Final Review

What does the "signal recognition particle" do?

The signal recognition particle guides the ribosome and mRNA to the surface of the ER where they bind with receptor proteins

Undershoot

The sodium channels close, but some potassium channels are still open. As these potassium channels close and the sodium channels become unblocked (still closed), the membrane returns to its resting state.

What kinds of molecules are these?

a. Glucose b. Nucleotide c. Protein d. Lipid

A cell has a prominent nucleolus, what is its function?

making ribosomal subunits

proton

positively-charged particle found in the nucleus of an atom

Describe the four lines of evidence for the endosymbiont theory of the evolution of mitochondria and chloroplasts:

1. Chloroplasts and mitochondria are both the same size as prokaryotes and divide by binary fission. 2. Mitochondria and chloroplasts have their own DNA that is circular, not linear. 3. Mitochondria and chloroplasts have their own ribosomes. 4. Several more primitive eukaryotic microbes, such as Giardia and Trichomonas have a nuclear membrane but no mitochondria.

List the three major steps of signal transduction, and for each step, briefly describe what happens at that step.

1. Reception - a protein at the cell surface detects chemical signals 2. Transduction - a change in the protein stimulates other changes including signal transduction pathways 3. Response - almost any cellular activity

What are the minimal components necessary for the creation of an early cell, at the boundary between an abiotic world and biological life? (pg. 524)

1. Synthesis of organic compounds (amino acids, nitrogenous bases). 2. The joining of these small molecules into macromolecules (proteins, nucleic acids). 3. The packaging of these molecules into protocells (reproduction, metabolism). 4. The origin of self-replicating molecules that made inheritance possible (RNA).

Imagine a membrane receptor protein that activates a phosphorylation cascade involving 4 different protein kinases (PK1-PK4), each phosphorylating and thus activating the next one in line. If each PK can activate 10 neighboring PKs, how many molecules of PK4 will be activated by the initial activation of one PK1 molecule? Again, a quick sketch might help you think about this.

1000; increase by power of 10 for each PK

Which of these cells are haploid? Which are diploid? What makes you say so?

2n is diploid. After meiosis 2 is haploid

You can use the following sequence to determine primary structure of a protein that is coded for by the strand of DNA that is opposite the sequence below. EXPLAIN HOW you'd do this. 5'- ATGCCGTCTGACACATGCCCGTAA-3'

3'- TACGGCAGACTGTGTACGGGCATT-5'

Explain the Miller-Urey experiment?

4 gases reacted with a spark forming amino acids

Earth formed ________________ years ago, and we have evidence of the first life forms approximately __________________ years after that.

4.6 BYA; 1.1 B (about 3.5 BYA)

Fructose only

? fructose has nothing to do with the lac operon

And by definition, how does a base change a solution it's added to?

A base reduces H+ concentration in a solution.

A benign tumor is not necessarily a health risk and can be removed.What's The essential difference between cells of benign tumor and cells of a malignant tumor?

A benign tumor cannot survive at another site, it can't spread. A malignant tumor can spread.

Explain what an enzyme is.

A biological substance that speeds up a reaction.

Describe how microbial vectors are used to amplify and transfer engineered genes.

A cloning vector and a PCR primer cut with the same restriction enzyme will mix to make a recombinant DNA plasmid. In molecular cloning, a vector is a DNA molecule used as a vehicle to artificially carry foreign genetic material into another cell, where it can be replicated and/or expressed. (more google answers).

What is a codon?

A codon is a sequence of three nucleotides that code for an amino acid.

intermediate filaments

A component of the cytoskeleton that includes filaments intermediate in size between microtubules and microfilaments.

Microtubules

A hollow rod composed of tubulin proteins that makes up part of the cytoskeleton in all eukaryotic cells and is found in cilia and flagella.

What is the function of each during mitosis

A kinetochore microtubule attaches to chromosomes and moves them towards the poles.A nonkinetochore microtubule lengthens the cell.

What is the difference between a kinetochore microtubule and a non-kinetochore microtubule?

A kinetochore microtubule is attached to chromosomes and move them toward the poles. A non-kinetochore microtubule is responsible for elongating the cell during anaphase.

Triacylglycerols (triglycerides)

A lipid consisting of three fatty acids linked to one glycerol molecule; also called a fat or triglyceride.

Cholesterol

A lipid that forms an essential component of animal cell membranes and acts as a precursor molecule for the synthesis of other biologically important steroids.

With regard to your answer for #12, how does this relate to cell differentiation?

A mix of different activators can lead to cell differentiation.

The enzymes that synthesize DNA (replicate it) cannot initiate it. They can only add nucleotides to a chain that has already been started. So how is this problem solved?

A new DNA strand will start with a primer designed from a past DNA template.

What macromolecule is synthesized in translation?

A polypeptide is synthesized in translation.

Explain how a "pulse chase" experiment works.

A pulse-chase analysis is a method for examining a cellular process occurring over time by successively exposing the cells to a labeled compound (pulse) and then to the same compound in an unlabeled form (chase).

Certain proteins contain amino acid sequences that act as "localization signals". Using the videos and Fig. 17.21 as a guide, outline how the presence of a "signal peptide" facilitates the synthesis of a protein into the ER lumen.

A signal peptide prompts the ribosome to attach to the translocation complex and release the protein into the ER lumen.

Microfilaments

A small rodlike structure, about 4-7 nanometers in diameter, present in numbers in the cytoplasm of many eukaryotic cells.

Depolarization

A stimulus opens some sodium channels. Na inflow through those channels depolarizes the membrane. If the depolarization reaches the threshold, it triggers an action potential.

What structure is required to move many proteins, such as neurotransmitters, all at once, out of a cell? What is this kind of transport called, and what organelle is involved?

A transport vesicle that has budded from the Golgi apparatus move along microtubules of the cytoskeleton to the plasma membrane. This process is called exocytosis.

What are the two components of a buffer?

A weak acid and its corresponding base

In the figures above (a,b,c) represent an animal cell in a solution. For each picture, indicate the solute concentration relative to the cell, and what effect this will have on both H2O movement and on the cell.

A: The solute concentration is equal inside and outside the cell. Movement will be minimal with H2O and the cell. Lyse. B: The solute concentration is inside the cell. H2O will begin moving outside the cell until equilibrium is reached. C: The solute concentration is outside of the cell. H2O will begin moving inside the cell until equilibrium is reached.

What could be considered the "spending money"?

ATP

How does your body convert the big deposit into the spending money, and more importantly, why does it have to?

ATP is more efficient

What essential thing does an acid do when it's added to water? For example, we call HCl an acid because it does what to water?

Acids add H+ to a solution. Acids increase the hydrogen ion concentration of a solution.

What is a "weak" acid?

Acids that reversibly release and accept back hydrogen ions

Explain what is necessary, at the transcription level, for a eukaryotic cell to achieve a high level of transcription for a particular gene.

Activators (mediator proteins) can increase the transcription level. Activators bring the enhancer region closer to the promoter. This binds other regulatory proteins or components of the transcription machinery, facilitating a series of protein-protein interactions that result in enhanced transcription of a given gene.

Imagine the ion from #6 is very abundant outside the cell, but rare inside the cell. How does this change your answer about whether it takes ATP energy or not? If it takes ATP energy, what is this kind of transport called?

Active transport would be required since it's going against gradient, ATP required.

From the rough ER what is the next organelle in the secretion pathway? (A) smooth ER; (B) Golgi; (C) lysosome.

After the ER, the next organelle in the secretion pathway is the Golgi.

Rough endoplasmic reticulum function

Aids in synthesis of secretory and other proteins on bound ribosomes; adds carbohydrates to proteins to make glycoproteins; produces new membrane.

Scientists believe that all life on Earth shares a common ancestor. In your opinion, what are the three most convincing lines of evidence that supports this view?

All living things reproduce, metabolize, and are made of cells.

What is the 2nd law of thermodynamics in the world around you?

All processes that happen in the universe increase entropy in the universe

The general structure of amino acids are shown in this picture. What function groups are pictured in salmon and yellow, respectively?

Amino and carboxyl

What enzyme is primarily involved in translation?

Aminoacyl - tRNA synthetases are the enzymes involved in translation. (In Hansens office hours she said its the ribosome???)

What is an action potential, and how is it initiated and propagated? Why does it travel only in one direction? Include in your answer what stimulates the gated channels to open, which channels open first, which open second, and how the membrane potential becomes established again.

An electrical signal that propagates (travels) along the membrane of a neuron or other excitable cell as a nongraded (all-or-none) depolarization

Give an example of the 2nd law of thermodynamics in the world around you.

An old car rusting

When during meiosis should the synaptonemal complex break down?

Anaphase 1

When during meiosis should cohesins between sister chromatids normally break down?

Anaphase 2

Briefly compare cytokinesis in animal cells and plant cells. Why is there such a difference in the process?

Animal cells form a cleavage furrow and pinch off separating into two cells. A plant cell must use a cell plate to form a new plant wall.

Density Dependence

Animal cells stop dividing when they come in contact with one another.

Who makes glycogen and why?

Animals for energy storage

On a molecular level, what is the basic structural difference between the fatty acids that animals make and the fatty acids that plants make?

Animals use saturated and plants use unsaturated. Aka unsaturated has more cis double bonds.

M checkpoint

Are all of the chromosomes attached to microtubules?

Recognize major representative examples of living organisms, and be able to classify them into domains and kingdoms reflecting their evolutionary history.

Bacteria - Aquifex, Thermotoga Archaea - Halophiles Eukarya - Animals, Fungi, Plants

Make a diagram of a gene "construct" (an engineered gene) that, when introduced into an animal or plant, will be able to express a particular type of protein at specific times and/or places within the organism. What are the elements required for such a gene?

Be able to draw out CRISPR and a region downstream where you can attach transcription factors.

Why do fish use more unsaturated fats than cows?

Because cows are exposed to higher temperatures, so they are able to keep saturated fat liquid. Fish are often in a colder climate which requires unsaturated fat, which stays liquid at colder temperatures.

Why do coastal areas have more moderate climates than inland areas of the same latitude?

Because of waters high specific heat that regulates the temperature on the coasts more evenly.

How are the mitochondria and chloroplast similar?

Both have double membrane Both have their own DNA

Lysosome function

Breakdown of ingested substances, cell macromolecules, and damaged organelles for recycling.

Why do researchers believe that telomerase may be a useful target for cancer therapy?

By targeting telomerase, it could limit the number of divisions that a somatic cell would undergo which could stop the spreading of cancer.

How can we predict whether a biological reaction will happen or not?

By the Free-Energy Change, ∆G

What is the formula for glucose?

C6H12O6

Give the full equation for cellular respiration of glucose?

C6H12O6+6O2 ----> 6CO2 + 6H2O + Energy

Carbonyl

C=O

Monosaccharides are in multiples of the general formula _________.

CH2O

Using the molecules found in the equation of respiration, what is the name of the following molecules in the diagram below

CH2O ----- CO2 / O2 ------ H2O

Methyl

CH3

Carboxyl

COOH/COO- (acid)

Sometimes ATP is used as a source of a phosphate group, and sometimes it is bound non covalently (via weak bonds) directly to one of the reactants. Describe an example of each kind of scenario in which ATP facilitates cellular work.

Can be covalently bonded, or broken (not covalent) to provide energy

Chloroplasts

Capture energy from sunlight and use it to produce food for the cell

Draw an atom that has 6 electrons, using a circle in the middle to represent the nucleus, and rings to represent each electron shell. Draw dots to represent each electron.

Carbon

Anchorage Dependence

Cells must be in contact with a solid surface to divide

What are the three types of "work" a cell does? Give an example of each kind.

Chemical work - synthesis of polymers and monomers Transport work - pumping of substances across the membrane Mechanical work - contracting of muscles, beating of cilia

What are the two basic stages of photosynthesis?

Chloroplasts are the organelles responsible for photosynthesis

Describe the difference in the function of cohesins and synaptonemal complex during prophase I.

Chohesins hold sister chromosomes together. Synap hold homologus chromosomes together.

On a separate piece of paper, brainstorm a giant list of all the ways you can think of for a eukaryotic cell to control which proteins are present and functional in that cell at any given time (i.e. controlling gene expression). Put these into general categories of levels of gene regulation: "Chromatin Structure", "Transcription Level", "Post-transcriptional", and "Post-translational"

Chromatin level - Tightly packed chromatin stops transcription. Loose chromatin permits transcription. DNA and histone methylation are also associated with the chromatin level regulation. Transcriptional Level - Transcription factors control this level of regulation. Repressors and activators change the rate of transcription. Post-transcriptional - mRNA degradation and blocking the initiation of translation. Post translational - Protein processing and degradation.

DNA is deleted to make a specific combination of antibodies.

Chromatin level, long term.

Whereas prokaryotes use operons to coordinate production of proteins that are all related in function, eukaryotes do not have operons. However, coordinated gene expression can occur. Imagine a scenario in which one hormone elicits the production of several different proteins simultaneously. What is the mechanism behind this level of coordinated gene expression?

Chromatin structure level, transcriptional level, post transcription, and post translational are all ways that Eukaryotic cells can control gene expression.

Metaphase

Chromosomes align at the metaphase plate. The spindle has captured all the chromosomes and lined them up, ready to divide. Centrosomes are now at opposite ends of the cell.

Prophase

Chromosomes are condensed in the nucleus. The spindle is in early phases of developing. The centrosomes move away from each other.

List the four main emergent properties of water. For each property, give an example of how this property can be seen in the natural world.

Cohesion - transport of water in plants from roots to leaves. Temperature Moderation - air is generally cooler along ocean coasts. Expansion upon freezing - solid ice floats on liquid water Versatility as a solvent - water dissolves more substances than any other liquid.

Describe the difference between competitive inhibitors and non-competitive inhibitors.

Competitive inhibitors directly compete by blocking substrates from entering active sites whereas noncompetitive inhibitors indirectly compete by binding to another part of the enzyme.

Explain what is happening in this image

Crossing over

What present day organisms do these early fossils resemble?

Cyanobacteria

The three pyrimidines are

Cytosine, Thymine, Uracil

Compare DNA to RNA including components, structure, role it serves.

DNA - is a double-stranded molecule made out of phosphate group, sugar, and nitrogen base. DNA provides instructions to produce proteins. RNA - is a single-stranded molecule made of ribonucleotide bases. RNA carries the genetic information copied from DNA in the form of a series of three-base code "words," each of which specifies a particular amino acid.

In your own words, explain the "semi-conservative" model of DNA replication.

DNA double helix has one old strand and one new strand.

What roles do the nucleases, polymerases and ligases have in DNA repair?

DNA polymerase proofreads. DNA ligases is an enzyme involved in the mismatch repair process. DNA nucleases catalyze the cleavage of phosphodiester bonds.

What macromolecule provides the information in transcription?

DNA provides the information in transcription.

Prokaryotes have a circular model while Eukaryotes have linear chromosomes. Eukaryotes DNA is in the nucleus while Prokaryotes are in the cytoplasm.

DNA replication is similar in prokaryotes and eukaryotes. List two ways in which they are Different.

During transcription, in which direction is the DNA template strand read? If it helps you answer, draw a line below to represent the template and the mRNA strand, putting 5' or 3' on the ends to designate the directions.

DNA template strand is read from 3' to 5'.

What is the definition of recombinant DNA?

DNA that has been formed artificially by combining constituents from two different organisms.

Consider the effects of a mutation that allows a cell to ignore the M checkpoint. What would be a likely outcome in the daughter cells resulting from cell replication of this cell?

Daughter cells may end up with the wrong amount of chromosomes.

What bonds two molecules of glucose together?

Dehydration synthesis

What is the reaction called that binds two glucose together?

Dehydration synthesis

Rising phase

Depolarization opens most sodium channels, while the potassium channels remain closed. Na influx makes the inside of the membrane positive with respect to the outside.

Vacuole function

Digestion, storage, waste disposal, water balance, cell growth, and protection.

Give an example of the 1st law of thermodynamics in the world around you.

Drop a phone makes a sound.

Does each codon correspond to only one, or more than one amino acid?

Each codon corresponds to one amino acid.

Imagine a plant cell, that, in order to do its job, needs to have more water enter it than it currently has. It is bathed in an aqueous solution (as all cells are) but it needs MORE water to enter into its cytoplasm. Given what you know about water, solutes, and transport, how could this plant manipulate the situation such that more water enters the cell?

Endocytosis

How does a cell acquire the energy necessary to perform the work cited in question 16

Energy coupling, the use of an exergonic process to drive an endergonic one.

Animals and plants both use fats. What do plants and animals use fats for?

Energy storage

What is potential energy?

Energy that matter possesses because of its location or structure. Anything that is not kinetic energy.

Describe why a reaction that is spontaneous will happen faster with the help of an enzyme. Be as through in your answer as you can. Revisit this question repeatedly during the next week and see if your answer changes as you become more familiar with the material.

Enzymes speed up metabolic reactions by lowering energy barriers.

What processes do we associate with living things?

Evolutionary adaptation, energy processing, responding to the environment, growth and reproduction.

Explain the differences between exergonic and endergonic reactions.

Exergonic is a release of energy whereas endergonic takes energy from its surroundings.

Give an example of a)exergonic, and b) endergonic reaction.

Exergonic- cellular respiration (these are spontaneous) B: Endergonic- photosynthesis (not spontaneous)

How/why would temperature and pH affect an enzyme's activity

Extreme temperatures cause an enzyme to lose it shape and stop working. Changing the pH outside of its range will slow the enzyme activity.

How is the cell protected from the low pH levels in a lysosome?

First, the enzymes are enclosed in the lysosomal membrane and second, even if the enzymes were to leak out of the lysosome, they would not be active at the neutral pH of the cytosol.

Imagine the energy your body uses as its energy "budget", bringing in energy and spending it to stay alive and active. Using this analogy, what could be considered the large deposit, or perhaps the "paycheck" coming into the bank?

Food in the form of glucose

What's the difference between free ribosomes and bound ribosomes?

Free ribosomes are floating the the cytoplasm while bound ribosomes are attached to the surface of the ER.

In an experiment, you fuse two cells, making 1 large cell with two nuclei. At the time of fusion, Cell 1 had been in mitosis, and Cell 2 had been in G1 phase. Predict what will happen to each of the nuclei for Cell 1 and for Cell 2 after they have fused. Explain your prediction in terms of cellular communication. Hint: Figs 12.14 and 12.16 may help.

G1 chromosomes condense and it will do a mitosis

The cell cycle consists of the mitotic phase and interphase, each of which is subdivided. Next to each subphase below, give a brief description of what occurs in the cell.

G1: Cell growth (making more organelles) S: Copies DNA G2: prepares to divide Mitosis: The division of the genetic material in the nucleus Cytokinesis: The division of the cytoplasm

Resting state

Gated Na and K channels are closed; ungated channels maintain the resting potential

Recombinant DNA can be used in different ways, depending on the desired end-result. Outline three distinctly different end results that would all include using recombinant DNA.

Gene cloning - Amplify the gene using bacteria and then sequence it or use it for further cloning. Allow the bacteria to express the gene, making lots of the protein product that the gene codes for. Insert the gene into another organism's DNA to give that organism a particular desireable trait when they express the protein. Gene therapy Food production

Explain the difference between gene cloning and reproductive cloning, and in very brief terms, outline the basic strategy behind reproductive cloning.

Gene cloning is simply when many copies of a certain gene are made. In reproductive cloning an entire organism will be cloned which should be genetically identical to the original clone.

List at least three occasions in which gene expression in your own body has important effects.

Gene regulation affects how many proteins we can make, how many for every cell and how many are appropriate for each environment.

In your own words, list at least three advantages of controlling gene expression.

Having control over cellular structure and function, adoption to changes in the environment, and conservation of energy.

What protein might be made in abundance by an erythrocyte (red blood cell) but not made by a lymphocyte (white blood cell)?

Hemoglobin

Define homologous chromosomes.

Homologous chromosomes are a set of one maternal and one paternal chromosome that pair up with each other inside a cell during meiosis. Homologs have the same genes in the same loci.

Describe what happens during "crossing over", and explain how crossing over leads to genetic variation. In your answer, you should be including these terms: homologous chromosome(s), sister chromatid(s), non sister chromatid(s), synapsis, chiasma(ta), recombinant chromosome(s)

Homologous chromosomes come together during prophase I and form a tetrad. And non sister chromatids cross over. They form a synapse and then Dna is exchanging between chromosomes. And then recombinant DNA.

Nucleus function

Houses chromosomes, which are made of chromatin (DNA and proteins); contains nucleoli, where ribosomal subunits are made; pores regulate entry and exit of materials.

What is meant by the "half life" of an isotope?

How long it takes 50% of the radioactivity of an atom to decay.

Which of the following explains what is happening when sodium chloride dissolves in water?

Hydration shells are forming around the sodium and chloride ions.

What do the 2nd, 3rd, and 4th protein levels all have in common?

Hydrogen bonds

In eukaryotes where in the cell do transcription and translation happen? What about in prokaryotes?

In Eukaryotes, transcription occurs in the nucleus and translation occurs in the cytoplasm (in the ribosome). In Prokaryotes, transcription and translation both occur in the cytoplasm.

What is a cloning vector?

In genetic engineering, a DNA molecule that can carry foreign DNA into a host cell and replicate there. Cloning vectors include plasmids and bacterial artificial chromosomes (BACs), which move recombinant DNA from a test tube back into a cell, and viruses that transfer recombinant DNA by infection.

What is the rule you need to remember in order to know which way water will move?

In the absence of other forces, a substance will diffuse from where it is more concentrated to where it is less concentrated. Put another way, any substance will diffuse down its concentration gradient. High to Low water potential. Low to high solute concentration.

"Independent assortment" is a term that describes one aspect of how chromosomes move during meiosis. Describe exactly what this means, using your own words.

Independent assortment: homologous chromosomes line up completely randomly at the metaphase plate so they are split up independent from one another.

G1 checkpoint

Is cell division necessary? Growth Factors? Large enough? Nutrients available?

In what major way is the CRISPR-Cas9 technology superior to most previous mechanisms? (The answer is not because it's faster and cheaper, although that's nice too!).

It is targeted.

On a molecular level, what does a MPF molecule do?

It is the cyclin-Cdk complex that stimulates the mitotic and meiotic phases of the cell cycle.

Imagine a scenario in which a point mutation occurs in the gene for a cell cycle protein, allowing the cell to ignore the requirements listed in #14. What would be a likely outcome for the cell and its surrounding tissue?

It may cause a tumor

What is the major role of DNA?

It provides instructions for creating proteins.

Why do they use carbon 14 (C14) instead of the more common carbon isotope, C12?

It takes longer to decay. Carbon-14 is radioactive and decays to nitrogen-14 so a half life can be used.

What impact does high concentration of MPF have on a cell?

It will send the cell into M phase.

What is chaperonin, and how does it aid in protein folding? Why is it necessary?

It's the box that protects the protein, so it's safe while it's folding.

What is kinetic energy?

Kinetic energy is the energy of motion.

In your own words, explain what is meant by a "protein".

Large molecules composed of one or more chains of amino acids.

Explain what is happening in this image.

Left: Meiosis I and Meiosis II. Right: mix between maternal and paternal

Explain the differences between light and electron microscopy.

Light Microscopy uses light which is passed through the specimen and then refracted through glass lenses magnifies up to 1000 times past the original, whereas electron microscopy beams electrons through the specimen. Resolution is inversely related to wavelength, so you can see much smaller.

What is the overall function of the light reactions?

Light reaction and the calvin cycle are the two stages in photosynthesis

On early Earth, what are two sources of energy that could have aided in the formation of small organic molecules?

Lightning and UV rays, volcano, meteors

What organelles should be very abundant in macrophages?

Lysosomes

Which type of organelle is involved in the digestion (hydrolysis) of triglycerides (fats and oils)?

Lysosomes

What is the link between cyclins and MPF?

MPF and cdks make proteins that facilitate mitosis.

How are mitochondria and chloroplasts different?

Mitochondria do not contain chlorophyll and chloroplasts do.

What is the outcome of mitosis? Why is it important?

Mitosis produces a new cell, and it's important for the growth and development of our bodies. It also replaces cells that are old or damaged.

Golgi body function

Modification of proteins, carbohydrates on proteins, and phospholipids; synthesis of many polysaccharides; sorting of Golgi products, which are then released in vesicles.

Describe the hierarchy of complexity in biological systems, and give examples to illustrate the relationship among different hierarchical levels:

Molecule - Makes up cells Organelle - Functions with other organelles to sustain a cell Cell - Make up tissues Tissue - Fuse to make organs Organ - Are attached to create organ systems Organ System - Sustain organisms Organism - Gather to make populations(one speices) Population - Form communities(multiple species) Community - Work together to form ecosystems Ecosystem - Make up the biosphere Biosphere - Is where all life on Earth exists

When pH goes down

More acidic so more hydrogen are added.

When pH goes up

More basic so more hydrogen are removed.

Water has an unusually high specific heat. This is directly related to which of the following?

More heat is required to raise the temperature of water.

Falling phase

Most sodium channels become inactivated, blocking Na inflow. Most potassium channels open, permitting K outflow, which makes the inside of the cell negative again.

Even with all the safeguards, mutations sometimes occur. Those that do usually have negative, if not disastrous results. However, there is one very good thing that can result from DNA mutations. In your own words, explain the main advantage of these rare mutations.

Mutations can lead to advantageous adaptations or even create a new species. Mutations are essential to evolution.

Amine

NH2 (base)

Outline the steps required in cell communication to increase the amount of a particular protein that is made (make up a hypothetical situation). Where is the receptor most likely to be located? What are two probable features that a ligand for such a receptor might have? Use a diagram to explain your answer - I think it helps thinking about signaling pathways.

Need more messengers (like a steroid hormone like testosterone); since hormones are nonpolar, they can pass directly through cell membrane into cytoplasm; hormone attaches to receptor protein to make receptor protein complex; receptor hormone complex travels to the nucleus where it acts as a transcription factor that upregulates and downregulates genes=cellular response.

Consider an asexually-reproducing animal that is 2n=8. Will there be any genetic variation among the offspring? Why or why not?

No because it will be an exact copy

Does each amino acid have only one codon that codes for it?

No, multiple codons can code for the same amino acid.

Given what you know about how chromosome behavior and movement during meiosis, think of another defect that could lead to similar results as in question

Non disjunction. Microtubules do not attach properly. Skipped checkpoints

What two very common and important molecules pass freely and easily across (through) a cell membrane? What is this kind of movement called?

Nonpolar molecules, CO2 and O2 because they are small and nonpolar. Called passive transport or simple diffusion.

What are the "nuclear localization signal* and the "ER signal sequence"? How do these serve as a molecular address? * also known as "nuclear localization sequence".

Nuclear localization signal: a short sequence of amino acids that serve as an address telling the cell the protein should be delivered to the nucleus.Usually found at the end. ER signal sequence: amino acid sequence which directs proteins into the lumen of the ER.

Imagine a cell-surface receptor protein (an integrin) is being newly synthesized. How can it get into the membrane that it will ultimately be a part of? Make a list showing the general steps required for the protein to go from its inception (DNA stage) to its final job site (membrane). Include the cellular components or organelles that are involved at each step.

Nucleus→Mrna→cytoplasm→roughER→ribosomes→translation→makes protein→golgi→packages into vesicle- cell membrane or diffused.

Hydroxyl

OH-

A signal transduction pathway usually has many steps. What are two advantages of having many steps instead of just a ligand, a receptor, and a response?

One advantage = multiple steps is the possibility of greatly amplifying a signal. If some of the molecules in a pathway transmit the signal to numerous molecules at the next step in the series, the result can be a large number of activated molecules at the end of the pathway. Having multiple steps also provides more opportunities for coordination and regulation of the cellular response.

What is significant about the transfer of electrons? Why is this important?

Oxidation and reduction always go hand and hand?? Not all redox reactions involve the complete transfer of electrons from one substance to another; some change the degree of electron sharing in covalent bonds????

What is the oxidized product of Pyruvate Oxidation? What is the reduced product of pyruvate oxidation? Where and how is C released during this step?

Oxidized product: NADH. Reduced product: Acetyl-CoA. Carbon is released as CO2

Why does the citric acid cycle stop under anaerobic conditions?

Oxygen is the final electron acceptor, so ox phone can't happen.

Phosphate

PO4 3-

What functional group is commonly used in cells to transfer energy from one organic molecule to another?

Phosphate

What is phosphorylation, and what protein facilitates it? What are its general effects, and how is it reversed?

Phosphorylation is the transfer of a phosphate group from ATP to some other molecule, such as the reactant. Protein kinase facilitates the addition of a phosphate group and it is reversed by phosphatase that take off a phosphate group. Adding a phosphate usually results in shape change and activation of the protein.

Within this organelle, in which structure does photosynthesis occur?

Photosynthesis takes place in the thylakoid membrane

The 3' end of a particular growth-factor mRNA makes it particularly unstable and prone to degrade rapidly

Post- transcriptional, short term.

Hormone response to hunger causes a phosphorylation cascade in a cell, resulting in activation of a particular enzyme

Post-translational, short term.

Describe the four levels of protein structure.

Primary- structure depends on covalent bonds. Secondary- structure resulting from hydrogen bonds, but not between members of the R-group side chains. Tertiary- structure resulting mostly from hydrogen bonds between elements of the R-group side chains. Quaternary- structure resulting from weak bonds between multiple polypeptides.

Outline the main points of the endosymbiont theory of the evolution of eukaryotes, and list the three lines of evidence for this theory that you think are most convincing.

Prokaryotes absorbed smaller cells and it was a mutually beneficial relationship and the cells eventually became organelles. This is where mitochondria and plastids came from, which descended from bacteria. Mitochondria and plastids share a lot of similarities with bacteria to prove this. They have similar enzymes and transport systems and replicate like bacteria. The ribosomes of them are more similar to that of bacteria than eukaryotic cells.

Ribosome function

Protein synthesis

All protein synthesis in cells occurs at what structure?

Protein synthesis occurs in the ribosome.

Proteins that contain the "ER signal sequence": (A) are initially made in the ER; or (B) are initially made at ribosomes.

Proteins that contain the "ER signal sequence" are initially made in the ribosome.

What is the oxidized product of Glycolysis? What is the reduced product of glycolysis?

Pyruvate and ATP are oxidized products. NAD is reduced product.

What enzyme is primarily involved in transcription?

RNA polymerase is the enzyme primarily involved in transcription

For questions 6 and 8, you listed two sources of genetic variation that occur during meiosis. What is a third source of genetic variation that occurs after meiosis?

Random fertilization

Describe why the reaction below is a redox reaction. Where do the electrons and H+ go after they leave the malate molecule?

Redox reaction is a type of chemical reaction were in one chemical losses electrons and other accepts it. They go to NAD+ and FAD and NADP.

What type of regulation is represented by this system, and why?

Regulation of how much tryptophan is in the cell is necessary for the cell to control enzyme production that occurs at the level of transcription.

Glucose and Fructose

Repressor active. Low levels of cAMP. CRP is not activated. Operon off.

Glucose only

Repressor active. Low levels of cAMP. CRP is not activated. Operon off.

Lactose and Fructose

Repressor inactive. High levels of cAMP. CRP is activated. Operon on.

Lactose only

Repressor inactive. High levels of cAMP. CRP is activated. Operon on.

Glucose and Lactose

Repressor inactive. Low levels of cAMP. CRP is not activated. Operon off.

Describe how scientists use enzymes to make recombinant DNA (the non-CRISPR way). In your description, tell where these enzymes originally come from - what is their actual function to the organisms that create them? And how have they been co-opted by humans to design gene constructs? In other words, how does the mechanism of these enzymes allow us to use them to make recombinant DNA?

Restriction enzymes are enzymes isolated from bacteria that recognize specific sequences in DNA and then cut the DNA to produce fragments called restriction fragments. Nuclease makes cuts in DNA and they use the overhang. Originally, restriction enzymes protect the bacterial cell by cutting up foreign DNA from other organisms or phages.

What causes the "rough ER" to be rough? (A) double membrane layer; (B) pores in its surface; (C) ribosomes on its surface.

Ribosomes on its surface cause the rough ER to be rough.

What evidence supports the double helix model of DNA structure?

Rosalind Franklin: Found the width of the helix and spacing of bases. Sugar-phosphate backbones were on the outside of the DNA molecule. X-ray data indicated the helix makes one full turn every 3.4 nm. Erwin Chargaff: The base composition of DNA varies from one species to another. James Watson and Francis Crick: Watson and Crick modeled the structure of DNA.

Think of entropy as a measure of molecular disorder, or randomness. In the list above which items seem to be increasing entropy, and which seem to be decreasing entropy? You'll need to have read 8.1 to make sense of this!

Rotting log - increasing in entropy. Growing log - decreasing in entropy.

Explain the differences between SEM (scanning electron microscopy) and TEM (transmission electron microscopy).

SEM studies the topography of a cell, The surface is coated in gold and a beam scans the pattern of the electrons. TEM studies internal structure. The atom is stained with heavy metals and then an electron beam scans them. However, both use electromagnets as lenses.

Compare the number of chromosomes in the first cell vs. the second cell in the image.

Same number of chromosomes

If you are designing a cloning vector, what are some features you would want to incorporate into it, in order for it to function for your purpose? For each feature you can think of, list what purpose that feature serves.

Selective marker (changing color), gene of interest, restriction enzyme, restriction site.

A cell must exchange substances with its surroundings. How does this influence the upper limit on cell size? And why can eukaryotes be successful with greater cell volumes than prokaryotes?

Since the plasma membrane functions as a barrier for the cell, the more surface are there is, the larger the cell can be. Metabolic requirements also impose limits on cell size.

The work of DNA replication is a complex job, requiring many steps. These steps are facilitated by proteins, most of which are enzymes. List 7 DNA replication proteins that function in E. coli, and briefly describe their roles in the process.

Single strand binding protein - stabilizing protein. Topoisomerase- Relieves strain caused by unwinding. Primase - Synthesizes Rna primers Helicase - Unwinds and separates the parental DNA. DNA polymerase III - completes synthesis DNA polymerase I - removes primer DNA ligase - joins ends 3' to 5'

Anaphase

Sister chromatids separate and are pulled to opposite ends of the cell. Microtubules are not attached to chromosomes elongate and push apart, separating the poles and making the cell longer.

What is a second messenger? What are a couple of very common second messengers in animals?

Small, water soluble molecules or ions, which rapidly relay the signal from the membrane-receptor-bound "first messenger" into a cell's interior. Second messengers participate in pathways initiated by both G protein-coupled receptors and receptor tyrosine kinases. Commonly used second messengers are cAMP and calcium ions.

If a cell's function was to make testosterone, which cellular component would you expect to find in abundance in this cell?

Smooth ER

Which organelle is mainly involved in the synthesis (condensation) of triglycerides (fats and oils)?

Smooth Endoplasmic Reticulum

4 stages of cellular respiration

Stage 1) GLYCOLYSIS: Glucose is partially oxidized forming two molecules of 3-carbon pyruvate. NAD+ is reduced to NADH. Reduced = gains an electron. Oxidized = loses an electron. Stage 2) PYRUVATE OXIDATION: One carbon molecule per pyruvate is released as CO2. NAD+ is reduced to NADH. Each pyruvate molecule is oxidized and united with coenzyme A, forming acetyl CoA. Stage 3) CITRIC ACID CYCLE: Acetyl CoA is fully oxidized to two molecules of CO2 each. NAD+ and FAD are reduced to NADH and FADH2. GTP is produced. Stage 4) OXIDATIVE PHOSPHORYLATION: NADH and FADH2 are oxidized to NAD+ and FAD. ATP is generated by chemiosmosis (via ATP synthase!).

Cytoskeleton function

Strength and support, movement of cellular structures and materials

What is the earliest fossil evidence of life on Earth?

Stromatolites, 3.5 BYA (pg. 532)

In your own words, describe why substances move down their concentration gradients.

Substances move down their concentration gradients, because if there are more molecules in the higher concentration regions, more molecules will be moving away from the higher concentration regions.

ATP can be generated by the following: a) substrate-level phosphorylation, b) oxidative phosphorylation, or c) photophosphorylation. List where and when each of the three processes can occur.

Substrate level - CYTOPLASM A smaller amount of ATP generated is formed directly in a few reactions of glycolysis and the citric acid cycle by a mechanism. Oxidative - electron transport chains convert the chemical energy to a form used for ATP synthesis in the process called chemiosmosis. Photophosphorylation - THE CHLOROPLAST phosphorylation of ADP to form ATP using the energy of sunlight.

Why does sweating help you cool off?

Sweat cools you down because when it evaporates, it takes energy from your skin.

Predict how life on earth would be different if water were less polar. Which one of the following would result if organisms lived in and consisted of a less polar medium than water?

Sweating would be less effective means of keeping cool

Smooth endoplasmic reticulum function

Synthesis of lipids, metabolism of carbohydrates, Ca2+storage, detoxification of drugs and poisons.

How does telomerase insure that germ-line cells do not suffer from the automatic shortening of each chromosome that happens each generation? In your answer, make sure to describe what telomeres are and why they are necessary.

Telomeres prevent staggered ends from triggering damage signals and act as a buffer zone. If there was no telomeres genetic information would be affected.

State the difference between the "template strand" and the "coding strand"

Template strand: 3' to 5' direction. Template strand acts as a template for transcription and codes for RNA. Coding strand: 5' to 3' direction. Coding strand specifies the amino acid sequence.

In humans, blood pH is around 7.4, and a decrease in blood pH to 6.4 would be fatal. A drop by 1 pH unit represents which of these?

Ten times as many H+ atoms in the solution.

Tell in which organism the CRISPR-Cas9 system evolved, and what the benefit of this system is to that organism.

The CRISPR-Cas9 system evolved from bacteria as an immune defense.

In your drawing above, draw a circle to represent where General Transcription Factors would bind, and another where Specific Transcription Factors would bind. Label each with either GTF or STF.

The GTF will bind onto the promoter. The STF will bind onto the distal control elements.

List all the places one might find DNA in a plant cell. Explain the results using endosymbiotic theory.

The Nucleus, mitochondria, and chloroplasts. Mitochondria and Plastids are thought to be decendants of bacterial cells, so that's why they still have the necessary cellular machinery to process DNA.

What does it mean for something to be reduced?

The addition of electrons to another substance Gains electrons, and protons Ex) NAD+ - NADH

How does the amount of DNA compare between G1 and G2?

The amount of DNA (chromatids) doubles in G2 phase

A calorie is defined as

The amount of heat energy required to raise the temperature of 1 gram of water by 1 degree Celsius.

Given what you know about receptors and signal transduction pathways, outline a scenario in which a few ligand molecules might be responsible for two or more simultaneous, complex cellular reactions (see fig. 11.8).

The binding of a ligand to a receptor tyrosine kinase complex can activate many different transduction pathways and cellular responses. This is a key difference between receptor tyrosine kinases and G protein-coupled receptors. Ligands bind to RTKs (Receptor tyrosine kinases) and the RTKs attract each other and phosphorylate their respective tyrosine kinase on the opposite RTK. The multiple phosphorylated tyrosine kinases are recognized by proteins in the cell and set of multiple signal transduction pathways.

5' caccatggtgcatctgactcctgaggagaagtctgcctag3' 3' gtggtaccacgtagactgaggactcctcttcagacggatc 5' Which strand in the above double stranded DNA molecule is the TEMPLATE strand? How do you know?

The bottom strand is the template strand because it is 3' to 5'. The top strand is the coding strand because it is 5' to 3' and it has the ATG start codon in it.

What is the lowest level of biological organization that can perform all the activities required for life?

The cell

Telophase

The cell is nearly done dividing and it starts to re-establish its normal structures as cytokinesis takes place. The mitotic spindle is broken down into its building blocks. Two new nuclei form, one for each set of chromosomes. Nuclear membranes and nucleoli reappear. The chromosomes begin to decondense and return to their stringy form.

What are the benefits of having compartments within cells?

The cell's compartments provide different local environments that support specific metabolic functions, so incompatible processes can occur simultaneously in a single cell.

Prometaphase

The chromosomes finish condensing so they are very compact. Centrosomes are located outside the nucleus. The nuclear envelope breaks down releasing the chromosomes. The mitotic spindle grows more, and some of the microtubules start to capture chromosomes.

Use Fig 16.14 to explain what is meant by "Each strand of DNA has directionality".

The direction of the DNA strand is determined by the orientation of the phosphate bond.

How does ATP differ as an energy-coupling molecule from the Initial Electron Acceptors of respiration?

The electron acceptor gain or lose electrons, but adding and taking away a phosphate has nothing to do with the electrons.

Which of the following hypothetical changes in a water molecule would tend to make it more polar?

The electronegativity value for O is increased.

Explain the endosymbiont theory including the origin of mitochondria and chloroplasts

The endosymbiotic theory states that some of the organelles in today's eukaryotic cells were once prokaryotic microbes. Mitochondria formed when bacteria capable of aerobic respiration were ingested; chloroplasts formed when photosynthetic bacteria were ingested. They eventually lost their cell wall and much of their DNA because they were not of benefit within the host cell.

Describe how form and function of a lysosome are connected.

The external membrane allows molecules inside of the lysosome without allowing the digestive enzymes to escape into the cell. Which allows it to continue its job as a floating trash bag.

Why is it advantageous for macrophages and other phagocytic cells to have a flexible cell shape and a dynamic cytoskeleton?

The flexible cell shape helps defend the body by engulfing and destroying bacteria and other invaders.

How is the structure of a lymphocyte specific for its function?

The flexible structure of the lymphocyte enables it to recognize and respond to pathogens quickly.

What is the formula for the photosynthesis reaction, i.e. it's reagents and its products?

The formula is 6CO2+6H2O=6O2+C6H12O6+energy

What do the proteins encoded by the genes of the trp operon do?

The genes in trp operon code for enzymes needed for tryptophan synthesis.

What is meant by the phrase "The genetic code has redundancy but not ambiguity"?

The genetic code has redundancy because more than one codon can code for the same amino acid, but there is no ambiguity because one codon wont code for more than one amino acid.

When most liquids freeze, they become more dense, and therefore they sink. What is it about frozen water that enables it to float? Imagine if ice did not float. What would be two consequences?

The hydrogen bonds create crystalline lattice (keeping them far apart). This causes solid ice to be less dense than liquid water. If ice did not float, bodies of water would freeze from the bottom up and life would not exist.

Explain the role of polarity in the creation of cell membranes.

The hydrophilic polar heads face out towards the water and the hydrophobic non-polar tails face inward and form the membrane.

Imagine that the fragment of newly-synthesized DNA you drew is the "leading strand". On the same drawing, make a line indicating the "lagging strand". Will the lagging strand be synthesized 3'-5', or 5'-3'? Will it be synthesized in the same physical direction of the leading strand that you drew?

The lagging strand goes from 3' to 5' however, it's in the opposite direction of the unzipping so it is done slower and in fragments.

Describe intracellular digestions

The lysosome goes through phagocytosis when it ingests materials in the cell and then continues the digestion process by disposing of them.

If a signal transduction pathway ends in a change in gene expression, where must the message ultimately be carried? What class of protein is going to be the final one to be affected, in order to lead to a difference in gene expression (think of your answer for question 8)?

The message must ultimately be carried to the nucleus where mRNA is transcribed. Transcription factors will be the proteins affected. They are the proteins that will decide which genes will be inhibited or prohibited, and the inhibited ones will be transcribed into mRNA

Imagine a small ion with a hydroxyl side chain. What kind of protein helper would it require to allow it to get from inside one cell and into another cell? Do you think this would require ATP energy? Explain why you said either yes or no. If it does not take ATP energy, what is this kind of transport called?

The molecule is polar and hydrophilic. Channel. It would require facilitated diffusion (passive transport) if abundant inside the cell (flows from external to internal) from low to high concentration. This would not require ATP energy.

he nuclear localization signal is which? (A) part of the ribosome; (B) part of the protein; (C) part of a separate enzyme system in the cytosol.

The nuclear localization signal is a part of the protein.

Mitochandria

The part of the cell that converts food to energy.

What is "free energy"?

The portion of a system's energy that can perform work when temperature and pressure are uniform throughout the system, as in a living cell.

Do the products have more free energy or less free energy than the reactants?

The products have more energy than the reactants

Within a plant cell, which organelle is responsible for photosynthesis?

The products of the light stage are ATP and NADPH

The chemical equilibrium between carbonic acid and bicarbonate acts as a pH regulator in our blood. If the blood pH begins to rise, what will happen?

The reaction proceeds to the right; more carbonic acid dissociates.

In your own words, describe what is meant by a "reading frame" in a DNA or mRNA sequence.

The reading frame is the triplet of amino acids transcribed during polypeptide synthesis. It is established by the start codon.

Imagine a hydrophilic protein that acts as a ligand. Where would the receptor for this ligand be?

The receptor would be in the plasma membrane because the hydrophilic protein would not be able to pass through the membrane.

When is lacL expressed? What protein does it encode?

The regulatory gene, lacI, located outside the lac operon, codes for an allosteric repressor protein that can switch off the lac operon by binding to the lac operator.

In the RNA sequence you just wrote, underline the start codon.

The start codon is AUG in RNA. ATG in DNA.

What provides the additional energy for this reaction to move forward?

The sun provides the energy for photosynthesis

What is it about the structure of ATP that makes it hydrolysis release so much energy?

The three negatively charged phosphate groups act like a spring when hydrolysis breaks up ATP.

What is a redox reaction?

The transfer of one or more electrons from one reactant to another. One loses electrons

Why is the lac operon turned on in the presence of lactose, while the trp operon is turned off in the presence of tryptophan?

The trp operon is considered a repressible operon because transcription is usually on but can be inhibited by tryptophan. Whereas the lac operon is considered an inducible operon because transcription is usually off but can be induced by lactose.

A particular species of sunflower can grow at a higher elevation than most sunflowers, and its oil is highly prized for its healthful benefits. What do you think might be so special about the oil, and how is this an adaptation to its environment?

Their percentage of unsaturated phospholipids increases in autumn so that its membrane won't solidify. This is an adaptation to its environment since it helps the membrane lipids to maintain its fluidity.

What do all lipids have in common?

They are all Hydrophobic

What are the special relationships between G and C, and A and T?

They bond together, Purines and Pyrimidines

Where did the monomers for building these macromolecules come from?

They come from the anticodons in the tRNA.

Consider a cell for which the cohesins of chromosome #1 do not break down as they should. What is a potential outcome for the resulting gametes?

They have an incorrect number of chromosomes at the end.

What are some ways in which a cell could divide in the absence of the normally-required growth factor?

They may make a required growth factor themselves, have an abnormality in the signaling pathway, or an abnormality in cell cycle control system caused by a change in one or more genes (like in p53).

Sometimes molecules are moved against their concentration gradients, accumulating on one side or the other of the cell membrane. What is this type of movement called? What kind of protein helper is required?

This is called active transport and is performed by protein pump or channel. ATP.

What is the membrane of this internal structure called?

Thylakoid membrane

How has the CRISPR-Cas9 system been co-opted by humans for our own purposes?

To correct mutations to protect from genetic diseases.

What is the function of cellular respiration?

To make ATP

What is the function of a buffer in biological systems?

To minimize the changes in concentration of H+ and OH- in a solution. Maintaining pH.

Transcription factors are essential to eukaryotes. What basic role do transcription factors play in the life of a cell?

Transcription factors play a role in gene regulation. They control which genes are turned on, which are the ones that will be transcribed into mRNA.

Gene is expressed only in flowers and not in fruits

Transcription level, long term.

Proteins are made only when light is available

Transcription level, short term.

In your own words, describe what is meant by "energy coupling".

Transfer of energy from an exergonic process to an endergonic process.

Vesicle function

Transport and store substances within a cell from one cell to another.

Compare the amount of DNA in the first cell vs. the second cell in the image.

Twice as much DNA

How do we observe this difference in our everyday lives (ex. when you are cooking).

Unsaturated fat is liquid at room temp (ex: vegetable oil vs. butter).

What organelles would you expect to find abundant in lymphocytes?

Vacuoles

G2 checkpoint

Was DNA replicated correctly? Is the cell large enough?

Does water pass freely through a cell membrane? In what way does a cell increase the rate of flow of water from one side of the membrane to another? What is this kind of movement called?

Water can pass through the membrane, but slower than nonpolar molecules. To speed up this process, the water passes through transport proteins, specifically, aquaporins. This is a type of passive transport called facilitated diffusion.

In your own words, what is water potential, and why does the water potential of a solution go down when more solutes are added?

Water potential is free water that is not bonded to anything. The water potential decreases when more solutes are added because there less is room for the water to move around

What happens in water to create H3O+ and OH-? What are the names of these ions?

When a hydrogen atom shifts from one water molecule to another, a single proton with a charge of +1 is transferred creating the molecules OH- and H3O+, known as hydroxide ion and hydronium ion.

Explain the differences between white light (brightfield) and fluorescence microscopy.

White light or brightfield microscopy occurs when light passes directly through the specimen. Staining can be used to increase visibility. Fluorescence is when the cell is stained with fluorescent dyes and then the fluorescent substances absorb UV radiation and emit visible light.

What in a redox reaction, which reagent is the reducing agent, and which is the oxidizing agent?

Xe-, the electron donor is reducing. Y, the electron acceptor, is the oxidizing agent.

Is glucose soluble in water?

Yes

ion

a charged atom with a different number of electrons than the uncharged form

Phospholipids

a lipid consisting of a glycerol bound to two fatty acids and a phosphate group.

Give two examples of different kinds of potential energy

against gravity, chemical bonds.

atom

building block of all molecules

Sulfydryl

-SH

In a forest, where might you most likely to find the following carbohydrates, and what purpose would they be serving?

A: chitin - in bugs (arthropods?), exoskeleton of bugs, cell wall of fungi B: starch - roots of plants C: cellulose - structural polysaccharide in plant cell walls D: glycogen - stored polysaccharide in animal livers

The two purines are

Adenine and Guanine

When speaking of DNA and RNA, what do A, T, G, C, and U refer to?

Amino acids

Which way is DNA synthesized during DNA replication?

DNA is synthesizes in the 5' to 3' direction.

Explain why DNA replication ONLY happens in a 5' to 3' direction.

DNA only occurs in the 5' to 3' direction because DNA polymerase requires a 3' hydroxyl group to attach to the new nucleotide.

Mistakes in DNA replication occasionally happen, but the mutation rate is quite low. List 3 ways in which mistakes are corrected, keeping the mutation rate low.

DNA polymerase III proofreads. "Mismatch repair" enzymes scans DNA. "Nucleotide Excision Repair" cuts out damaged bases with a string of nucleotides.

When, during the cell cycle, does production of cyclin really increase?

G2

Sexual reproduction is clearly time-consuming, takes energy, and is sometimes dangerous! Explain the main evolutionary advantage to sexual vs. asexual reproduction.

Genetic variation

According to the mini-lecture on Canvas, what the three "stories" or "themes" of cellular respiration?

Glycolysis Citric acid cycle ETC

Explain how emergent properties of living organisms such as growth and development emerge from and depend upon interactions of elements at different levels of biological organization.

Growth and development are both emergent properties that are controlled by genes. However, development may refer to something "changing" while growth refers to "growing". Ex: development would refer to an egg developing into a chick, while growth would refer to a chick growing into a chicken .

Describe How Cancer Could Result From Genetic Changes In A)a growth factor gene, orb)tumor-suppressor gene. What fundamental difference would there be between these two changes, even though the result (cancer) is the same?

Growth factor - there only has to be one over active growth factor. Tumor suppressor - both tumor suppressors must be whack.

List four external requirements for a cell to get passed the G1 checkpoint.

Growth factor, nutrients, anchorage dependence, and density dependence.

Our blood has a carbonic acid / bicarbonate ion buffering system. Given that carbonic acid is H2CO3, what is the base?

HCO3- known as bicarbonate

The image below depicts a source of genetic variation that is called

Independent Assortment

How does the number of chromosomes compare between G1 and G2?

It does not change

What is the name of the coenzyme that functions as the initial electron acceptor (IEA)

NADH

What carriers bring electrons (as part of H atoms) into the electron transport chain?

NADH, FADH2

List two other IEAs found in respiration and photosynthesis.

NADP, NAD+

What is the final acceptor of electrons in the electron transport chain?

Oxygen

What is the difference between phagocytosis and pinocytosis?

Phagocytosis engulfs particles whereas pinocytosis gulps droplets of extracellular fluid

Is photosynthesis an exergonic or an endergonic reaction?

Photosynthesis is considered endergonic (because it must first take energy from its surroundings).

Given the 2nd law of thermodynamics, what kinds of reactions are favored? In other words, what is a "spontaneous" reaction?

Spontaneous reaction does not require energy in order to happen. Happens on its own.

In your own words, describe "activation energy".

The energy required to start a reaction.

What is membrane potential? Name the two kinds of gradients that form the membrane potential.

The opening of an ion channel and the movement of ions. Stimulus

Does the repressor bind to the operator in the presence or absence of tryptophan?

The repressor binds to the operator in the presence of tryptophan.

Beginning with the start codon use lines to section your RNA into codons.

caccaug-gug-cug-acu-ccu-gag-gag-aag-ucu-gcc-uag

Transcribe the coding strand into RNA (just a straight translation, not using complementary base pairing)

caccauggugcugacuccugaggagaagucugccuag

List these things in order of "less order/energy" to "more order/energy".

carbon atom, glucose, chloroplast, rotting log, growing tree

Why are human enzymes that digest starch unable to digest cellulose?

cellulose has beta-galactoside linkages that only beta-galactosidases bacteria can cleave.

The four emergent properties of water that are important for life are:

cohesion, moderation of temperature, expansion upon freezing, and solvent properties.

What is entropy?

disorder

The part of the atom that mainly determines how the atom reacts with others is the __________

electron

What are the monomers of glycogen?

glucose

Compared to a carbon atom with only single covalent bonds, a carbon with a double bond

is more polar

What proteins do lacZ, lacY, and lacA encode? What are their functions?

lacZ: encodes B-Galactosidase. Splits lactose. lacY: encodes permase. Imports lactose. lacA: encodes Transacetylase. Transfers an acetyl group.

What macromolecule is synthesized in transcription?

mRNA is synthesized during translation

In which direction (3' to 5' or 5' to 3'?) is mRNA synthesized?

mRNA is synthesized from 5' to 3' direction.

What macromolecule provides the information in translation?

mRNA provides the information in translation

Plants make beta glucose to:

make cellulose

Plants use alpha glucose to:

make starch

What is the 1st law of thermodynamics?

matter cannot be created or destroyed, but can be transformed.

Use the genetic code provided below to translate the RNA into protein.

met val leu thr pro glu glu lys ser ala stop

Given a chemical formula for an organic molecule (ex: C6H12O6) one can usually deduce its:

molecular weight and solubility in water

Consider a sexually-reproducing plant that is 2n=8. When sperm are made in this plant, how many different possible combinations of maternal and paternal chromosomes can there be among the gametes?

n^4 so 2^4= 16

electron

negatively-charged particle that orbits around an atom in a cloud

neutron

non-charged particle found in the nucleus of an atom

Water is polar because of the presence of ______ bonds.

polar covalent

What are the two greatest determining factors that govern whether a molecule will be able to pass freely across a membrane?

polarity and size

Explain how an enhancer region can affect gene regulation for a gene that is far away - even thousands of bases upstream or downstream from the gene.

protein-mediated bending of the DNA is thought to bring the bound activators into contact with a group of mediator proteins, which in turn interact with general transcription factors at the promoter. These protein-protein interactions help assemble and position the initiation complex on the promoter, and allow the promoter and enhancer to come together in a very specific fashion, in spite of what is often a large number of nucleotide pairs between them.

What are some different forms of kinetic energy?

radiant, thermal, sound, electrical, and mechanical

What is the function of photosynthesis

to make ATP

Why is there smooth ER in the liver?

to process lipids

molecule

two or more atoms connected with a strong bond

What determines whether or not ATP can be used to power a particular chemical reaction? In other words, what is the rule regarding delta G?

∆G must be negative for a reaction to be spontaneous. If ∆G is zero or positive, the reaction is not spontaneous.