LS3 MIDTERM 2 QUESTIONS

You are testing out an RNA Polymerase you have isolated, however you only get short aborted transcripts. Which option below best fits this scenario: A) The complex contains no sigma factor B) The sigma factor cannot disassociate from the core of the polymerase C) The RNA polymerase cannot form a functional holoenzyme D) The sigma factor subunits are not recognizing the promoter

B) The sigma factor cannot disassociate from the core of the polymerase

A major event during transcription initiation is the unwinding of the DNA double strand at the promoter. Which sequence feature would you expect to be most likely at promoter regions? A. GC rich c C. AG rich D. TC rich E. Even distribution of A/T and G/C

B. AT rich

which one of the following mRNA sequences could encode for the peptide Met-Ala-His-Ser? A. AUGAAUCACUCU B. AUGGCUCACAGC C. UCUCACGCUAUG D. AUGAAUCAUUCA

B. AUGGCUCACAGC

Which of the following materials are not needed to perform a PCR reaction? A. DNA polymerase B. An RNA template C. A DNA template D. Free nucleotides E. Two different primers

B. An RNA template

Transcription would initiate if TFIIH had a mutation rendering its helicase activity non-functional. A. True B. False

B. False

After exposure to UV light, cells from an XP patient would contain ________ ssDNAs than cells from a healthy patient. A. More B. Less

B. Less

What repairs ethidium bromide intercalation? A. MMR B. NER C. BER D. NHEJ E. HDR

B. NER

In the Sanger sequencing method, the use of dideoxy adenosine triphosphate stops nucleotide polymerization opposite A. A's in the template strand. B. T's in the template strand. C. G's in the template strand. D. C's in the template strand. E. any base selected randomly in the template strand.

B. T's in the template strand.

Why are ddGTPs added at a 1:100 ratio to dGTPs? A. To terminate the reaction every ~100 bases B. To terminate there action every ~100th time a Guanine is in the sequence C. To provide energy for there action D. All of the above

B. To terminate the reaction every ~100th time a Guanine is in the sequence

Which of the following reactants is specific to DNA sequencing in contrast to PCR? A. Primer B. ddNTP C. DNAPolymerase D. Template

B. ddNTP

A single STR may differ between two unrelated people by... A. Sequence B. Length C. Location in the genome D. Sequence and length

B. length

The role of dideoxynucleotides in Sanger sequencing is the: A. removal of specific bases from DNA. B. termination of DNA synthesis at specific bases. C. addition of specifically labeled phosphates to the DNA. D. detection of protons during DNA synthesis. E. inhibition of restriction enzyme activity.

B. termination of DNA synthesis at specific bases.

which dna repair mechanism repairs deaminated cytosines

BER

Dr. Dre discovers life on Mars and wants to study how a Martian organism packages DNA. He first notes that Martian DNA is positively charged. Based on this information, which of the following characteristics of Martian histone tails should he expect? (Y if he should expect them, N if he should not): Basic: Acidic: Positive: Negative:

Basic: N Acidic: Y Positive: N Negative: Y

Why does TBP show such a strong preference to T:A regions? A) T:A base pairs are smaller than G:C base pairs B) T:A base pairs bind phenylalanine better C) T:A base pairs are easier to distort D) T:A base pairs bind TBP better

C) T:A base pairs are easier to distort

How many of the following statements are true? •HDACs indirectly recruit proteins with chromodomains • HATs unmask the positive charge of lysines •proteins with bromodomains help make euchromatin •HDACs acetylate lysines •methyl transferases mask the positive charge of lysines •methylated lysines recruit proteins with chromodomains •HATs indirectly recruit proteins with bromodomains A. 1 B. 2 C. 3 D. 4 E. 5

C. 3 •proteins with bromodomains help make euchromatin •methylated lysines recruit proteins with chromodomains •HATs indirectly recruit proteins with bromodomains

What repair mechanism requires a glycosylase enzyme? A. MMR B. NER C. BER D. NHEJ E. HDR

C. BER

What repairs spontaneous base hydrolysis? A. MMR B. NER C. BER D. NHEJ E. HDR

C. BER

which of the following polypeptide sequences will be made from the RNA sequence shown, translating from the first start codon to the stop codon? 5′- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUU,.UU - 3' A. Arg-His-Ala B. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly-Tyr-Pro-Phe C. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly D. Met-Pro-Lys-Ile

C. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly

In a typical PCR A. The concentration of Taq polymerase decreases with every cycle of the PCR B. The concentration of Taq polymerase increases with every cycle of the PCR C. The concentration of Taq polymerase stays the same with every cycle of the PCR

C. The concentration of Taq polymerase stays the same with every cycle of the PCR

describe methylation

Catalyzed by DNA methyltransferases, has no effect on the charge of histone tails, recruits chromo-domain-containing proteins which manipulate histones/nucleosomes to repress gene expression, promotes heterochromatin

Describe acetylation

Catalyzed by HATs and reversed by HDACs, reduces the positive charge of histone tails and thus the interaction between DNA and histone tails, recruits bromo-domain-containing proteins which manipulate histones/nucleosomes to activate gene expression, promotes euchromatin

What is the correct order of the steps of transcription initiation? 1. Unwinding DNA (open complex) 2. Release sigma, promoter escape 3. Binding RNA polymerase holoenzyme to promoter (closed complex) 4. Initiation of transcription A. 1,3,4,2 B. 3,1,2,4 C. 1,3,2,4 D. 3,1,4,2

D. 3,1,4,2

_________ alter(s) the charge of histone tails to make them __________ A. HDACs/less positive B. phosphorylation/more positive C. methylation/more positive D. HATs/less positive

D. HATs/less positive

what dna lesion does the mutagen ethidium bromide create?

DNA intercalaion: usually creates insertions/deletions/point mutations leading to a protein frameshift mutation (DNA polymerase can't properly replicate intercalated DNA)

describe the sanger sequencing reaction?

DNA is synthesized using the primer and dNTPs. Every once in a while a ddNTP is incorporated. After ddNTP incorporation, no additional nucleotides can be added due to the lack of the 3' OH group, terminating this fragment. This way, a number of fragments with different lengths are generated.

what are the components of sanger sequencing reaction?

DNA polymerase, one primer, a template, dNTPs, dye labelled ddNTPs (1:100 ddNTP to dNTP ratio)

In EK, the TATA box is a critical element of the transcription terminator sequence (T/F)

F - TATA box is a critical element of EK promoters, and the poly A signal sequence is an important DNA sequence involved in EK transcription termination

each prokaryotic transcript contains exactly one protein coding gene (T/F)

F - in PK we often find polycistronic operons which involve a single promoter controlling the expression of a group of genes related in a pathway

Prokaryotic RNA polymerase binds to the -35 and -10 region of the promoter. (T / F)

F - it is sigma factor that recognizes and binds these sequences

what is the function of HATs?

HATs acetylates lysine residues on histone tails which shields the posi3ve charge of lysines. This action makes the histone tails less positive and hence less tightly associated to the negatively charged DNA. HATs work to increase gene expression by loosening the DNA around nucleosomes so that local genes can be expressed.

what is the function of HDACs?

HDACs counteract the action of HATs by removing the acetyl groups that HATs add to lysine residues. They restore/increase the positive charge of histone tails and therefore increase the attraction of DNA to histone tails. HDACs work to decrease gene expression by keeping DNA tightly wound around nucleosomes so that local genes will not be expressed.

which dna repair mechanism repairs double strand breaks without introducing errors?

HDR

DNA polymerase incorporates a guanine instead of an adenine in an E.coli cell Which DNA repair pathway would the cell utilize to repair this mutation

MMR

which dna repair mechanism repairs mistakes made by dna polymerase?

MMR

which dna repair mechanism repairs lesions caused by ethidium bromide intercalation into dna

NER

which dna repair mechanism repairs thymine dimers?

NER

which dna repair mechanism repairs double strand breaks while introducing errors?

NHEJ

What factor controls the shift between closed and open complex formation for transcription in prokaryotes and eukaryotes?

Sigma factor performs this function in PKs, while TFIIH performs this function in EKs. ATP energy is required for open complex formation in EKs, but not PKs

+1 represents the transcription start site in both PK and EK (T/F)

T

rho dependent termination requires energy in form of ATP (T/F)

T

the first general transcription factors to bind eukaryotic promoters consist of a complex containing __ and __ . The specific part of the promoter region this complex binds is called __. The last of the general transcription factors to localize to the the promoter region is __.

TFIID TBP TATA box TFIIH

How is the result of sanger sequencing interpreted?

The fragments that are generated during the reaction will be run on a capillary gel electrophoresis. Each one ends with a ddNTP that is dye labeled - color coding the last nucleotide that was added. The colors and therefore nucleotide sequence is read out by an automated sequencer

bromodomain

a common domain found in chromatin remodeling proteins that make DNA more decondensed/euchromatin-like. The bromodomain component of such proteins recognizes and binds to acetylated lysines on histone tails to help remove DNA wrapped around nucleosomes

chromodomain

a common domain found in chromatin remodeling proteins that make DNA more more condensed/heterochromatin-like. The chromodomain component of such proteins recognizes and binds to methylated lysines on histone tails to help keep the DNA tightly wrapped around nucleosomes and other higher order chromatin remodeling proteins.

nucleosome

a complex of eight histone proteins that DNA is wrapped around

somatic cell

a fully differentiated cell (e.g muscle cells, neurons, etc.) Somatic cells have specific pakerns of euchromatin/heterochromatin representative of what genes are expressed/not expressed in these cells. Somatic cells have a lot more heterochromatin than stem cells because they express a particular subset of genes and condense genes that are not needed into heterochromatin

histone

a protein subunit of a nucleosome.

The nucleophile of the first step of spliceosome-mediated pre-mRNA splicing is the: a. 2′ hydroxyl of the branch point adenosine. b. 3′ hydroxyl of a free guanine nucleotide. c. 3′ hydroxyl of the 5′ splice site exon. d. 2′ hydroxyl of the 3′ splice site intron.

a. 2′ hydroxyl of the branch point adenosine.

How do the following protein modifications—acetylation, phosphorylation, and methylation—usually change the net charge on the surface of a modified histone? a. Acetylation neutralizes the charge; phosphorylation adds negative charge; methylation causes no change. b. Acetylation of lysine residues can alter the net charge by creation of an amide linkage. Methylation of lysine generally does not remove the positive charge of the terminal amino moiety, although it can alter the pKa of the group. c. Acetylation neutralizes the charge; phosphorylation adds negative charge; methylation adds positive charge. d. Acetylation neutralizes the charge; phosphorylation adds negative charge; methylation neutralizes the charge. e. Acetylation adds positive charge; phosphorylation adds negative charge; methylation causes no change.

a. Acetylation neutralizes the charge; phosphorylation adds negative charge; methylation causes no change.

What would be the consequences of a C-to-G mutation in the third position of the anticodon of tRNAAla? a. The mutant tRNAAla would insert Pro residues at codons that specify Ala. b. The mutant tRNAAla would insert Arg residues at codons that specify Ala. c.The mutant tRNAAla would insert Ser residues at codons that specify Ala. d. The mutant tRNAAla would insert Thr residues at codons that specify Ala.

a. The mutant tRNAAla would insert Pro residues at codons that specify Ala.

Addition of a benzopyrene adduct is the result of what type of reaction? a. alkylation b. hydrolysis c. depurination d. oxidation e. radiation

a. alkylation

Pre-mRNA splice sites are recognized by the spliceosome through: a. base pairing with snRNAs. b. the specific distance of the intron from the mRNA 5′ cap. c. site-specific recognition by the Sm proteins. d. RNA hairpin recognition.

a. base pairing with snRNAs.

Proteins that bind to acetylated lysine residues in the histone tail contain: a. bromodomains b. DNA-binding domains c. chromodomains d. kinase domains e. histone-fold motifs

a. bromodomains

In PCR, _______ creates single-stranded DNA template molecules. a. heat b. high salt concentration c. DNA polymerase d. exonuclease e. a primer

a. heat

The splicesome includes both protein and a functional type of RNA known as: a. small nuclear RNAs (snRNAs). b. micro RNAs (miRNAs). c. transfer RNA (tRNA). d. small interfering RNAs (siRNAs). e. ribosomal RNAs (rRNAs).

a. small nuclear RNAs (snRNAs).

The sequence of the consensus -10 region is TATAAT. Two genes, tesA and tesB, have identical promoter sequences except in the -10 region, where the tesA sequence is TAATAT and the tesB sequence is TGTCGA. Assuming the two genes use similar modes of transcription initiation, which gene would you expect to be more efficiently transcribed, and why? a. tesA will be more efficiently transcribed. The tesB -10 sequence deviates more from the consensus sequence and its higher G/C content will be more difficult to melt. b. tesB will be more efficiently transcribed. The tesB -10 sequence maintains the position of T in the 1 and 3 positions of the consensus sequence, which is paramount for promoter recognition. c. Both genes will be transcribed with equal efficiency. It is the -35 sequence that dictates the efficiency of transcription, not the -10 sequence.

a. tesA will be more efficiently transcribed. The tesB -10 sequence deviates more from the consensus sequence and its higher G/C content will be more difficult to melt.

Differential RNA processing may result in: a. the production of two proteins with different activities from a single gene. b. the production of the same protein from two different genes. c. a shift in the ratio of mRNA produced from two adjacent genes. d. inversion of certain exons in the mature mRNA.

a. the production of two proteins with different activities from a single gene.

A PCR cycle consists of a. three steps, denaturation, primer annealing, and elongation b. three steps, denaturation, initiation and elongation c. four steps, denaturation, initiation, elongation, and termination d. four steps, primer annealing, initiation, elongation, termination

a. three steps, denaturation, primer annealing, and elongation

micrococcal nuclease

an enzyme that degrades any DNA that is not protected by being wrapped around proteins such as nucleosomes. It is an exo/endo nuclease, meaning it universally degrade unprotected DNA

stem cell

an undifferentiated cell with the potential to become any cell type. Stem cells will have a much higher ratio of euchromatin to heterochromatin compared to somatic cells because they have the ability to express genes necessary for any cell type. As stem cells become differentiated into a particular cell type, they will condense the parts of their genome they don't need into heterochromatin. Imagine a cell differentiating into a muscle cell that needs to shut off gene expression specific for other cell types by condensing these regions of their genome into heterochromatin

A PCR reaction that continues for 5 cycles will produce approximately how many PCR products from a single template DNA molecule? a. 10 b. 32 c. 1024 d. approximately 1 million

b. 32

Replacing Arg in a histone with a neutral amino acid would make the histone _______ positively charged, and _______ likely to bind to DNA. a. A=U b. A=T c. G=C d. G=T

b. A=T

Which of the following is NOT required for a PCR reaction? a. A thermostable DNA polymerase b. Dideoxy-NTPs (ddNTPs) c. Primers d. Template DNA

b. Dideoxy-NTPs (ddNTPs)

Which statement about pre-mRNA splicing is false? a. It is directed by consensus sequences. b. It is common in prokaryotes. c. It is performed by small nuclear ribonucleoprotein (snRNP) particles. d. It removes introns in eukaryotic genes. e. It shortens the RNA molecule.

b. It is common in prokaryotes.

The calcitonin gene can encode either the hormone calcitonin or a protein called calcitonin-gene-related peptide depending upon which 3' cleavage site is used. In the thyroid gland, cleavage and polyadenylation occurs after the 4th exon leading to calcitonin production. However in the brain, the exact same transcript is cleaved after the 6th exon yielding calcitonin-gene-related peptide. This is an example of: a. Alternative splicing b. Multiple 3' cleavage sites c. Intron splicing d. Environmental influence e. Mutation

b. Multiple 3' cleavage sites

Which of the following techniques is used to test for genetic diseases such as fragile X syndrome?RNA-Seq a. FISH b. PCR c. Western blotting d. immunoprecipitation

b. PCR

Many bacteria, including E. coli, are capable of growing under both anaerobic and aerobic conditions. Some mutations are introduced into an E. coli strain that inactivate several enzymes involved in DNA repair. The mutant strain grows normally when kept in an incubator with a 100% nitrogen gas atmosphere. However, the strain dies when exposed to a normal laboratory atmosphere. Why? a. Nitrogen stabilizes the enzymes responsible for DNA repair, while oxygen destabilized these enzymes. b. Reactive oxygen species generated during normal aerobic metabolism form free radicals and are a major source of DNA damage. c. The mutations introduced into the E. coli strain also affected enzymes required for aerobic respiration. d. Deamination of cytosine, which introduces mismatched nucleotides, occurs at a higher frequency in aerobic conditions as compared to anaerobic conditions.

b. Reactive oxygen species generated during normal aerobic metabolism form free radicals and are a major source of DNA damage.

List cis elements for EK

- TATA box - upstream sequences (proximal promoter elements and distal promoter elements including enhancers and insulators)

List trans elements for EK

- TFIID - TBP - TFIIH - RNA polymerase II - Mediator - DNA bending proteins activators - repressors

List cis elements for PK

-35/-10 box upstream sequences (also called UP elements)

DNA polymerase incorporates a guanine instead of an adenine in an E.coli cell List the steps involved in this repair pathway. Rather than using repair factor names, describe their FUNCTION and how they execute the repair pathway in a stepwise manner:

1. a protein recognizes a distortion in the DNA backbone 2. the newly synthesized strand with the lesion is identified because it is not methylated 3. an endonuclease creates a nick in the dna sugar phosphate backbone 4. an exonuclease excises a short region of DNA around the lesion 5. a dna polymerase fills in the correct nucleotides 6. ligase seals the final nick in the sugar phosphate backbone

How many copies of a target sequence are generated after five PCR cycles?

32: 2, 4, 8, 16, 32

Design a primer pair, each 15bp in length, to amplify the following DNA sequence in a PCR reaction (note: only one strand is shown) 5'ATACACCCCAGAGATAGCTAAATCGATAGCAGGGGTCTAGTCGGGATCGTAATCG3'

5' ATACACCCCAGAGAT 3' 5' CGATTACGATCCCGA 3'

Transcription initiation involves a series of ordered steps. What is the correct order of the following steps? 1. Abortive initiation 2. Open complex formation 3. Promoter escape 4. Closed complex formation 5. sigma factor binds the promoter

5, 4, 2, 1, 3

what dna lesion does the mutagen base analogs create?

5-bromo uracil incorporation into DNA- makes a AT:GC lesion (a point mutation)

What is a consensus sequence? How do changes in the -35/-10 consensus sequence influence the frequency of transcription in prokaryotes?

A consensus sequence is the "best match" for sigma factor to bind, and thus deliver RNA polymerase to select promoter regions for transcription. Deviations from the consensus -35/-10 sequences will decrease the frequency of transcription initiation of genes controlled at that particular promoter.

Which pair of terms is associated with loosely-wound DNA (and hence elevated gene expression levels)? A. HATs/euchromatin B. HATs/heterochromatin C. HDACs/heterochromatin D. HDACs/euchromatin

A. HATs/euchromatin

Stem cells have more/less euchromatin than differentiated cells A. More B. Less

A. More

In a typical PCR A. the concentration of primers decreases with every cycle B. the concentration of primers increases with every cycle of the PCR C. the concentration of primers stays the same with every cycle of the PCR

A. The concentration of primers decreases with every cycle of the PCR

The human disease known as xeroderma pigmentosum (XP) arises from mutations in at least seven different genes. The resulting deficiencies are generally in enzymes involved in some part of the pathway for nucleotide excision repair. The various types of XP are denoted A through G (XPA, XPB, etc.), with a few additional variants lumped together under the label XP-V. Cultures of fibroblasts from healthy individuals and from patients with XPG are irradiated with UV light. The DNA is isolated and denatured, and the resulting single-stranded DNA is examined by analytical ultracentrifugation. Samples from the normal fibroblasts show a significant reduction in the average molecular weight of the single-stranded DNA after irradiation, but samples from the XPG fibroblasts show no such reduction. Why might this be? a. Single-strand DNA is excised during NER, accounting for the short ssDNA fragments observed in normal cells after irradiation. However, a defective NER system in the XPG mutant cells only removes one or two nucleotides that cannot be detected. b. Single-strand DNA is excised during NER, accounting for the short ssDNA fragments observed in normal cells after irradiation. However, a defective NER system in the XPG mutant cells prevents formation of single-strand breaks and subsequent repair. c. Single-strand DNA is excised during NER, accounting for the short ssDNA fragments observed in normal cells after irradiation. However, a defective NER system in the XPG mutant cells immediately degrades the newly synthesized single-stranded DNA that would replace the DNA removed during the repair process.

b. Single-strand DNA is excised during NER, accounting for the short ssDNA fragments observed in normal cells after irradiation. However, a defective NER system in the XPG mutant cells prevents formation of single-strand breaks and subsequent repair.

Which of the following is the result of external mutagens? a. template slippage during replication b. addition of bulky adducts to the DNA c. depurination d. recombination errors e. replication errors

b. addition of bulky adducts to the DNA

An RNA processing event that frequently leads to different protein products encoded by a single gene is: a. transcription. b. alternative splicing. c. alternative transcription. d. polyadenylation.

b. alternative splicing.

Insertions and deletions of three base pairs:change one codon and, therefore, only one amino acid in the protein sequence. a. do not disrupt the reading frame so the protein ends up completely normal. b. do not disrupt the reading frame so the protein will usually retain some degree of function. c. cause frameshifts that will change the reading frame and, therefore, the sequence of the protein. d. usually result in the expression of a truncated protein.

b. do not disrupt the reading frame so the protein will usually retain some degree of function.

If a mutation causes a decrease in the activity of histone acetyltransferases, histones will most likely have a _______ affinity for DNA, and there would be _______ in transcription rates. a. greater; an increase b. greater; a decrease c. reduced; an increase d. reduced; no change e. reduced; a decrease

b. greater; a decrease

Which of the following features is primarily responsible for rho protein to cause termination of transcription? a. recognizing unstructured RNA b. helicase activity c. migrating behind RNA polymerase d. RNA-binding activity

b. helicase activity

In a typical sequencing reaction, the amount of dNTPs is much greater than of the ddNTPs. Predict the results if equal amounts of both types of nucleotides were used in each reaction. After gel electrophoresis and visualization: a. mostly long fragments would be present and no sequence could be read close to the primer. b. mostly short fragments would be present and only sequences very close to the primer could be read. c. the sequence could be read normally; the dNTP/ddNTP ratio does not affect the products of the reaction. d. only the purine reactions would show termination and be read from the gel. e. no bands would be visible because the high concentration of ddNTPs would inhibit the activity of the polymerase.

b. mostly short fragments would be present and only sequences very close to the primer could be read.

All four dideoxynucleotides can be present in a single Sanger sequencing reaction and still be distinguished because: a. they are incorporated in the growing chain with different efficiency. b. they are labeled with different fluorescent dyes. c. the fragments into which they are incorporated have different mobility in a gel. d. All of these choices are correct.

b. they are labeled with different fluorescent dyes.

The main reason that mRNA transcripts are modified at the 5′ and 3′ ends is: a. to ensure that all nucleotides are phosphorylated. b. to protect the RNA from nucleolytic degradation. c. so that the two ends remain associated with each other during transport. d. to guide the removal of introns.

b. to protect the RNA from nucleolytic degradation.

What is the minimum number of transesterification reactions required to splice an intron from a precursor transcript? a. one b. two c. One to cleave the 5' exon-intron junction and one to join the two exons, with release of the intron. d. three e. four

b. two

what dna lesion does the mutagen oxidative damage create?

base oxidation (leads to wrong nucleotides being incorporated upon DNA replication), double strand breaks (often introduces insertions/deletions at the break site)

The nucleophile of the second step of spliceosome-mediated pre-mRNA splicing is the: a. 2′ hydroxyl of the branch point adenosine. b. 3′ hydroxyl of a free guanine nucleotide. c. 3′ hydroxyl of the 5′ splice site exon. d. 2′ hydroxyl of the 3′ splice site intron.

c. 3′ hydroxyl of the 5′ splice site exon.

The sequence of the messenger RNA molecule (primary transcript) synthesized from a DNA molecule with a coding strand having the sequence 5′ ATGCTACCGTTA is: a. 5′ UACGAUGGCAAU. b. 5′ UAACGGUAGCAU. c. 5′ AUGCUACCGUUA. d. 5′ AUUGCCAUCGUA. e. None of these choices is correct.

c. 5′ AUGCUACCGUUA.

How do transcriptional activator proteins and repressors affect the level of transcription of eukaryotic genes? a. Activators proteins and repressors bind to each other to form a dimer that can attach to RNA polymerase and serve as an "on" or "off" switch. b. Activator proteins form pores in the nucleus to allow the import of RNA polymerase from the cytoplasm, and repressors block these pores. c. Activator proteins and repressors bind to cis elements on the DNA and promote or prevent, respectively, the assembly of the basal transcription factor apparatus. d. Activator proteins create a pool of ATP molecules needed for transcription and repressor proteins block ATP production, thereby inhibiting transcription.

c. Activator proteins and repressors bind to cis elements on the DNA and promote or prevent, respectively, the assembly of the basal transcription factor apparatus.

What is the benefit of using Taq polymerase in PCR? a. Because it is taken from bacteria that live in high temperatures, it doesn't have a proofreading function. b. Because it is taken from bacteria, this enzyme works much more efficiently than other types of DNA polymerase. c. Because it is taken from bacteria that live in high temperatures, it stays active during denaturation steps of the reaction d. Because it is taken from bacteria, it makes fewer mistakes. e. None of the other answer options is correct.

c. Because it is taken from bacteria that live in high temperatures, it stays active during denaturation steps of the reaction

How does epigenetic inheritance differ from Mendelian inheritance? a. Traits inherited epigenetically do not change an organism's genotype or phenotype, while mutations change the genotype and phenotype of an organism and will be subject to Mendelian inheritance. b. Traits inherited epigenetically cannot be changed during an organism's lifetime, while mutations can be introduced during an organism's lifetime and are subject to Mendelian inheritance. c. Epigenetic inheritance describes chromatin modifications that are retained in the chromatin after cell division and affect gene transcription. Such modifications are not encoded in the DNA and thus are not subject to Mendelian inheritance. d. Epigenetic inheritance describes chromatin modifications that are retained in the chromatin after cell division and affect gene transcription. Such modifications do not involve the X or Y chromosomes and thus are not subject to Mendelian inheritance.

c. Epigenetic inheritance describes chromatin modifications that are retained in the chromatin after cell division and affect gene transcription. Such modifications are not encoded in the DNA and thus are not subject to Mendelian inheritance.

All of the following are components of mature mRNAs of bacterial cells EXCEPT: a. Protein coding region b. 3' UTR c. Introns d. Exons e. 5' UTR

c. Introns

Which one of the following polypeptide sequences will be made from the RNA sequence shown, translating from the first start codon to the stop codon? 5′- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU a. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly-Tyr-Pro-Phe b. Met-Pro-Lys-Ile c. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly d. Arg-His-Ala

c. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly

Which of the following is TRUE of introns? a. More DNA of the human genome is devoted to exons than to introns. b. When annealing mature mRNA to corresponding chromosomal DNA sequences, the mRNA will form loops with intron sequences looped out. c. RNA II polymerase transcribes the intron sequences along with exon sequences. d. Introns are not found in bacteria or archaea, only eukaryotes.

c. RNA II polymerase transcribes the intron sequences along with exon sequences.

Which of these processes is LEAST likely to expand the coding capacity of the genome? a. RNA editing b. poly(A) site choice c. RNA capping d. alternative splicing

c. RNA capping

Suppose that the string of A nucleotides following the inverted repeat in a rho-independent terminator was deleted but that the inverted repeat was left intact. How will this deletion affect termination? What will happen when RNA polymerase reaches this region? a. RNA polymerase will terminate when the hairpin causes the polymerase to destabilize and come off the template. b. The hairpin will occur in the template, preventing transcription, but the product will not have the stop codon encoded by the string of A nucleotides. c. RNA polymerase may stall at the hairpin, but the necessary destabilization at the DNA-RNA hybrid will not be sufficient to cause termination. d. Rho will not be effectively recruited without the string of A nucleotides in the template.

c. RNA polymerase may stall at the hairpin, but the necessary destabilization at the DNA-RNA hybrid will not be sufficient to cause termination.

The reading frame of mRNA is: a. all of the nucleotides of an mRNA molecule. b. any three nucleotides that can base pair with an anticodon. c. a continuous, nonoverlapping set of three-nucleotide codons. d. the first three nucleotides of a gene.

c. a continuous, nonoverlapping set of three-nucleotide codons.

High concentrations of a protein are found in some muscle cells in mice. The protein binds to certain regulatory sequences, increasing the expression of certain genes. This protein is most likely a. a sigma factor. b. a general transcription factor. c. a specific transcription factor. d. an enhancer. e. TFIID.

c. a specific transcription factor.

Poly(A) site choice: a. is a mechanism to determine the length of the poly(A) tail. b. leads to polyadenylation of the 5′ end of the mRNA. c. can generate multiple protein products from a single gene. d. is catalyzed by small nucleolar ribonucleoproteins.

c. can generate multiple protein products from a single gene.

What is the CORRECT order of transcriptional events occurring after RNA polymerase binds to the promoter? a. start of RNA synthesis, open complex formation, closed complex formation, promoter clearance b. closed complex formation, open complex formation, promoter clearance, start of RNA synthesis c. closed complex formation, open complex formation, start of RNA synthesis, promoter clearance d. open complex formation, closed complex formation, start of RNA synthesis, promoter clearance e .open complex formation, closed complex formation, promoter clearance, start of RNA synthesis

c. closed complex formation, open complex formation, start of RNA synthesis, promoter clearance

the genetic code is degenerate (redundant) because: a. one particular amino acid can only be encoded by one codon b. not all possible codons are used to code for amino acids c. one particular amino acid can be encoded by more than one codon d. one particular codon can code for more than one amino acid

c. one particular amino acid can be encoded by more than one codon

A mutation causes a decrease in the activity of histone deacetylase. Most likely histones would have a _______, and there would be _______ in rates of transcription. a. greater affinity for DNA; an increase b. greater affinity for DNA; a decrease c. reduced affinity for DNA; an increase d. reduced affinity for DNA; no change e. reduced affinity for DNA; a decrease

c. reduced affinity for DNA; an increase

which strand has the same sequence as the RNA? Template strand or Coding strand (non-template)?

coding strand (non-template strand)

what dna lesion does the mutagen base hydrolysis create?

cytosine deamination- makes a GC:AT lesion (a point mutation)

The template DNA strand is read in a _______ direction while mRNA is built in a _____ direction. a. 5' to 3'; 5' to 3' b. 5' to 3'; 3' to 5' c. 3' to 5'; 3' to 5' d. 3' to 5'; 5' to 3'

d. 3' to 5'; 5' to 3'

Starting with a single double-stranded DNA molecule, _______ double-stranded DNA molecules will be created after five rounds of PCR (assuming that the PCR works perfectly). a. 5 b. 10 c. 16 d. 32 e. 1024

d. 32

The processes carried out by RNA polymerases and DNA polymerases are in some ways very similar, but they also have striking differences, including which of the following? a. RNA polymerases do not require a primer to initiate synthesis. b. DNA polymerases use both strands of DNA as templates. c. RNA polymerases use only defined stretches of the DNA as templates. d. All of the above. e. Only a and c are correct.

d. All of the above.

What is required for a DNA lesion to result in a mutation? a. A base is altered and no longer hydrogen bonds properly. b. An incorrect base is inserted into a nucleotide sequence. c. A break occurs in one of the DNA strands d. Replication occurs before repair of a lesion producing a base pair that is different from the original base pair.

d. Replication occurs before repair of a lesion producing a base pair that is different from the original base pair.

Which of the following is NOT true of translesion synthesis (TLS)? a. TLS uses polymerases with wider-than-normal active site architecture to accommodate abnormal nucleotides in the template. b. TLS lacks the 3'-5' exonuclease activity usually required for proofreading. c. It is activated during replication when the polymerase stalls at a lesion; the TLS polymerase takes over long enough to extend the DNA over the lesion. d. TLS can be used to repair lesions such as pyrimidine dimers, bulky adducts, and double-stranded breaks. e. All of these choices are true.

d. TLS can be used to repair lesions such as pyrimidine dimers, bulky adducts, and double-stranded breaks.

What would be the effect on the PCR reaction if there are no primers in the reaction? a. PCR would proceed normally b. Non-specific PCR of random templates will occur c. The reaction will cease after a few cycles d. The PCR reaction will not commence

d. The PCR reaction will not commence

Researchers artificially mutated a serine to an alanine in the C-terminal domain (CTD) of RNA polymerase II. In their Xenopus transcription system, they found that this mutated polymerase could no longer transcribe. What is the best hypothesis to explain this observation? a. Without the serine, Pol II was no longer able to bind the DNA template, and therefore no transcription could occur. b. The serine is important for interaction with sigma factors; without the sigma factor binding properly, transcription could not initiate. c. The serine is important for the methylation of CTD in order to form a pre-initiation complex; without the methylation, no transcription could occur. d. The serine is important for the phosphorylation of CTD necessary for transcription elongation; without it no transcription could occur.

d. The serine is important for the phosphorylation of CTD necessary for transcription elongation; without it no transcription could occur.

Which of the following is NOT true of the reaction catalyzed by RNA polymerases? a. Template DNA is copied in the 3′ to 5′ direction. b. The 3′-hydroxyl group of the growing RNA strand is a nucleophile. c. The reaction is magnesium ion-dependent. d. U residues are incorporated into the RNA to pair with T residues of the template. e. The RNA molecule is synthesized in the 5′ to 3′ direction.

d. U residues are incorporated into the RNA to pair with T residues of the template.

the reading frame of mRNA is: a. all of the nucleotides of an mRNA molecule b. any three nucleotides that can base pair with an anticodon c. the first three nucleotides of a gene d. a continuous, non-overlapping

d. a continuous, non-overlapping

A ribonucleoprotein is: a. an enzyme that degrades RNA. b. an RNase that functions in the nucleus. c. a nucleotide-transport protein. d. a noncoding RNA complexed with protein.

d. a noncoding RNA complexed with protein.

The conserved adenine nucleotide in introns serves as the: a. initial site of intronic RNA digestion and removal. b. key point for ribosome assembly and initiation of translation. c. molecular signal for RNA splicing. d. branch point for the formation of the intronic "lariot." e. site for intron recognition for the splicesome.

d. branch point for the formation of the intronic "lariot."

Which of the following is the MOST common type of hydrolysis damage in the cell? a. deamination of thymidine b. breakage of the glycosidic linkage between the pyrimidines and the DNA backbone c. removal of cytosine from the DNA backbone to create an abasic site d. deamination of cytosine to uracil e. None of the damage types given is known to occur in cells.

d. deamination of cytosine to uracil

Three temperature stages make up a single PCR cycle (synthesis=elongation phase for this question). These three stages (in order) are a. denaturation, synthesis, primer annealing. b. primer annealing, denaturation, synthesis. c. synthesis, denaturation, primer annealing. d. denaturation, primer annealing, synthesis.

d. denaturation, primer annealing, synthesis.

Point mutations in the DNA sequence do NOT cause _____ mutations. a. silent b. missense c. nonsense d. frameshift e. transversion

d. frameshift

The enzyme responsible for adding acetyl groups to histone proteins is called a. histone acetylase (HA). b. histone deacetylase (HDAC). c. histone acetylmethyltransferase (HAT). d. histone acetyltransferase (HAT). e. histone methyltransferase (HMT).

d. histone acetyltransferase (HAT).

An individual's STR may vary from the same STR of another individual by the a. order of nucleotides. b. specific bases present. c. specific chromosomal location of the STR. d. number of times a specific sequence is repeated. e. number of coding regions.

d. number of times a specific sequence is repeated.

Which of the following is NOT a component of a polymerase chain reaction (PCR)? a. dNTPs b. DNA containing the sequences to be amplified c. primers complementary to each end of the sequence to be amplified d. heat stable Taq polymerase e. DNA ligase to connect the fragments together

e. DNA ligase to connect the fragments together

What are the three processes in posttranscriptional modification that must be completed before transcripts can be translated in eukaryotes? a. Binding of snRNPs, addition of a poly A tail, splicing of introns b. Binding of snRNPs, transporting, synthesizing of ribose c. Capping, transporting, synthesizing of ribose d. Binding of snRNPs, capping, splicing e. Splicing, capping, addition of a poly A tail

e. Splicing, capping, addition of a poly A tail

DNA genotyping by analyzing short tandem repeats has been used do all the following EXCEPT: a. identify criminals using blood samples. b. identify the father of a child. c. disprove a mother's claim to a child. d. acquit an accused rapist. e. determine a newborn's chance for genetic disease.

e. determine a newborn's chance for genetic disease.

The addition of acetyl groups makes histones _______ positively charged, and thus _______ their affinity for DNA. a. more; increases b. more; decreases c. less; increases d. less; has no effect on e. less; decreases

e. less; decreases

The expression of some genes can be regulated in part by the pattern of RNA splicing. This is an example of a. pretranscriptional control b. genomic imprinting c. transcriptional regulation. d. DNA methylation. e. posttranscriptional control.

e. posttranscriptional control.

HAT

histone acetyltransferase. Adds acetyl groups to lysines located on histone tails to mask their positive charge and reduce the positive charge on histone tails to lessen their affinity for DNA.

HDAC

histone de-acetyltransferase. Removes acetyl groups on lysines located on histone tails. This restores the positive charge of lysines and therefore increases the affinity of histones for DNA

Describe the phosphorylation state of eukaryotic RNA pol I during pre-initiation

no phosphorylation

Describe the phosphorylation state of eukaryotic RNA pol I during the latter part of elongation

phosphorylation at ser2, recruits splicing factors, cleavage factors, and polyadenylation factors

Describe the phosphorylation state of eukaryotic RNA pol I during promoter escape

phosphorylation at ser5, recruits capping enzymes

decondensed chromatin

refers to DNA loosely wrapped around nucleosomes that is not associated with with higher order chromatin structure (ie euchromatin, highly expressed genes)

euchromatin

refers to DNA loosely wrapped around nucleosomes. This DNA can be transcribed and genes located within euchromatin are actively expressed

heterochromatin

refers to DNA tightly wrapped around nucleosomes and other higher order chromatin remodeling proteins. This DNA is inaccessible for transcription, therefore genes within heterochromatin are not expressed

condensed chromatin

refers to DNA tightly wrapped around nucleosomes and other proteins associated with higher order chromatin structure (ie heterochromatin, genes that are not expressed)

epigenetic

refers to modifications of DNA nucleotides and histone tails that control gene expression without actually altering the DNA sequence. DNA/histone modifications can be passed down through generations

chromatin remodeler

refers to proteins that influence how DNA is condensed into chromatin. Chromatin remodelers can facilitate either the condensation of DNA (formation of heterochromatin where genes are not expressed) or the decondensation of DNA (formation of euchromatin where genes can be expressed)

methylation

refers to the transfer of a methyl group to an amino acid. Methylation of lysines on histone tails via methyltransferases doesn't alter the charge of the histone tails, but it attracts proteins that contain a chromodomain

acetylation

refers to the transfer of an acetyl group to an amino acid (typically lysines). Acetylation can mask the positive charge on lysines. Acetylation of lysines on histone tails (via histone acetyltransferases, HATs) makes the tails less positively charged and therefore reduces their affinity for DNA.

List trans elements for PK

sigma factor RNA polymerase

what is a snRNP? Describe how U2 snRNP binds the branch point splice site to facilitate the first transesterification reaction in RNA splicing.

small nuclear ribonucleoproteins (snRNPs) each consist of a small nuclear RNA (snRNA) complexed with different proteins. there are 5 snRNPs which make up the spliceosome (the name for the entire splicing machinery). the snRNA component of U2 snRNP is complementary to the intronic RNA sequence surrounding (but not including) the branch point A. When the U2 snRNA base pairs with this sequence, the A gets jutted out of the RNA in bulge which exposes the 2'OH and allows it to function as a nucleophile.

histone tail

the N terminus of individual histones proteins takes the form of a "tail" that sticks out from the nucleosome. Since there are 8 histones per nucleosome, each nucleosome has 8 tails. These tails have a lot of positively charged amino acids (especially lysines), which give histones a net positive charge. Amino acids on histone tails are commonly modified to influence their affinity for negatively charged DNA

what dna lesion does the mutagen UV light create?

thymine dimers: similar consequences as intercalating agents

what dna lesion does the mutagen dna polymerase error create?

wrong nucleotide incorporated in the dna, creates a point mutation