particles?

ions

DNA, after sep from other cellular constituents, is precip in which of the following?

isopropanol

which of the following is involved in connecting the centromere to the spindles during chromos segregation in mitosis? kinetochore euchromatin histone prot h1 heterochromatin

kinetochore

what determines the specificity in terms of the gene or region that is detected in the southern blot?

labeled probe

adding formamide to a hybrization mix: incr stringency incr Tm lowers Tm incr [salt]

lowers Tm

a pyrosequencer detects visible light, making it which type of instrument? luminometer UV spectrophotometer mass spectrometer fluorometer

luminometer UV

what are the 4 steps of the QIAGEN ext kit?

lyse, bind, wash, elute

PolyT oligomers bound to a matrix resin column will selectively isolate what?

mRNA

a northern blot allows you to do which of the following? analyze a specific region of DNA in a complex bg meas gene expression investigate DNA binding prot determine Ag/Ab interactions

meas gene expression

a chromos that has the centromere in the center of the chromos is called:

metacentric

Examination of chromosomes in karyotypes is performed on chromosomes in what stage of mitosis?

metaphase

which is critical to the success of seq-specific PCR? -5' end of the primer must match the template -the forward primer must have a higher Tm than the reverse primer -the 3' base of the primer must be complementary to the template -the primers must be less than 20 bases long

the 3' base of the primer must be complementary to the template

the AA seq DAILMNCST is mutated has a S8X mutation. which of the following correctly describes this mutation? -7 add'l serine residues are inserted next to S -the S is sub w/ any AA at position 8 -there was a frameshift mutation at the S, producing a stop codon -the S at position 8 is mutated to a nonsense codon

the S at position 8 is mutated to a nonsense codon

what is learned from the size of restriction frag as determined by migration speed in gel electrophoresis? the specificity of the RE the dist b/t RE recog sites the rate of digestion of the enz the # of restriction sites in the DNA

the dist b/t RE recog sites

the codon UGG is mutated to UGA. what will happen to the encoded prot?

the encoded prot will be prematurely terminated

nucleic acid has been isolated from a urethral swab and a PCR is performed on the sample to detect Neisseria gonorrhoeae. the + ctrl has a band and at the expected size; the - template ctrl and the contamination ctrl don't have bands; and the amp ctrl has a band of expected size. the patient sample has a band and consistent w/ the amp ctrl band and doesn't have a band and corresponding to the + ctrl band. how is this result interpreted?

the patient doesn't have Neisseria gonorrhoeae, and it's a true - result

enz that recog palindromic seq of DNA, that are cut w/i the recog seq, that don't have methylating activity, and that are used frequently in the lab are which type of RE? type 1 type 2 type 3 type 4

type 2

in organic DNA ext methods, the DNA is found in which fraction?

upper aqueous

a patient w/ a family history of breast cancer, in which several affected relatives have a known mutation in the BRCA1 gene, is screened for the presence of the mutation by allele-specific oligomer hybridization. signal from the labeled oligomer corresponding to the normal seq was observed when exposed to the patient's sample. signal was also observed when the labeled oligomer of the mutant seq was tested w/ the patient's sample. which of the following corresponds to the correct interpretation of these results? -the patient has a normal BRCA1 seq -the patient has a heterozygous mutation in BRCA1 -the patient has a homozygous mutation in BRCA1 -the results aren't valid

the patient has a heterozygois mutation in BRCA1

a single-strand conformation polymorphism (SSCP) procedure has been performed on a patient sample, and the results were compared w/ those from a normal reference sample. the patient bands resolved in different locations on the gel as compared w/ the reference bands. these results would be interpreted as which of the following?

the patient has a mutation in the targeted region

a patient is being tested to determine whether he has the factor V Leiden mutation by PCR-RFLP analysis.PCR is performed on the patient's DNA and cut w/ HindIII. The mutation-positive ctrl sample had a single band of expected size, and the mutation-negative ctrl sample had a slightly larger band. the patient's specimen had 2 bands, 1 was the same size as the mutation-positive ctrl band and the other the same as the mutation- neg ctrl. which of the following is the correct interpretation of these results? -the patient doesn't have the factor V Leiden mutation -the patient is heterozygous for the factor V Leiden mutation -the patient is homozygous for the factor V Leiden mutation -the results aren't valid, and the assay should be repeated

the patient is heterozygous for the factor V Leiden mutation

a melt curve analysis was performed to genotype hep C virus (HCV), which has been identified in a patient. when the derivative of fluorescence was plotted vs the T for the patien'ts isolate as well as for a known genotype of HCV, the 2 seq had identical peaks and thus the same Tm. Which of the following is the correct interpretation of these results? -the patient's HCV genotype is the same as the known genotype -the patient's HCV genotype is different from the known genotype -the patient has multiple HCV genotypes -the patient's virus isn't HCV but some other virus

the patient's HCV genotype is the same as the known genotype

which of the following pieces of info has been determined about the human genome? chromos 13 has the most genes per bp the size of the human genome if 3 Gbp the avg gene size if 45 kbp chromos X has the fewest genes

the size of the human genome if 3 Gbp

a molecular technologist has run a vertical gel. while analyzing the gel, the technologist notices that the bands in the outer lanes didn't run as far as similar-sized bands in the inner lanes, so the bands look like a smile on the gel. what is the explanation for this?

the temp across the gel wan't constant, so the inner wells were warmer

what is the purpose of an amp ctrl in PCR?

to distinguish true - from false -

what is exo-sap method used for? to add complement ddNTP into the PCR prod to prevent mispriming in the PCR prod to remove NT and primers from PCR prod to allow rxn to be inactive form @ RT to be able to detect bands when performing a gel

to remove NT and primers from PCR prod

polyacrylamide gel properties can be altered by adjusting T and C values. what are T and C in this context?

total [acrylamide] + cross-linker and % cross-linker

what is the designation of a cell w/ 3 copies of every chromos?

triploid

in what way is fluorometry more accurate than spectrophotometry?

using specific stains, fluorometry only detects intact ds DNA