POB1-Midterm 2 topics

What do we need to express a eukaryotic gene in a prokaryotic cell?

-A prokaryotic promoter - only insertion of the coding sequence of the gene - an affinity tag to allow us to purify the protein

Which of the following are associated with regions of accessible, transcribed chromatin in eukaryotic genomes (select all that apply) -Methylated DNA -Deacetylated histones -Acetylated histones -Ribosomes -ATP-dependent chromatin remodeling enzymes

-Acetylated histones -ATP-dependent chromatin remodeling enzymes

What most commonly serves as a start codon in both prokaryotes and eukaryotes?

AUG

During what stage of mitosis do sister chromatids separate?

Anaphase

Cytokinesis in plants

Plants cells have cell walls so a cleavage furrow does not form. Instead a new cell wall forms after all of mitosis is completed.

silent substitution

When you have a mutation in a single nucleotide in a codon , BUT the mutated codon still ends up coding for the same amino acid. This is a silent mutation, as the protein sequence is unchanged → so structure and function is not changed.

Undeterred by the fact that you couldn't express lac operon proteins in a eukaryote, you decide that you want to express the gene for human DNA ligase I (LIG1) in E. coli. The LIG1 gene has 29 exons. (A) How many introns does the LIG1 gene have? Hint, it might be helpful to think about how many introns are present in a gene with 2 exons, 3 exons, 4 exons, etc.(1 pt) (B) To express LIG1 in E. coli, you need to clone DNA downstream of a prokaryotic promoter - should you make this DNA by PCR from a genomic DNA template, or from a cDNA template? Justify your choice (2 pt total for B)

((A) 28, (B) cDNA (0.5 pt). E. coli cannot remove introns from the transcript, which will be translated as it is transcribed. So the sequence that encodes the ligase protein would not be present if we used genomic DNA (

You decide that you want to produce the three proteins encoded within the lac operon in yeast (a eukaryote) rather than E. coli (a prokaryote). You clone the operon, replace the promoter with the GAL1 promoter - which can be activated by adding the sugar galactose, and use CRISPR to insert this DNA into the yeast genome. (A) What technique could you use to test whether the operon is successfully transcribed upon addition of galactose? (1 pt) You observe a high level of transcription from your yeast-modified lac operon, just as you hoped: however, when you purify protein from your yeast cells and perform western blots to detect beta-galactosidase, permease, and transacetylase, you do not detect any of these proteins... (B) Describe a very simple experiment you could use to convince yourself and other scientists that your western blot is working, and that your failure to detect the three proteins from the lac operon in these cells means that they are not present. 400 characters maximum (1 pt) (C) Why are none of the proteins from the lac operon properly translated in yeast? If any of the three were properly expressed, which one is most likely - and why? 500 characters maximum.

((A) Northern blot or RT-PCR (1 pt for either) using a probe complementary to, or primers that amplify, any portion of the operon, (B) Do a western blot looking for these proteins on a protein sample purified from E. coli grown in the absence of glucose and the presence of lactose (so they will be expressing the operon). This shows that the specific western blot you are trying to do works. Give 0.9 points for an answer that suggests doing an actin blot or similar as a loading control, and spend time in recitation explaining why this doesn't quite answer the question., (C) Eukaryotes begin translation from the first start (AUG) codon in a transcript (1 pt for this). Prokaryotes use internal start codons, guided by upstream sequence. If any of the three proteins were successfully translated, the first one in the transcript (beta galactosidase) is most likely (1 pt) because it is closest to the 5' end of the mRNA (1 pt).)

What does a plasmid need?

-An origin of replication -A region wth lots of restriction enzyme sites where we can put our DNA -A gene to confer an advantage on bacteria who get (and keep) the plasmid- antibiotic resistance gene

Which of the following would not cause a frameshift mutation? -Insertion of 1 nucleotide into an exon -Insertion of 2 nucleotides into an exon -Insertion of 3 nucleotides into an exon -Insertion of 4 nucleotides into an exon -Insertion of 5 nucleotides into an exon

-Insertion of 3 nucleotides into an exon

Which of the following receptors can directly act as transcription factors? G-protein-coupled receptors (GPCRs) -Steroid hormone receptors -Receptor tyrosine kinases -Ligand-gated transmembrane ion channels -None of these receptors can act as transcription factors

-Steroid hormone receptors

Which of the following statements about affinity tags is/are true (in the context of a human protein being expressed and purified from a bacterial cell, using a plasmid)? Select all that apply -The affinity tag is covalently attached to the protein you want to purify -The affinity tag allows the protein to be separated from a cellular lysate by affinity purification -The affinity tag will be transcribed/translated by the bacterial RNA polymerase/ribosomes

-The affinity tag is covalently attached to the protein you want to purify -The affinity tag allows the protein to be separated from a cellular lysate by affinity purification -The affinity tag will be transcribed/translated by the bacterial RNA polymerase/ribosomes

Which three of the following are found in the genomic DNA corresponding to a given gene in a eukaryotic cell? -A 5' cap -A poly(A) tail -Untranslated regions (UTRs) -Exons -Introns

-Untranslated regions (UTRs) -Exons -Introns

25. In a cloning experiment, you start with a skin cell from your pet and an egg from my pet. The nuclear genetic material of the clone would be: ( ) 2n from my pet ( ) 2n from your pet ( ) 1n from my pet ( ) 1n from my pet and 1n from your pet ( ) It is impossible to tell

2n from your pet

Which of the following is a second messenger? -An activated protein kinase -Glycogen -Platelet derived growth factor -A receptor tyrosine kinase -5'-3' cyclic AMP (cAMP)

5'-3' cyclic AMP (cAMP)

three tRNA binding sites

A Site - where the incoming tRNA bearing the next amino acid will bond. P Site - contains the tRNA that is covalently bonded (at its 3 prime end) to the whole protein. E site- occupied by a tRNA on its way out, after it has dropped off its amino acid.

23. Adult stem cell is a cell that is critical for tissue homeostasis. A stem cell is: ( ) A pluripotent cell ( ) An uncommitted cell ( ) A rapidly dividing cell ( ) A cell that can make a copy of itself and at least another cell type ( ) A cell that can differentiate into another cell type

A cell that can make a copy of itself and at least another cell type

Which of the following proteins would you expect to be translated by a ribosome associated with the rough endoplasmic reticulum? -A component of DNA polymerase -A component of RNA polymerase II (a.k.a. RNA Polymerase 2) -A potassium channel that localizes to the plasma membrane -Pyruvate kinase (a protein involved in glycolysis)

A potassium channel that localizes to the plasma membrane

The budding yeast (S. cerevisiae) genome is 12 million base pairs long. Which of the following will likely make cuts at the largest number of sites in the yeast genome? -A restriction enzyme with a 4 base pair recognition sequence -A restriction enzyme with a 6 base pair recognition sequence -A restriction enzyme with a 8 base pair recognition sequence -CRISPR/Cas9 guided by ~20 base pairs of complementarity through its guide RNA

A restriction enzyme with a 4 base pair recognition sequence

Tay-Sachs disease is a devastating genetic disorder, resulting from mutations in the HEXA gene. The most common disease-causing mutation in HEXA is a four base pair insertion in exon 11 of the gene (which has 14 exons). (A) Briefly rationalize why this mutation impairs production of full length HEXA protein. (B) Would you expect either of the following to have a similar effect on protein function: (i) insertion of 9 base pairs into exon 8, or (ii) deletion of 13 base pairs from intron 10

A) The 4 bp insertion changes the reading frame (0.5 pt), disrupting sequence downstream of the insertion and leading to a premature stop codon B) No to both inserting 9 bp doesn't change the reading frame, so unless the added amino acids themselves are problematic (pretty unusual), this won't affect protein function. Intronic DNA doesn't end up in the mature transcript, so this change will not have an effect unless it impacts splicing (not impossible, but again relatively unlikely))

18. During development, which cell in the list below is the least committed? (A) Zygote (B) Morula (C) Inner cell mass (D) Embryonic Stem Cells (E) Adult Stem cells

A) Zygote

Multicellularity success rests on differentiating cells into a large array of cell types during development and their replacement during post-embryonic stages. Thus, you decided to study cell commitment, potential and differentiation.A. Parthenogenesis is a form a reproduction where the unfertilized egg develops into an adult organism. What would the n number of individuals that have developed by parthenogenesis? [1 pt] B. Would tissue regenerative capacity will be reduced, enhanced, or remain equal if we treat patients with a drug that reduces adult stem cell differentiation potential? [1 pt] C. Because of their differentiation potential, embryonic stem cells are transforming medical research. Would it be possible to generate human gastrula states in the lab from human embryonic stem cells? [2 pts]

A. 1n B. It will reduce tissue's regenerative capacity. C. Yes. Because they are derived from the inner cell mass (before gastrulation), embryonic stem cells have the potential to gastrulate.

6. You want to create a knockout of a gene in mouse embryonic stem cells, using CRISPR/Cas9 to cut the DNA and relying on the cell's non-homologous end joining (NHEJ) machinery to make a frameshift mutation. Which of the following is the most sensible part of the gene to target? A. An exon near the start of the gene B. An intron near the start of the gene C. An exon near the end of the gene D. An intron near the end of the gene E. All of the above would be equally sensible places to target

A. An exon near the start of the gene

OE3. Consider the epinephrine signaling pathway, shown below. Binding of a single molecule of epinephrine to its receptor can normally liberate ~108 molecules of glucose-1-phosphate from glycogen. How would the amount of glucose-1-phosphate liberated by an identical amount of epinephrine change, given the following perturbations? Answer using the words 'increase', 'decrease' or 'unchanged' [1 pt each] A. Mutation of the receptor so that it no longer binds epinephrine B. Mutating the G protein such that its GTPase activity is increased C. Inhibiting cyclic AMP phosphodiesterase with a drug D. Mutating phosphorylase kinase so that it cannot be phosphorylated by protein kinase A

A. Decrease B. Decrease C. Increase D. Decrease

OE1. You engineer a variant of the lac repressor that binds the amino acid arginine instead of allolactose, then use CRISPR/Cas9 to replace the gene encoding the lac repressor with your engineered version. (A) Under what specific conditions would high levels of transcription occur from the lac operon in the strain you have generated? [2 pts] Now consider the mRNA produced by the lac operon: this encodes three proteins (in order, these are beta-galactosidase, permease, and transacetylase). (B) How many distinct proteins would be encoded by a mutant form of the mRNA in which the ribosome binding site (ShineDalgarno sequence) upstream of the Permease gene was completely removed? [1 pt]. (C) Would cells with this mutated form of the lac operon to be able to metabolize lactose?

A. Low Glucose, high arginine (1 pt each) B. Two (Beta galactosidase and transacetylase) C. No

Which of the following best describes the role of release factors in translation? A. Release factors recognize stop codons and promote the removal of the protein chain from the 3' end of the P site tRNA by hydrolysis B. Release factors recognize start codons and promote the release of inhibitory GDP from the small ribosomal subunit C. Release factors release the amino acids from the 3' ends of free tRNAs not associated with the ribosome D. Release factors remove RNA polymerase from mRNAs so ribosomes can access start codons

A. Release factors recognize stop codons and promote the removal of the protein chain from the 3' end of the P site tRNA by hydrolysis

11. Which of the following receptors is most likely to act directly as a transcription factor? A. The estrogen receptor (steroid hormone) B. The EGF receptor (growth factor) C. The beta-adrenergic receptor (GPCR) D. All of these receptors can act directly as transcription factors

A. The estrogen receptor (steroid hormone)

12. Consider the signaling pathway downstream of the EGF receptor, shown below. What would be the effect of a pair of mutations that constitutively activated MEK, while at the same time preventing TGF⍺ from binding to the EGF receptor? A. The pathway would be locked in the ON state with no need for TGF⍺ B. The pathway would locked in the ON state after an initial TGF⍺ stimulus C. The pathway would be locked in the OFF state D. There would be no change to the behavior of the pathway

A. The pathway would be locked in the ON state with no need for TGF⍺

What would be the transcriptional output of the lac operon in an E. coli cell in the following 8 scenarios? Your answers must be one word each, selected from the following two options: 'high' and 'low'. A. No functional lac repressor protein, high glucose, high lactose B. No functional lac repressor protein, low glucose, high lactose C. No functional lac repressor protein, high glucose, low lactose D. No functional lac repressor protein, low glucose, low lactose E. No functional CAP protein, high glucose, high lactose F. No functional CAP protein, low glucose, high lactose G. No functional CAP protein, high glucose, low lactose H. No functional CAP protein, low glucose, low lactose

A. low B. high C. low D. high E. low F. low G. low H. low i.e. No CAP No transcription from the lac operon regardless of what sugar is present. No lac repressor synthesis from the lac operon whenever glucose is absent, regardless of the presence/absence of lactose)

G-protein process

Activation of receptor by binding of the ligand This causes the G protein to bind GTP and release GDP. Over time, intrinsic GTPase activity in the GTP protein will hydrolyze the GTP into GDP and P, returning the G protein back to its inactive state.

The Trp repressor: -Binds to DNA in the presence of tryptophan -Is a protein -Represses transcription of the trp operon -All of the above are true

All of the above are true

Failure of the anaphase checkpoint can lead to defects in chromosome segregation. A human cell that inherits the incorrect number of chromosomes is known as:

Aneuploid

2. A metabolic pathway in yeast makes the essential product D as follows: ABCD. Each step is catalyzed by an intuitively named enzyme (these enzymes, listed in the order they act, are AtoBase, BtoCase, and CtoDase). You have a mutant strain of yeast that can grow when provided with either C or D, but not A or B. Which enzyme is mutated in the strain? A. AtoBase B. BtoCase C. CtoDase D. None of these enzymes are mutated in the strain E. It's impossible to tell

B. BtoCase

9. Which of the following would not be used when trying to express a eukaryotic gene in a prokaryote? A. DNA with the sequence of the mature, processed mRNA from the gene B. DNA with the sequence of unprocessed mRNA from the gene C. A prokaryote-specific promoter D. A plasmid with a selectable marker E. DNA encoding an affinity tag, appended to the start or end of the sequence encoding your protein of interest

B. DNA with the sequence of unprocessed mRNA from the gene

15. A 2n=32 diploid cell goes through mitosis, producing daughters that each go through a round of mitosis: what do we have at the end of this? A. Two 2n=32 diploid cells B. Four 2n=32 diploid cells C. Two 1n=16 haploid cells D. Four 1n=16 haploid cells E. Eight 1n=16 haploid cells

B. Four 2n=32 diploid cells

If we mutate the anticodon of tRNATrp from CCA to ACC, what would happen?

B. Sometimes glycine, sometimes tryptophan would be incorporated when the ribosome encountered a GGU codon

By what enzyme and where in the cell are non-coding regions/introns removed?

By the spliceosome by a process called RNA splicing in the nucleus before the mRna is exported for translation.

17. Fertilization is the first step in sexually reproducing species. A cortical reaction failure that results in the fertilization of a human egg by two sperm cells will produce: ( A) A normal individual (B) Twins (C) An inviable embryo (D) An embryo with only trophectoderm abnormalities (E) An embryo with only mesoderm abnormalities

C) An inviable embryo

16. Which of the following is able to phosphorylate target proteins and facilitate progress through the cell cycle: A. A cyclin alone B. A CDK alone C. A complex of a cyclin and a CDK D. A steroid hormone receptor E. The signal recognition particle

C. A complex of a cyclin and a CDK

14. Which of the following best describes the anaphase checkpoint? A. Verifies that cells are large enough to divide before exiting G1 B. Verifies that DNA has been completely replicated before exiting S-phase C. Verifies that chromosomes are properly attached to opposite poles D. Verifies that the nuclear envelope has properly re-formed E. Verifies that cytokinesis has been properly completed

C. Verifies that chromosomes are properly attached to opposite poles

Key Events in G2

Centrosomes replicate → two centrioles in a centrosome

Key Events in Prophase

Chromosomes condense and sister chromatids align at the centromere. Nucleoli disappear Asters and spindle form - mitotic spindle fibers are made of microtubules Centrosomes move toward opposite poles

19. Based on what you about developmental states, cell division speed, and synchrony: Which developmental stage would you choose to study how cyclins oscillate during the cell cycle? ( ) Sperm ( ) Zygote ( ) Cleavage ( ) Adult tissue ( ) Senescent cells

Cleavage

Which best describes the regulation and activity of cyclins and cyclin-dependent kinases (CDKs)? -Cyclins and CDKs are both expressed in an oscillatory fashion: either a cyclin or a CDK is sufficient to phosphorylate target proteins -Cyclins are expressed in an oscillatory fashion, while CDKs are always expressed: both a cyclin and a CDK are required to form a protein complex in order to phosphorylate target proteins -Cyclins are expressed in an oscillatory fashion, while CDKs are always expressed: either a cyclin or a CDK is sufficient to phosphorylate target proteins -Cyclins and CDKs are both expressed in an oscillatory fashion: both a cyclin and a CDK are required to form a protein complex in order to phosphorylate target proteins

Cyclins are expressed in an oscillatory fashion, while CDKs are always expressed: both a cyclin and a CDK are required to form a protein complex in order to phosphorylate target proteins

13. Which of the following is bound at the P site of the ribosome immediately before catalysis (i.e. before immediately before addition of the next amino acid to the growing protein chain)? A. A release factor B. A tRNA with nothing attached to its 3' end C. A tRNA with the next amino acid to be added covalently attached at its 3' end D. A tRNA with the whole protein synthesized so far covalently attached at its 3' end E. Methionine

D. A tRNA with the whole protein synthesized so far covalently attached at its 3' end

8. Which of the following is most likely to be a restriction enzyme recognition sequence? A. AAAAAA B. ACAACA C. AAACCC D. ATATAT E. GCAACG

D. ATATAT

7. Which of the following will cut at the fewest sites in a large chromosome 10 million base pairs long (assume its sequence is random) A. A restriction enzyme with a 4 base-pair recognition sequence B. A restriction enzyme with a 6 base-pair recognition sequence C. A restriction enzyme with an 8 base-pair recognition sequence D. CRISPR/Cas9 guided by ~21 base pairs of base pairing to a guide RNA E. All would cut equally frequently

D. CRISPR/Cas9 guided by ~21 base pairs of base pairing to a guide RNA

1. Which of the following statements about prokaryotic transcription is not true? A. Transcription is carried out by RNA polymerase B. Transcription proceeds from 5'-3' C. Many prokaryotic transcripts encode more than one protein D. Prokaryotic transcription requires a helicase to unwind DNA ahead of the polymerase E. Transcription generates a single-stranded RNA whose sequence corresponds to the reverse complement of the template strand DNA

D. Prokaryotic transcription requires a helicase to unwind DNA ahead of the polymerase

10. Which of the following statements about protein kinases is not true? A. Cyclin:CDK complexes are protein kinases B. Protein kinases covalently add phosphate groups to specific amino acids in proteins C. Protein kinases use ATP as a source of phosphate D. Protein kinases remove phosphate groups from specific amino acids in proteins E. Protein kinases are involved in several cellular signaling pathways

D. Protein kinases remove phosphate groups from specific amino acids in proteins

Describe the role of topoisomerase in RNA transcription

DNA becomes overwound ahead of the RNA polymerase and under-wound behind it. The topological problem is overcome by topoisomerase.

5. Which of the following is not found in the genomic DNA of a eukaryotic gene? A. Introns B. Exons C. The 5' UTR D. The 3' UTR E. The poly(A) tail

E. The poly(A) tail

A gene will still be transcribed if it is found in a region of open chromatin but RNA polymerase cannot be recruited to its promoter. True or False?

False

Gap junctions allow bacteria to communicate with their nearest neighbors. True or False?

False

RNA polymerase requires a helicase to unwind DNA. True or False?

False

The number of chromosomes found in a cell of a given animal directly correlates with the complexity of the body plan of the animal. True or False?

False

For a G-protein to be in its active state, it must be bound to what?

GTP

The lac operon is transcribed at a high level when: -Glucose and lactose are both scarce -Glucose is scarce and lactose is abundant -Glucose and lactose are both abundant -Glucose is abundant and lactose is scarce

Glucose is scarce and lactose is abundant

Where does pre-mRNA splicing occur in a eukaryotic cell?

In the nucleus

24. based on what you know about cell commitment during differentiation: What would be the likely behavior of an adipose adult stem cell from the belly transplanted into the lip during a cosmetic treatment? ( ) It will produce belly adipose tissue ( ) It will produce face adipose tissue ( ) It will produce face tissue ( ) It will produce lip tissue ( ) It will de-differentiate into an embryonic state

It will produce belly adipose tissue

21. Genes are transcribed in specific cells during the embryo and adult body. The ability of a given gene to be transcribed in a cell depends on: ( ) Its enhancer DNA sequence ( ) Activating transcription factors ( ) Its enhancer DNA sequence and activating transcription factors ( )Its exons DNA sequence ( ) Its exons DNA sequence and activating transcription factors

Its enhancer DNA sequence and activating transcription factors

20. Complex multicellular organisms like a fly have different appendages along their body length. During development, cells along the main body axis: ( ) Do not know their relative position because they express the same Hox gene ( ) Do not know their relative position because they express the different Hox genes ( ) Know their relative position because they express the same Hox gene ( ) Know their relative position because they express different Hox genes ( ) Know their relative position but do not express Hox genes

Know their relative position because they express different Hox genes

Which of the following is not a necessary component of a plasmid used to express a human gene in bacteria? -Lactose -An antibiotic resistance gene so the plasmid is retained -The coding sequence of a human gene -A bacterial origin of replication so the plasmid can be replicated -A bacterial promoter so the gene can be expressed

Lactose

Key Events in Metaphase

Longest of the M stages (mitosis stages) Chromosomes gather/align at the metaphase plate Centromeres are at the opposite poles *** Microtubules attach to the kinetochores at centromeres

The mitotic spindle is composed of:

Microtubules

What are the two pathways of DNA repair? Describe them.

Non Homologous end joining(NHEJ)- DNA ends are glued back together; sometimes sequences are gained or lost Homologous recombination(HR)- DNA from the homologous chromosome is used as a template for repair- HR is error free - we can use the fact that if we break the DNA cells will repair it using NHEJ or HR to alter the sequence of the gene

22. Ascl1 is an activating transcription factor containing a DNA binding domain and an activation domain. Ascl1 induces neuronal differentiation. A truncated Ascl1 lacking the DNA binding domain but with an intact activation domain will: ( ) Bind to DNA, activate transcription, and differentiate cells into neurons ( ) Bind to DNA, not activate transcription, and not differentiate cells into neurons ( ) Not bind to DNA, activate transcription, and differentiate cells into neurons ( ) Not bind to DNA, not activate transcription and differentiate cells into neurons ( ) Not bind to DNA, not activate transcription, and will not differentiate cells into neurons

Not bind to DNA, not activate transcription, and will not differentiate cells into neurons

Key Events Between Prophase and Metaphase (Prometaphase)

Nuclear envelope fragments Kinetochores appear → 1 per chromatid → or two per centromere Spindle fibers attach to the kinetochores Non-kinetochore microtubules continue to interact

Key Events In Telophase

Nuclear envelope reforms Chromosomes decondense Nucleoli reform Cytokinesis often occurs simultaneously with telophase

Open vs. Closed Mitosis

Open Mitosis -Most eukaryotes undergo open mitosis -The nuclear envelope breaks down and is reformed after cytokinesis. Closed -The nuclear envelope remain intax -Centrosomes form within the nucleus, which is divided along with the rest of the cell during cytokinesis. -Diatoms and some yeast undergo closed mitosis

Using genome engineering, you create a fusion gene that encodes a GFP-tagged version of the POFB1 gene in the kangaroo genome. When you look at the genetically modified kangaroos under UV light, their fingers and toes are green. What do you conclude?

POFB1 is normally expressed only in kangaroos' fingers and toes

What class of enzyme removes phosphate groups from proteins?

Protein Phosphatase

Describe the role of sigma factors for RNA transcription

RNA polymerase is delivered to the gene by proteins that bind to the specific DNA sequences in the promoter. Bacterial RNA polymerase needs an accessory protein (σ) to bind at promoters and initiate transcription. Without sigma factors, the RNA cannot go to the promoter and we cannot get transcription. But after the RNA polymerase arrives at the promoter, the sigma factor can leave and the RNA polymerase can continue into transcribing the coding region. Sigma factors are not required for RNA polymerase to add NTPs, it is just necessary for it to actually bring the RNA to the gene.

How do the two pathways for DNA repair affect gene editing by CRISPR/Cas9?

Repair by NHEJ fixes the site with instances of innacurate repair and insertions/deletions which cause frameshift mutations and can inactivate the gene(knockout). Homologous recombination allows u to replace the sequence with a new sequence of your choice so it changes the gene sequence(knock in or add a GFP)

The Stages of Mitosis

S phase - DNA synthesis (replication) G2 - a gap with a checkpoint to ensure that DNA synthesis is complete. Prophase - chromosome condense Metaphase - chromosomes align Anaphase - chromosomes move to the poles Telophase - nuclei reform Cytokinesis - cell division and separation

Describe Northern Blots

Sample-->RNA extraction-->Gel Electrophoresis-->membrance transfer-->probe hybridization-->visualize RNA; this makes sure the gene is being expressed properly

Key Events in Anaphase

Shortest of the M stages Kinetochore microtubules shorten Sister chromatids separate to opposite poles. Non Kinetochore tubules lengthened, elongating the cell.

What is the purpose of a 5' cap?

The 5' cap is added by the capping enzyme so that there is no exposed 5' end and the mRNA can be protected from degradation by 5' to 3' exonucleases

Which of the following statements about protein synthesis is true? -The C terminus of the growing protein chain is attached to the 3' and of a tRNA -The N terminus of the growing protein chain is attached to the 3' and of a tRNA -The C terminus of the growing protein chain is attached to the 5' and of a tRNA -The N terminus of the growing protein chain is attached to the 5' and of a tRNA tRNAs are never attached to the growing protein chain

The C terminus of the growing protein chain is attached to the 3' and of a tRNA

Aminoacyl tRNA synthetases

There are 20 aminoacyl tRNA synthetases → each one recognizes one amino acid and all the related tRNAs. The amino acid is covalently linked to the 3 prime ends of the tRNA → so when the tRNA recognizes a specific codon, it brings along with it, the amino acid the codes for. almost 0 error

Which of the following is a common property of the sequences recognized by restriction enzymes? -They are palindromes (read the same on both strands) -They are always 7 base pairs long -They are always 5 base pairs long -They are impossible for DNA polymerases to synthesize

They are palindromes (read the same on both strands)

Which two of the following statements about transcription are true -Transcription involves the addition of NTPs to the 5' end of a growing RNA chain -Transcription makes an RNA copy of an RNA template -Transcription involves the addition of NTPs to the 3' end of a growing RNA chain -Transcription makes an RNA copy of a DNA template -Transcription makes an DNA copy of an DNA template

Transcription involves the addition of NTPs to the 3' end of a growing RNA chain Transcription makes an RNA copy of a DNA template

The Genetic Code is ...

Triplet-based Redundant and unambiguous Non-overlapping Universal

What most commonly serves as a stop codon in both prokaryotes and eukaryotes?

UAG

What tRNA anticodon (written 5'-3') could recognize a CGA codon encoding arginine? Note that the arginine codon is also written from 5'-3'

UCG

What represents the sequence of an RNA transcript for which the template strand of DNA has the sequence:GTACTGGCTAGCTGCTAGAA?

UUCUAGCAGCUAGCCAGUAC

How do we make DNA breaks in the right places for genome engineering?

We can't use restriction enzymes because they have short recognition sequences(generally 4-8 bp) so we use CRISPR/Cas9 part of a bacterial immune system that can cut DNA at essentially any sequence, guided by ~20 bp

Nonsense Substitution

When a single nucleotide change immediately creates a STOP codon, thus truncating the entire amino acid sequence ... preventing any more amino acids from being encoded.

Mis-sense substitution

When a single nucleotide is mutated results in a different amino acid being encoded. Many of these mis-sense mutations are not that bad - they quite often don't compromise the function of the protein.

Gap junctions

between adjacent cells in animals allow small molecules, ions and electrical impulses to be shared. Present in most tissues: most cells communicate with other cells → small molecules and electrical impulses can move between cells. Given cells can communicate efficiently between its immediate neighbors. Adjacent cells can also communicate with one another via surface ligands and receptors.

Describe the process of adding DNA to a plasmid

cut plasmid with restriction enzymes cut DNA to be inserted to generate compatible ends Use DNA ligase to seal up the plasmid, which now contains the insert DNA

Cytokinesis

divide the cell in two Cytokinesis occurs after the chromosomes have moved to the daughter cells.

What is needed as an energy source for all the transactions in the ribosomal unit?

hydrolysis of GTP

How many introns will there be compared to exons?

introns=exons-1

What is DNA methylation used for in eukaryotes?

it is a way to repress transcription and is referred to as epigenetic info along with histone modifications-- these create repressive chromatin environments

How do u amplify RNA?

make a cDNA copy using reverse transcription, then amplify via RT-PCR

What kind of DNA sequence does a restriction enzyme recognize?

palindromic DNA sequences- same 5' to 3' sequence on both DNA strands

Release factors in translation

recognize stop codons and promote hydrolysis of the bond between the tRNA and the completed polypeptide. Then the ribosomal components dissociate

Western blots

same procedure as northern blot but the end product is proteins bc we use an antibody for our protein of interest

Where does the ribosome bind to on a eukaryotic mRNA?

the 5' cap and scans to find the first AUG downstream

when does the trp repressor bind to the operator

when tryptophan is present- so the default state of the trp operon is ON