Test Chapter 17-19
Part A Which of the following is(are) homologous to the bones in this image?
(dark brown cat's foot)
Mastering Bio Questions
***
The sticky end of the DNA restriction fragment shown here will pair with a DNA restriction fragment with the sticky end _____. The figure shows the part of the DNA. One strand from left to right reads T G C A G A A T T C. The second strand, which is complementary to the first, reads backwards C T T A A G, excluding the first four nucleotides.
-ACGT
-Part A Which of the following statements about natural selection is true?
-Natural selection favors individuals that reproduce more than others.
Which of the findings of the Human Genome Project were contrary to initial expectations? Select all that apply. -Ninety-three percent of multi-exon human genes have alternatively spliced forms. -The human genome contains 3,000 Mb. -The human genome contains fewer than 21,000 genes.
-Ninety-three percent of multi-exon human genes have alternatively spliced forms. -The human genome contains fewer than 21,000 genes.
How do transposons differ from retrotransposons? Select all that apply: -Retrotransposons reverse the effects of transposons. -Transposons may or may not leave a copy behind at the original site, whereas retrotransposons always leave a copy behind at the original site. -Transposons move by means of a DNA intermediate, whereas retrotransposons move by means of an RNA intermediate.
-Transposons may or may not leave a copy behind at the original site, whereas retrotransposons always leave a copy behind at the original site. -Transposons move by means of a DNA intermediate, whereas retrotransposons move by means of an RNA intermediate.
Number of Genes
-euk bigger than bact -euk have number of genes small compared to size of it , maybe due to alternative splicing
Genome SIZe
-euk tend to have larger genome size -phenotype does not correlate to size
Gene Density
-euks have low gene density -bacteria have mostly expressed genes -humans dom't mostly nc, complex reg seq
Comparison Of Plant and Animal Development
-no need for morphogenesis on plants -relies on cascade of trans reg turning on off genesdevelopmental programs of plants and animals evolved seaprately mads-box in plants , hox in animals mostly
-Part A Charles Darwin _____.
-proposed natural selection as the mechanism of evolution
Emerging viruses arise by
-the spread of existing viruses more widely within their host species. -the spread of existing viruses to new host species. -mutation of existing viruses.
What is the goal of comparative genomic studies?
-to identify homologues in model organisms for genes involved in human disease. -to study how genomes evolve. -to study genetic variation within a species or a population. -to identify genes that are important for evolution of a particular species.
In a nucleotide, the nitrogenous base is attached to the sugar's _____ carbon and the phosphate group is attached to the sugar's _____ carbon. 1' ... 5' 2' ... 1' 1' ... 3' 1' ... 2' 2' ... 3'
1' ... 5' The nitrogenous base is attached to the sugar's 1' carbon and the phosphate group is attached to the sugar's 5' carbon.
Part G Darwin and Wallace made independent observations in different parts of the world. Which statements are true? Select all that apply
1)Both collected huge numbers of specimens and realized that individuals vary within species 2)Both observed slightly different species on nearby islands and concluded that species could change over time. 3)Both witnessed nature up close and realized it was a battlefield with massive casualties
Part E What does Dr. Carroll mean when he says, "while mutation is random, natural selection is not"? Select all that apply
1)Natural selection favors some mutations 2)Natural selection acts on traits 3)Mutations for advantageous traits are more likely to be passed on to the next generation
Part C - Natural selection in monkey flowers Select the three statements that are true
1)Nearly 100% of monkey flowers growing in copper-contaminated soil are copper tolerant. 2)If you were to test monkey flowers growing on the shore of the lake, you would expect nearly 100% of them to be copper tolerant 3)The population that existed before mining must have included both copper-tolerant and copper-intolerant plants
Part C After his journey on the HMS Beagle, Darwin made this now-famous sketch in his notebook. Which ideas does it represent?
1)Species descend from other species just as naturally as children come from parents 2)All species are connected to one another in a "family tree." 3)All species are linked to one another by common ancestry
Part A Identify the four postulates of natural selection. Select all that apply.
1)Survival and reproductive success are variable among individuals in a population. 2)Some trait differences are heritable. 3)Individuals with certain traits are more likely to survive and reproduce. 4)Individuals in a population vary in the traits they possess
Part B Which observations led Darwin to establish a relationship between extinct and living animals? Select all that apply.
1)The bony shells of armadillos resembled the shells of ancient Glyptodon fossils 2)The fossilized remains of giant sloths were found in places where smaller sloths now live
Part F In the lab, Nachman examined dark mice from two different populations living hundreds of miles apart. The mice looked nearly identical. Their dark color was caused by two different genes. What does this tell you?
1)Two completely different mutations in two separate genes can generate the same phenotype 2)Under very similar conditions, natural selection can favor very similar adaptations. 3)There are at least two genes involved in creating dark mouse fur 4)Dark fur color evolved independently on each lava flow
DNA fragment A consists of _____ base pairs. 564 1,268 1,405 2,027 2,322
1,268
DNA fragment A consists of _____ base pairs. The figure shows the results of gel electrophoresis. In this figure, the DNA two has three bands. The length of the first band is 4796, the length of the second is 1405, and the length of the third is 1268. Letter A indicates the second band. The third band is indicated by letter B.
1,268
DNA fragment B consists of _____ base pairs. The figure shows the results of gel electrophoresis. In this figure, the DNA two has three bands. The length of the first band is 4796, the length of the second is 1405, and the length of the third is 1268. Letter A indicates the second band. The third band is indicated by letter B.
1,405
What are the steps in the shotgun approach to whole-genome sequencing?
1. Multiple copies of the same chromosome are prepared 2. Chromosome copies are broken into 1-kb fragments 3. 1-kb fragments are cloned into plasmids 4. The plasmids are sequenced 5. A computer combines the fragmented sequences
What are the steps in the shotgun approach to whole-genome sequencing?
1. Multiple copies of the same chromosome are prepared. 2. Chromosome copies are broke into 1-kb fragments. 3. 1-kb fragments are cloned into plasmids. 4. The plasmids are sequenced. 5. A computer combines the fragment sequences.
Drag the labels to their appropriate locations in the flowchart below, indicating the sequence of events in the production of fragment B. (Note that pol I stands for DNA polymerase I, and pol III stands for DNA polymerase III.)
1. Pol III binds to 3' end of primer B 2. Pol III moves 5' to 3', adding DNA nucleotides to primer B 3. Pol I binds to 5' end of polymer A 4. Pol I replaces primer A with DNA 5. DNA ligase links fragments A and B
Approximately what proportion of the DNA in the human genome codes for proteins or functional RNA?
1.5%
Identify all correct statements about the ionization of water.
1.Dissociation of water is reversible. 2.Dissociation of water produces equal numbers of OH- and H+. 3.Water ionizes to form hydroxide and hydronium ions.
In how many positions are there nucleotide differences between your query sequence and the sequence of accession AY259214.1?
10
In how many positions are there nucleotide differences between your query sequence and the sequence of accession AY259214.1? 3 4 9 10 12
10
What percent identity is implied by the dashes?
100% identity
Repetitive DNA
15% of genome 5% long dna 10,000 - 300k bp, simple sequence dNA of tandem repeats, 2to 5 nucs STR, also satellite DNA when centrifuged, centromeric and telomeric DNA
On which chromosome is the BCR gene normally located?
22
On which chromosome is the BCR gene normally located? 1 9 20 22
22
Most stable to least stable with amount of bonds
3 bonds is most stable, 1 bond is least stable
If a strand of DNA has the nitrogen base sequence 5'-ATTTGC-3', what will be the sequence of the matching strand? 3'-UAAACG-5' 3'-ATTTGC-5' 3'-TAAACG-5' 3'-GCAAAT-5' 3'-TUUUCG-5'
3'-TAAACG-5'
How many DNA molecules would there be after four rounds of PCR if the initial reaction mixture contained two molecules?
32
Bacteriophages were grown in a medium containing radioactive sulfur (35S) and radioactive phosphorous (32P), which are incorporated into proteins and DNA, respectively. If these phages were used to infect a bacterial culture, which isotope would be detected within the infected bacteria?
32P
Hershey and Chase used _____ to radioactively label the T2 phage's proteins. 32P 35S 222Ra 14C 92U
35S
Write the complementary sequence for the following DNA sequence, in order from 3' to 5': 5′−CGATATTGAGCTAAGCTT−3′
3′− GCTATAACTCGATTCGAA −5′
Imagine that a prokaryote-like organism has been discovered in the polar ice on Mars. Interestingly, these Martian organisms use the same DNA → RNA → protein system as life on Earth, except that there are only 2 bases (A and T) in the Martian DNA, and there are only 17 amino acids found in Martian proteins. Based on this information, what is the minimum size of a codon for these hypothetical Martian life-forms? 2 bases 3 bases 4 bases 5 bases 6 bases The answer cannot be determined from the information provided.
5 bases In the most general case of x bases and y bases per codon, the total number of possible codons is equal to xy . In the case of the hypothetical Martian life-forms, is the minimum codon length needed to specify 17 amino acids is 5 (25 = 32), with some redundancy (meaning that more than one codon could code for the same amino acid). For life on Earth, x = 4 and y = 3; thus the number of codons is 43, or 64. Because there are only 20 amino acids, there is a lot of redundancy in the code (there are several codons for each amino acid).
Nucleic acids are assembled in the _____ direction. 1' to 5' 5' to 3' 2' to 3' 5' to 1' 4' to 5'
5' to 3'
Which of the following percent identities is a good cut-of value separating within-family parings from between-family pairings?
50%
In this example the marker DNA includes fragments that have 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, and 564 base pairs. Approximately how many base pairs are in the DNA fragment indicated by the letter A? The figure shows the results of gel electrophoresis. In this figure, the marker DNA has seven bands; their lengths are 23130, 9416, 6557, 4361, 2322, 2027, and 564 base pairs respectively. The first researched DNA has two bands. The first, indicated by the letter A, complies to the third band of the marker DNA and the second is located between the sixth and the seventh bands of the marker DNA. The second researched DNA has three bands. The first, indicated by the letter B, is located between the third and the fourth bands of the marker DNA and two others are located between the sixth and the seventh bands.
6,557
Approximately how many people worldwide are infected with AIDS?
60 Million
homeodomain
60 amino acids length, binds to DNA when prtoein is a trans reg, can bind to and seg of DNA, but other domains in the protein control wha it binds to
How many people world wide are infected with AIDS?
60 million
If a DNA double helix is 100 nucleotide pairs long and contains 25 adenine bases, how many guanine bases does it contain? 25 200 50 75 150
75
What is the precent identity between the β and ε globin sequences?
76%
Which segment of the normal ABL protein aligns with the query sequence? Provide your answer in this format: number of first amino acid, number of last amino acid. (For example, if the first amino acid is 23 and the last amino acid is 413, enter 23, 413.)
80,246
A farmer wishes to develop a strain of high-yield corn that is also resistant to drought. He has the following individuals from the current year's crop: Individual A—Yield: 179 bushels/acre; drought resistance: high Individual B—Yield: 220 bushels/acre; drought resistance: low Individual C—Yield: 185 bushels/acre; drought resistance: medium Individual D—Yield: 140 bushels/acre; drought resistance: high Individual E—Yield: 200 bushels/acre; drought resistance: medium Which of the following crosses would produce the highest corn yield with the highest resistance to drought?
A and E
Part F A farmer wishes to develop a strain of high-yield corn that is also resistant to drought. He has the following individuals from the current year's crop: Individual A—Yield: 179 bushels/acre; drought resistance: high Individual B—Yield: 220 bushels/acre; drought resistance: low Individual C—Yield: 185 bushels/acre; drought resistance: medium Individual D—Yield: 140 bushels/acre; drought resistance: high Individual E—Yield: 200 bushels/acre; drought resistance: medium Which of the following crosses would produce the highest corn yield with the highest resistance to drought?
A and E
Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus? A translation stop codon is added at the 3' end of the pre-mRNA. A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA. Coding sequences called exons are spliced out by ribosomes. A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA. Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes.
A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA. A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA. Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes.
What happens when two atoms form a chemical bond?
A chemical bond forms when two atoms transfer or share outer electrons to complete their outer shells.
Part D Which of the following organisms could be produced by artificial selection?
A cow that produces a large quantity of milk
Which of the following organisms could be produced by artificial selection?
A cow that produces a large quantity of milk
Which of these is currently considered the best definition of a gene? A gene codes for either a polypeptide or an RNA molecule. A gene codes for a single protein. A gene codes for a single enzyme. A gene codes for a particular ribozyme. A gene codes for a single polypeptide.
A gene codes for either a polypeptide or an RNA molecule.
Which of the following statements about mutations is false? Addition and deletion mutations disrupt the primary structure of proteins. A deletion mutation results in the loss of a base in the DNA sequence. An addition mutation results in an added base in the DNA sequence. A knock-out mutation results in a total absence of the mutated protein.
A knock-out mutation results in a total absence of the mutated protein.
Which of the following is characteristic of the lytic cycle?
A large number of phages are released at a time. Destroying the host cell
What is the polymerase chain reaction (PCR)?
A method to amplify a fragment of DNA (PCR is an in vitro DNA synthesis reaction that produces many copies of a single DNA fragment.)
What is genetic cloning?
A method to produce many copies of a gene
The H1N1 2009 outbreak is considered to have been which of the following?
A pandemic.
Your dog is lacking syncytin. It will not be able to properly form what?
A placenta
horizontal transmission
A plant is infected with a virus by an external source.
You are an epidemiologist studying a new disease very similar to AIDS. Most likely, this new disease is caused by what?
A retrovirus
Which statements about viruses are true?
A retrovirus contain both DNA and RNA; The capsid enters the host cell if the virus is enveloped; Enveloped viruses bud from the host cell; HIV contains reverse transcriptase;
Select the most accurate statement about the interaction between a tree and its physical environment.
A tree and its physical environment alter each other.
Which of the following would not typically cause a proto-oncogene to become an oncogene?
A.gene suppression
Each of a group of bacterial cells has a mutation in its lacoperon. Which of these will make it impossiblefor the cell to metabolize lactose?
A.mutation in lac(-galactosidase gene)
The photograph shows Rainbow and CC (CC is Rainbow's clone). Why is CC's coat pattern different from Rainbow's given that CC and Rainbow are genetically identical?
A.random X chromosome inactivationB.heterozygous at coat color gene locusC.environmental effects on gene expression
Which molecule is a nucleotide?
ATP
Which of the following events stimulates the production of viral particles in a host cell?
Activation of the host cell by cytokines, growth factors, or antigens. -Activation of the host immune cell by cytokines, growth factors, or antigens causes viral DNA to be transcribed at high rates in preparation for viral production.
_____ bind(s) to DNA enhancer regions. RNA polymerase Promoters Introns Activators Exons
Activators
Part B Which term describes a trait that increases an individual's ability to survive in a particular environment?
Adaptation
Which term describes a trait that increases an individual's ability to survive in a particular environment?
Adaptation
Which of the following enzymes converts ATP to cAMP? ATP synthase b-galactosidase Adenylyl cyclase Galactoside permease
Adenylyl cyclase
A population of zooplankton is exposed to a small number of predatory fish that feed on the larger-sized (adult) zooplankton. Which of the following predictions would most likely occur based on the principles of natural selection?
Adult zooplankton will start to reach sexual maturity when they are still relatively small.
In which section of the search results can you find nucleotide-by-nucleotide comparisons between your query sequence and similar database sequences? Graphic Summary Descriptions Alignments
Alignments
The universal genetic language of DNA is common to virtually all organisms on Earth, however diverse. What is the best explanation for this fact?
All living things share a common genetic language of DNA because they share a common ancestry.
What is the goal of comparative genomic studies? to study genetic variation within a species or a population to study how genomes evolve to identify genes that are important for evolution of a particular species to identify homologues in model organisms for genes involved in human disease All of the above are goals of comparative genomic studies.
All of the above are goals of comparative genomic studies.
Why are viruses called obligate intracellular parasites? They must use a host cell's metabolic enzymes and pathways to obtain energy. They must use a host cell's nucleotides for transcription and replication. They must use a host cell's ribosomes to synthesize proteins. They must use a host cell's amino acids to synthesize proteins. All of the above.
All of the above.
Part D Darwin and Wallace independently arrived at the same conclusion that species change over time. Which observations supported their conclusions? Select all that apply.
All of them are correct
Sequences Related to Transpo Elements
Alu elements - 10% genome 300nucs function unkown L1- 6,5000bp low rate of transpo cuz its sequences block rna poly from it moving, reg gene exp
Identify the functional groups.
Amino and carboxyl are functional groups.
If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred? None. A deletion mutation. An addition mutation and a deletion mutation. An addition mutation
An addition mutation and a deletion mutation.
Which statement about relative potential energy of electrons is correct?
An electron in the 3 p orbital of the third electron shell has more potential energy than an electron in the 2 p orbital of the second electron shell.
What does the term electron orbital describe?
An electron orbital describes a three-dimensional space where an electron can be found 90% of the time.
All of the statements below are true. Select the statement that best supports the view of most biologists that viruses are nonliving.
An isolated virus is unable to replicate its genes or regenerate ATP.
All of the statements below are true. Select the statement that best supports the view of most biologists that viruses are nonliving. The viral genome may be single-stranded or double-stranded RNA or DNA. An isolated virus is unable to replicate its genes or regenerate ATP. Viruses are obligate intracellular parasites.
An isolated virus is unable to replicate its genes or regenerate ATP.
Which of the following statements best defines the term operon? An operon is a region of DNA that codes for a series of functionally related genes under the control of the same promoter. An operon is a region of DNA that consists of a single gene regulated by more than one promoter. An operon is a region of RNA that consists of the coding regions of more than one gene. An operon is a region of DNA that codes for sugar-metabolizing enzymes.
An operon is a region of DNA that codes for a series of functionally related genes under the control of the same promoter.
During which step in the PCR cycle do primers form bonds with a single-stranded template?
Annealing. (Primers form hydrogen bonds with the single-stranded DNA template during the annealing step.)
Why is it ineffective to treat viral disease with antibiotics?
Antibiotics inhibit enzymes specific to bacteria and have no effect on virally encoded enzymes.
Why is it ineffective to treat viral disease with antibiotics? Due to excessive antibiotic use, most viruses have evolved to be resistant to antibiotics. Antibiotics inhibit enzymes specific to bacteria and have no effect on virally encoded enzymes. Pathogenic RNA viruses have a high rate of mutation, producing new genetic varieties that are insensitive to antibiotic treatment. SubmitMy AnswersGive Up
Antibiotics inhibit enzymes specific to bacteria and have no effect on virally encoded enzymes.
The scala naturae, or scale of nature, is based on the ideas of _____.
Aristotle
Which of the following people developed the idea known as the scala naturae, or scale of nature?
Aristotle
This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is common to both the victim and Suspect 1?
B (A visual comparison of the gel electrophoresis results should reveal that Suspect 1 has a DNA fragment that matches victim DNA fragment B.)
Examine the descriptions for the group of hits that align with the N-terminal end of the query sequence. Which of the following terms are found among these descriptions? Select all that apply. BCR variant breakpoint cluster region unnamed protein product
BCR variant breakpoint cluster region unnamed protein product
NCBI provides
BLAST, a database of protein structures, and Genbank
Cycles
Bacteriophages, which contain double-stranded DNA, can reproduce by two alternative mechanisms: the lytic cycle and the lysogenic cycle. •In the lytic cycle, virus parts are made, new viruses are assembled, and the cell is lysed, releasing the newly assembled viruses. •In the lysogenic cycle, the viral DNA incorporates into the bacterial DNA and is passed on to daughter bacterial cells when the infected bacteria reproduce normally. Occasionally, an infected bacterium in the lysogenic cycle can enter the lytic cycle, in which viral particles are produced and the cell is eventually ruptured.
Transposons were discovered by which of the following scientists?
Barbara McClintock
To cause a human pandemic, the H5N1 avian flu virus would have to:
Become capable of human-to-human transmission.
AIDS can be contracted by contact with which of the following?
Blood or semen
What happened in the soapberry bug population in central Florida when the bugs began to feed on smaller goldenrain tree fruits?
Bugs with shorter beaks had more access to food, allowing them to produce more offspring.
This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is common to both the victim and Suspect 2?
C (A visual comparison of the gel electrophoresis results should reveal that Suspect 2 has a DNA fragment that matches victim DNA fragment C.)
Part A - Identifying the elements of hypothesis-based science This experiment is an example of hypothesis-based science. What question did the researchers ask?
Can predation result in selection for color patterns in guppies?
This experiment is an example of hypothesis-based science.
Can predation result in selection for color patterns in guppies?
The nucleic acid of a virus particle is enclosed in a protein coat. What is it called?
Capsid
HIV evolved from a virus that infected what species?
Chimpanzee
How are genes coordinately controlled in eukaryotic cells? Select all that apply. Coordinately controlled genes in eukaryotic cells share a set of control elements. Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals. Coordinately controlled genes in eukaryotic cells are located together on the same chromosome.
Coordinately controlled genes in eukaryotic cells share a set of control elements. Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals.
The modern idea of extinction as a common occurrence in Earth's history was 1st proposed in the early 19th century writings of
Cuvier
The modern idea of extinction as a common occurrence in Earth's history was first proposed in the early 19th century writings of _____.
Cuvier
The radioactive isotope 32P labels the T2 phage's _____. protein coat base plate head DNA tail
DNA
Which of these is a difference between a DNA and an RNA molecule? DNA is a polymer composed of nucleotides, whereas RNA is a polymer composed of nucleic acids. DNA contains uracil, whereas RNA contains thymine. DNA is usually double-stranded, whereas RNA is usually single-stranded. DNA contains five-carbon sugars, whereas RNA contains six-carbon sugars. DNA contains nitrogenous bases, whereas RNA contains phosphate groups.
DNA is usually double-stranded, whereas RNA is usually single-stranded.
What enzyme forms covalent bonds between restriction fragments?
DNA ligase (DNA ligase catalyzes the formation of covalent bonds between restriction fragments.)
Which of the following tools of recombinant DNA technology is incorrectly paired with its use? reverse transcriptase - production of cDNA from mRNA DNA ligase - enzyme that cuts DNA, creating the sticky ends of restriction fragments electrophoresis - separation of DNA fragments restriction enzyme - production of RFLPs DNA polymerase - used in a polymerase chain reaction to amplify sections of DNA
DNA ligase - enzyme that cuts DNA, creating the sticky ends of restriction fragments
How did Hutton and Lyell's ideas influence Darwin's thinking?
Darwin reasoned that the Earth must be very old and that slow, subtle processes could produce substantial biological changes
Which of the following statements about Darwin following the voyage of HMS Beagle is incorrect?
Darwin thought the Earth was a few thousand years old.
Which of the following mutations would likely be most dangerous to a cell? Which of the following mutations would likely be most dangerous to a cell? Deletion of three nucleotides Deletion of one nucleotide Substitution of one nucleotide for another
Deletion of one nucleotide
If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred? None. Both addition and deletion. Addition. Deletion.
Deletion.
What is the meaning of Darwin's expression "descent with modification"?
Descent with modification refers to evolutionary change over time.
Part A - Scientific evidence supporting evolution Scientific evidence documents the pattern of evolution. The evidence exists in a variety of categories, including direct observation of evolutionary change, the fossil record, homology, and biogeography. Sort the following examples into the correct categories. Drag each phrase to the appropriate bin.
Direct observation of evolutionary change: Development of drug resistance in bacteria fossil record: discovery of transitional form of horses, discovery of shells of extinct species homology: same genetic code in fireflies and tobacco plants, similarities in mammalian forelimbs, vestigial pelvis in right whales Biogeography: the high concentration of marsupial species in Australia, similarity of endemic island species to nearby mainland species
Which of the following is an example of convergent evolution?
Dolphins and sharks have a similar fusiform (streamlined) body shape.
Your brother died of a heart attack at age 47. Assuming no other risk factors, what does this do to your chance of developing heart disease? Nothing. Doubles it. Triples it. Quadruples it.
Doubles it.
Which of these DNA molecules is the shortest?
E (The shorter the DNA molecule, the farther it moves.)
Which statement about isomers is correct?
Enantiomers differ in biological activity.
Select the correct statement(s) about genome size and density. Select all that apply. -Within eukaryotes, genome size is a reliable predictor of phenotypic complexity. -Eukaryotic genomes are larger than prokaryotic genomes. -Eukaryotes have higher gene densities than prokaryotes.
Eukaryotic genomes are larger than prokaryotic genomes.
Animals that posses homologous structures probably ______
Evolved from the same ancestor
Know what's in Exclusively DNA Both RNA & DNA Exclusively RNA
Exclusively DNA- Deoxyribose & Thymine Both RNA & DNA- Guanine, Adenine, Cytosine, & Phosphate Exclusively RNA- Ribose & Uracil
During which step in the PCR cycle are nucleotides used?
Extension. (Nucleotides are used to synthesize the complementary strand to the DNA template during the extension step.)
True or false? A codon is a group of three bases that can specify more than one amino acid. True False
False
True or false? The mechanism by which glucose inhibits expression of the lac structural genes is known as catabolite stimulation, whereas the mechanism by which lactose stimulates expression of the lac structural genes is known as allosteric regulation. True False
False
True or false? The Taq enzyme is a type of DNA polymerase that allows researchers to separate the DNA strands during the annealing step of the PCR cycle without destroying the polymerase.
False (Taq polymerase is derived from a species of bacteria living in hot springs, which makes it stable at the high temperature required for the denaturation step of PCR.)
True or false? The use of growth hormone isolated from cadavers was banned mainly because there were not enough cadavers to supply the hormone.
False (The use of growth hormone isolated from cadavers was banned mainly because the isolated hormone was potentially contaminated with prion proteins.)
True or false? The human immunodeficiency virus (HIV) uses reverse transcriptase to make double-stranded RNA copies of its DNA genome.
False -A retrovirus such as HIV has an RNA genome and uses reverse transcriptase to make double-stranded DNA copies of the genome, which can then be integrated into the host cell's genome.
True or false? The human immunodefiency virus (HIV) uses reverse transcriptase to make double stranded RNA copies of its DNA genome.
False.
Part B The wing of a bat is homologous to the _____ of a whale.
Flipper
How long must AIDS patients take their medication?
For the rest of their life.
If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides: 5' - ACTACGTGA - 3' Frameshift Mutation Base substitution mutation
Frameshift Mutation- 5' ACTTACGTGA 3' & 5' ACTCGTGA 3' Base substitution mutation- 5' ACTAAGTGA 3' & 5' ACTACGTGT 3'
The "ingredients" for PCR and for the dideoxy chain-termination method of DNA sequencing are both similar and include __________.
Free nucleotides, DNA polymerase, DNA primers (If DNA polymerase encounters a DNA template strand with a primer attached to it, and free nucleotides are available, DNA synthesis will proceed.)
Which kingdom does Hypocreales belong to? Fungi Eukaryota Dikarya Animalia
Fungi
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence? Sequences of DNA fragments GATGAC CGATGCG GGCGTCAG GACATGGC TCAGTCGA
GATGACATGGCGTCAGTCGATGCG
Which of these genes codes for a protein that plays a role in growth?
GH1 ("GH" stands for growth hormone.)
Which of the following must exist in a population before natural selection can act upon that population?
Genetic Variation among individuals
Which of the following characteristics, structures, or processes is common to both bacteria and viruses?
Genetic material composed of nucleic acid.
Paleontology, the study of fossils, was developed by
Georges Cuvier
Which of these binds to receptor molecules on the host cell membrane?
Glycoproteins on the viral envelope recognize and bind to receptors on the host cell.
Forms of the Ras protein found in cancerous tumors usually cause which of the following?
Growth factor signaling to be hyperactive, ultimately leading to increased cell division
How does HIV cause disease?
HIV kills cells that defend the body against disease.
How does HIV cause disease?
HIV kills cells that defend the body against disease. -HIV affects the immune system and kills cells that protect the body from foreign bacteria and viruses.
The HIV virus attacks only a certain type of white blood cells, and not other cell types. Why?
HIV receptors are not found on the other cell types.
Which of the following is a true statement about Charles Darwin?
He proposed natural selection as the mechanism of evolution.
Sort the phrases into the appropriate bins depending on which protein they describe. Helicase Topoisomerase Single-strand binding protein
Helicase-binds at the replication fork & breaks H-bonds between bases Topoisomerase-binds ahead of the replication fork & breaks covalent bonds in DNA backbone Single-strand binding protein-binds after the replication fork & prevents H-bonds between bases
Part C Which term describes the ability of a trait to be passed on to offspring?
Heritability
Which term describes the ability of a trait to be passed on to offspring?
Heritability
Part B Which of the following statements is an accurate combination of postulates 1 and 2 of natural selection?
Heritable variation exists for traits among individuals in a population.
Who demonstrated that DNA is the genetic material of the T2 phage? Hershey and Chase Franklin Meselson and Stahl Watson and Crick Darwin and Wallace
Hershey and Chase
Which enzyme(s) will produce a DNA fragment that contains the entire vgp gene (shown in red) and has "sticky ends"? Select all that apply.
HindIII BamHI (Cloning the vgp gene requires an enzyme that has restriction sites on both sides of that gene but not within the gene. Two enzymes, HindIII and BamHI, satisfy that requirement, while also producing DNA fragments that have sticky ends. Sticky ends make it possible for the fragments to combine with the DNA of a cloning vector, such as a plasmid.)
Which of the following has the largest genome and the fewest genes per million base pairs? Saccharomyces cerevisiae (yeast) Haemophilus influenzae (bacterium) Arabidopsis thaliana (plant) Homo sapiens (human) Drosophila melanogaster (fruit fly)
Homo sapiens (human)
What is the source of a viral envelope?
Host cell membrane.
RNA viruses require their own supply of certain enzymes because
Host cells lack enzymes that can replicate the viral genome
What are Hox genes?
Hox genes encode transcription factors with a DNA-binding domain called a homeo box, and regulate development of the vertebrate body plan (Hox genes and their functions have been highly conserved throughout the animal kingdom.)
What are Hox genes?
Hox genes encode transcription factors with a DNA-binding domain called a homeo box, and regulate development of the vertebrate body plan.
What are Hox genes? Hox genes encode transcription factors with a DNA-binding domain called a homeo box, and regulate development of the vertebrate body plan. Hox genes are transcription factors that bind to specific DNA sequences called homeodomains. Hox encode transcription factors that respond to steroids. Hox genes regulate flower development. Hox genes regulate sex determination in mammals.
Hox genes encode transcription factors with a DNA-binding domain called a homeo box, and regulate development of the vertebrate body plan.
The human genome consists of approximately 21,000 genes, which is only slightly more than the genome of the nematode Caenorhabditis elegans, which has 20,100 genes. How can 2 organisms with similar numbers of genes be so different in overall complexity?
Human genes typically contain multiple exons, which can be spliced together in different ways, leading to the production of many more proteins than the number of proteins in the nematode; extensive RNA splicing, which generates more than 1 polypeptide from a single gene, occurs in humans but is not typically seen in nematodes; post-translational modifications of proteins are more common in humans than in nematodes; RNAs that play regulatory roles in humans are not typically present in nematodes
Nucleotides are added to a growing DNA strand as nucleoside triphosphates. What is the significance of this fact? Nucleoside triphosphates are more abundant in the cell than nucleotides. Nucleoside triphosphates are more easily transported in the cell than are nucleotides. Hydrolysis of the two phosphate groups (P-Pi) and DNA polymerization are a coupled exergonic reaction.
Hydrolysis of the two phosphate groups (P-Pi) and DNA polymerization are a coupled exergonic reaction.
Which of the following is true? If a person has early heart disease, their female children will have it while their male children will not. If a person has early heart disease, their children may or may not have it. If a person has early heart disease, all of their children will have it. If a person has early heart disease, their male children will have it while their female children will not.
If a person has early heart disease, their children may or may not have it.
Part D When dark-colored fur gives mice a 1% competitive advantage and 1% of the population begins with dark fur, in about 1000 years, 95% of the population will have dark fur. Which of the following statements is true?
If dark-colored rock pocket mice had a competitive advantage of 0.1%, it would take longer for 95% of the population to have dark fur
What is allosteric regulation? In allosteric regulation, genes are expressed constitutively. In allosteric regulation, a small molecule binds to a large protein and causes it to change its shape and activity. In allosteric regulation, a gene is turned off by a repressor protein. In allosteric regulation, a gene is turned on by an activator protein.
In allosteric regulation, a small molecule binds to a large protein and causes it to change its shape and activity.
Which statement(s) about inducible operons is/are correct? Select all that apply. Inducible enzymes generally function in synthetic pathways that produce end products from raw materials. In an inducible operon, the repressor is synthesized in an active form. In an inducible operon, an inducer inactivates the repressor.
In an inducible operon, the repressor is synthesized in an active form. In an inducible operon, an inducer inactivates the repressor.
What are the steps in the shotgun approach to whole-genome sequencing?
In shotgun sequencing, the DNA from many copies of an entire chromosome is cut into fragments. The fragments are inserted into plasmids and cloned in bacteria. Plasmid DNA is isolated from the bacteria, purified, and sequenced. Finally, a computer assembles the fragment sequences into the continuous sequence of the whole chromosome, based on overlap between the fragments.
How does the alignment of the FN397219.1 sequence to your query sequence compare to the alignment of the AY259214.1 sequence you examined in Part F?
In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps.
How does the alignment of the FN397219.1 sequence to your query sequence compare to the alignment of the AY259214.1 sequence you examined in Part F? The two alignments are identical. In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps. In the FN397219.1 alignment, there are more nucleotide differences but the same number of gaps. In the FN397219.1 alignment, there are more nucleotide differences and more gaps. In the FN397219.1 alignment, there are fewer nucleotide differences and fewer gaps.
In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps.
Annotation of the human genome sequence reveals a discrepancy between the number of protein-coding genes and the number of predicted proteins actually expressed by the genome. Proteomic analysis indicates that human cells are capable of synthesizing more than 100,000 different proteins and perhaps three times this number. What is the discrepancy, and how can it be reconciled?
Increased protein production from approximately 20,000 genes is probably related to alternative splicing and various posttranslational processing schemes. In addition, a particular DNA segment may be read in a variety of ways and in two directions.
Part C Which of the following statements is an accurate combination of postulates 3 and 4 of natural selection?
Individuals experience differential success in their ability to survive or reproduce due to differences in certain traits
Which enzyme inserts viral DNA into the host's chromosomal DNA?
Integrase inserts viral DNA into the host's chromosomal DNA.
Which enzyme inserts viral DNA?
Integrase.
It has been observed that organisms on islands are different from, but closely related to, similar forms found on the nearest continent. This is taken evidence that
Island forms and mainland forms descend from common ancestors
What is the function of reverse transcriptase?
It catalyzes the formation of DNA from an RNA template.
What is the function of reverse transcriptase? It catalyzes the formation of a polypeptide from an RNA template. It catalyzes the formation of DNA from a polypeptide template. It catalyzes the formation of RNA from a polypeptide template. It catalyzes the formation of RNA from a DNA template. It catalyzes the formation of DNA from an RNA template.
It catalyzes the formation of DNA from an RNA template.
What is the function of reverse transcriptase?
It catalyzes the formation of DNA from an RNA template. -This is the function of reverse transcriptase.
Which of the following would not be true of cDNA produced using human brain tissue as the starting material?
It could be used to create a complete genomic library.
Based on the information given in the three different sections, which of the following statement(s) correctly describe(s) the hit that is most similar to the query sequence? Select all that apply.
It is a chimeric protein. Its accession number is CAM33009.1. It is identical to the query sequence in length and amino acid sequence.
Based on the information given in the three different sections, which of the following statement(s) correctly describe(s) the hit that is most similar to the query sequence? Select all that apply. It is identical to the query sequence in length and amino acid sequence. It is a chimeric protein. Its accession number is CAM33009.1. It contains a total of 491 amino acids.
It is identical to the query sequence in length and amino acid sequence. It is a chimeric protein. Its accession number is CAM33009.1.
Select the correct statement about the process of scientific inquiry.
It is possible to test hypotheses, such as those involving historical events, without conducting experiments.
Folk singer Woody Guthrie died of Huntington's disease, an autosomal dominant disorder. Which statement below must be true?
It is very likely that at least one of Woody Guthrie's parents also have had the allele for Huntington's disease. (Unless the disease is caused by a new mutation, which is quite rare, individuals with a dominant condition must have inherited the dominant allele from one of their parents. As it happens, Guthrie's mother also died of Huntington's disease.)
Which of the following statements best describes the function of reverse transcriptase?
It makes complementary DNA (cDNA) from mRNA.
How has gene duplication played a critical role in evolution?
It produces redundant copies of existing genes, which are then free to mutate and adopt new functions.
How has gene duplication played a critical role in evolution? It increases the amount of DNA in the genome. It almost always introduces immediate benefits for the organism. It increases the likelihood of viral infection in cells. It increases the number of pseudogenes in the genome. It produces redundant copies of existing genes, which are then free to mutate and adopt new functions.
It produces redundant copies of existing genes, which are then free to mutate and adopt new functions.
What is the function of reverse transcriptase in retroviruses?
It uses viral RNA as a template for DNA synthesis.
The operon model of the regulation of gene expression in bacteria was proposed by _____. Watson and Crick Franklin Darwin Jacob and Monod Mendel
Jacob and Monod
Which of the following is true?
Kaposi's sarcoma is a symptom of AIDS.
What defect causes pituitary dwarfism?
Lack of growth hormone
Part E Which pair of chickens should a farmer breed to produce larger chickens?
Large hen, large rooster
Which pair of chickens should a farmer breed to produce larger chickens?
Large hen, large rooster
Drag each phrase to the appropriate bin depending on whether it describes the synthesis of the leading strand, the synthesis of the lagging strand, or the synthesis of both strands. Leading strand Laggin strand Both strands
Leading strand- daughter strand elongates toward replication fork, only one primer needed, & made continuously. Laggin strand- daughter strong elongates away from replication fork, multiple primers needed, & made in segments. Both strands- synthesized 5' to 3'.
What happens first when a phage infects a bacterial cell and is going to enter a lysogenic cycle?
Linear DNA circularizes.
In order to determine the probable function of a particular sequence of DNA in humans, what might be the most reasonable approach? Prepare a genetically engineered bacterial culture with the sequence inserted and assess which new protein is synthesized. Genetically engineer a mouse with a copy of this sequence and examine its phenotype. Look for a reasonably identical sequence in another species, prepare a knockout of this sequence in that species, and look for the consequences. Mate two individuals heterozygous for the normal and mutated sequences.
Look for a reasonably identical sequence in another species, prepare a knockout of this sequence in that species, and look for the consequences.
Which replicative cycle describes a virus that can integrate its genome into the host cell's genome?
Lysogenic -A lysogenic virus can integrate its genome into the host cell's genome and be duplicated by the host cell's replication machinery.
Which replicative cycle describes a virus that can integrate its genome into the host cell?
Lysogenic.
Classify each phrase as applying to the lytic cycle, the lysogenic cycle, or both types of reproductive cycles of phages.
Lytic: new phages are assembled from viral DNA and proteins, the cell is lysed, & the host is destroyed Lysogenic: the cell reproduces normally, & The viral dna integrates into the chromosome of the host cell Both: viral genes are replicated
Which of these genes codes for a protein that plays a role in white blood cell function?
MPO (This gene codes for a protein that plays a role in white blood cell function)
Imagine a species of bird in which females prefer to mate with brightly colored males. However, males with bright backs are more often preyed upon by hawks. Assuming that a wide variety of genetic variation exists in the species, which do you think is the most likely evolutionary outcome?
Males will be selected to have bright chests and dull backs.
Part E What did Wallace conclude from observing that the bones in manatee flippers look similar to the bones in a human arm and hand?
Manatees' arm and finger bones are evidence that manatees share a common ancestor with land mammals.
Which of the following is a key observation that must be explained in a unifying theory about life?
Many basic characteristics are shared by all living things.
if an adaptation is defined as a trait that promotes survival or reproduction, which of the following traits would qualify as an adaptation?
Many desert plants have leaves shaped like needles.
Identify the pair of homologous structures.
Maple leaf and Oak leaf
Identify the pair of homologous structures.
Maple leaf and oak leaf
Which of the following steps would be performed last when screening a cDNA library?
Match the region of radioactivity on the filter with the corresponding plate
Which of the following observations led to Darwin's major inferences?
Members of a population vary in their heritable traits. Although organisms can produce huge numbers of offspring, many of these offspring do not survive.
Translation for mRNA 5′−AUGGCAAGAAAA−3′
Met-Ala-Arg-Lys An amino acid sequence is determined by strings of three-letter codons on the mRNA, each of which codes for a specific amino acid or a stop signal. The mRNA is translated in a 5' → 3' direction.
What amino acid sequence does the following DNA nucleotide sequence specify? 3′−TACAGAACGGTA−5′
Met-Ser-Cys-His Before mRNA can be translated into an amino acid sequence, the mRNA must first be synthesized from DNA through transcription. Base pairing in mRNA synthesis follows slightly different rules than in DNA synthesis: uracil (U) replaces thymine (T) in pairing with adenine (A). The codons specified by the mRNA are then translated into a string of amino acids.
Which of the following statements about genome sizes is true?
Most eukaryotes have larger genomes than most prokaryotes.
Which of the following statements about genome sizes is true? Most eukaryotes have larger genomes than most prokaryotes. Large animals have larger genomes than plants. Species within a phylogenetic group such as flowering plants or insects have similar genome sizes. The human genome is the largest and most complex. All of the above statements are true.
Most eukaryotes have larger genomes than most prokaryotes.
Which of the following statements about genome sizes is true? Large animals have larger genomes than plants. Species within a phylogenetic group such as flowering plants or insects have similar genome sizes. Most eukaryotes have larger genomes than most prokaryotes. The human genome is the largest and most complex. All of the above statements are true.
Most eukaryotes have larger genomes than most prokaryotes.
Which of the following statements about genome sizes is true? The human genome is the largest and most complex. Large animals have larger genomes than plants Most eukaryotes have larger genomes than most prokaryotes. Species within a phylogenetic group such as flowering plants or insects have similar genome sizes All of the above statements are true
Most eukaryotes have larger genomes than most prokaryotes. (The only exceptions may be intracellular parasites whose genomes have undergone reduction because they are dependent on their hosts for many functions.)
The average length of a transcription unit along a eukaryotic DNA molecule is about 27,000 nucleotide pairs, whereas an averaged-sized protein is about 400 amino acids long. What is the best explanation for this fact? Each amino acid in a protein is encoded by a triplet of nucleotides. Many genes are subject to alternative RNA splicing. Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that are not translated.
Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that are not translated.
Part A When Charles Darwin set sail on the HMS Beagle, what did he and most of his contemporary scientists think about the origin of species?
Most scientists, including Darwin, thought each species was specially created by God in its present form and did not change over time
In this activity, you will examine three different mutations. Wild- type- DNA-3' CTT 5' - 5' GAA 3' RNA- 5' GAA 3' Amino acid- GLU Type of mutation- N/A Effect on polypeptide- Normal Mutant 1- DNA-3' CAT 5' - 5' GTA 3' RNA- 5' GUA 3' Amino acid- Type of mutation- Effect on polypeptide- Mutant 2- DNA-3' CTC 5' - 5' GAG 3' RNA- 5' GAG 3' Amino acid- Type of mutation- Effect on polypeptide- Mutant 3- DNA-3' ATT 5' - 5' TAA 3' RNA- 5' UAA 3' Amino acid- Type of mutation- Effect on polypeptide-
Mutant 1- DNA-3' CAT 5' - 5' GTA 3' RNA- 5' GUA 3' Amino acid- VAL Type of mutation- Substitution Effect on polypeptide- Missense Mutant 2- DNA-3' CTC 5' - 5' GAG 3' RNA- 5' GAG 3' Amino acid- GLU Type of mutation- Substitution Effect on polypeptide- Silent Mutant 3- DNA-3' ATT 5' - 5' TAA 3' RNA- 5' UAA 3' Amino acid- STOP Type of mutation- Substitution Effect on polypeptide- Nonsense
Which of the following statements about natural selection is true?
Natural selection favors individuals that reproduce more than others.
Which of the findings of the Human Genome Project were contrary to initial expectations? Select all that apply. Ninety-three percent of multi-exon human genes have alternatively spliced forms. The human genome contains fewer than 21,000 genes. The human genome contains 3,000 Mb.
Ninety-three percent of multi-exon human genes have alternatively spliced forms. The human genome contains fewer than 21,000 genes.
Under which conditions are the lac structural genes expressed most efficiently? High glucose, no lactose High glucose, high lactose No glucose, no lactose No glucose, high lactose
No glucose, high lactose
Part D Does the ability of a Mycobacterium tuberculosis cell to infect a new host depend on its drug-resistant phenotype?
No, drug-susceptible cells and drug-resistant cells are equally likely to infect a new host
The scientists arranged the branches into groups made up of one ancestral variant and all of its descendant, mutated variants. They are color-coded in the tree. Do all of the groups have the same number of branches or branch tips? What does this result indicate?
No; some groups experienced a higher mutation rate than others.
Drag the labels to the appropriate targets to identify where in the cell each process associated with protein synthesis takes place. Nucleolus Cytoplasm Ribosomes Nucleus Rough ER
Nucleolus- formation of ribosomal subunits Cytoplasm- attachment of an amino acid to tRNA Ribosomes- translation of cytoplasmic proteins Nucleus- transcription and RNA processing Rough ER- translation of secreted proteins
Which statement best describes the evolution of pesticide resistance in a population insects?
Offspring of insects that are genetically resistant to the resistant to the pesticide become more abundant as the susceptible insects die off
Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)? One addition and one deletion mutation. One deletion mutation. One addition and two deletion mutations. One addition mutation.
One addition and one deletion mutation.
What insight did Darwin gain from reading Thomas Malthus's essay on human suffering?
Organisms have the capacity to overreproduce.
Because he was well aware of the effect his theory of evolution would have on the public and on the Church of England, Darwin delayed publishing his work for several decades while he gathered additional evidence. After invoking selective breeding of domesticated species as evidence that groups of organisms are capable of change, he then proposed that natural populations can change as well. On which two lines of evidence did he base this proposal?
Organisms within a population vary, and all populations produce more offspring than can be supported by the environment, resulting in competition for survival within the population.
_____________ is a method for amplifying DNA.
PCR
For each protein, identify its targeting pathway: the sequence of cellular locations in which the protein is found from when translation is complete until it reaches its final (functional) destination. (Note that if an organelle is listed in a pathway, the location implied is inside the organelle, not in the membrane that surrounds the organelle.) PFK Insulin
PFK- Cytoplasm only Insulin- ER-> Golgi-> Outside cell
What do we call a virus that attacks a bacterium?
Phage.
Know the different groups Phosphate Ribose Deoxribose Purine Pyrimidine
Phosphate- 4 O, P in middle Ribose- 2 OH on the bottom Deoxribose- 1 OH and 1 H on the bottom Purine- Hexagon attached to pentagon Pyrimidine- Only Hexagon
Part B What was the researchers' main hypothesis?
Predation results in selection for more drab color patterns in guppies.
What was the researchers' main hypothesis?
Predation results in selection for more drab color patterns in guppies.
Part G - Interpreting the data What conclusion would you draw from the data presented?
Predation results in selection for more drab coloration in pike-cichlid pools
What conclusion would you draw from the data presented?
Predation results in selection for more drab coloration in pike-cichlid pools.
There are four levels of protein structure. These figures show primary, secondary, tertiary, and quaternary protein structure. Which level(s) of protein structure may be stabilized by covalent bonds?
Primary, tertiary and quaternary levels of protein structure
Drag each label into the appropriate bin depending on whether it applies to primary, secondary, tertiary, or quaternary structure. Primary Secondary Tertiary Quaternary
Primary- amino acid sequence Secondary- Beta pleated sheet, Alpha Helix & results from hydrogen bonding between the backbone constituents of the polypeptide Tertiary- Results from interactions between side chains (R groups) of amino acids & the overall shape of a polypeptide Quaternary- the aggregation of multiple polypeptide subunits
How do prions, which are misfolded proteins, infect organisms?
Prions enter brain cells and cause normal forms of the protein to refold into the prion form
How do prions, which are misfolded proteins, infect organisms?
Prions enter brain cells and cause normal forms of the protein to refold into the prion form.
How do prions, which are misfolded proteins, infect organisms?
Prions enter brain cells and cause normal forms of the protein to refold into the prion form. -Prions are a misfolded version of a protein normally found in the brain. When prions come into close proximity with the normal proteins, they cause them to refold into the prion form.
Double-stranded viral DNA is incorporated into a host cell as a_____.
Provirus.
How can large quantities of protein be produced from a bacterial colony containing the gene of interest?
Put a cDNA encoding the protein into a plasmid with a bacterial promoter sequence.
What is the genetic material of retroviruses?
RNA
Where do retroviruses carry their genetic material?
RNA
What molecule binds to promoters in bacteria and transcribes the coding regions of the genes? A nucleotide RNA polymerase DNA polymerase DNA ligase
RNA polymerase
What is the function of a spliceosome? protein activation translation protein degradation regulating the transport of mRNA to the cytoplasm RNA processing
RNA processing
Which statement(s) about repressible operons is/are correct? Select all that apply. Repressible enzymes generally function in anabolic pathways. In a repressible operon, the repressor is synthesized in an active form. A repressible operon is on unless a corepressor is present.
Repressible enzymes generally function in anabolic pathways. A repressible operon is on unless a corepressor is present.
How do retrotransposons differ from other transposons?
Retrotransposons move via an RNA transcript, whereas other transposons do not.
How do retrotransposons differ from other transposons? Retrotransposons have lost the ability to move about a genome. Retrotransposons move via an RNA transcript, whereas other transposons do not. Retrotransposons are likely to be the remains of a viral infection. Retrotransposons have retained the ability to move about a genome, an ability that has been lost by other transposons. Only retrotransposons can affect gene expression.
Retrotransposons move via an RNA transcript, whereas other transposons do not.
HIV uses which of the following processes to synthesice a DNA strand using its RNA genome as a template?
Reverse transcription.
The lytic cycle of bacteriophage infection ends with the____.
Rupture of the bacterium.
Part A Can you match these prefixes, suffixes, and word roots with their definitions?
Same: sym- father: pater first: proto- with or together: co- other: allo- true, good: eu- many: poly equal: equi-
Which of the following most likely describes the vertical transmission of a plant virus?
Seeds are planted and reared under protected conditions, but mature plants show disease symptoms.
In the hypothetical environment, fishes called pike-cichlids are visual predators of algae-eating fish (i.e., they locate their prey by sight). If a population of algae-eaters experiences prediction pressure from pike-cichlids, which of the following should least likely be observed in the algae-eater population over the course of many generations?
Selection for larger female algae-eaters, bearing broods composed of more, and larger, young
Which statement best describes the results shown in the Descriptions section?
Several hits derived from Fusarium oxysporum are best matches to the query sequence.
Which statement best describes the results shown in the Descriptions section? Only one hit derived from Fusarium oxysporum is the best match to the query sequence. Several hits derived from Fusarium oxysporum are best matches to the query sequence. Only one hit derived from Fusarium redolens is the best match to the query sequence. Several hits derived from Fusarium redolens are best matches to the query sequence.
Several hits derived from Fusarium oxysporum are best matches to the query sequence.
Your aunt is 63 and has a non-fatal heart attack. Which of the following is true? The average age of a heart attack is not known in women. She is younger than average for having a first heart attack. She is older than average for having a first heart attack. She is right at the average age of a first heart attack.
She is younger than average for having a first heart attack.
Did you find any sequences in the human genome that were statistically similar to your query sequence?
Similar sequences were found only with the blastn (lower similarity) search.
Did you find any sequences in the human genome that were statistically similar to your query sequence? Similar sequences were found only with the blastn (lower similarity) search. Similar sequences were found with both the megablast (high similarity) and the blastn (lower similarity) searches. There were no similarities with either the megablast (high similarity) or the blastn (lower similarity) search. Similar sequences were found only with the megablast (high similarity) search.
Similar sequences were found only with the blastn (lower similarity) search.
The genetic material of HIV consists of______.
Single stranded RNA.
Doing which of the following increases your risk of developing heart disease? Drinking coffee. Exercising vigorously. Smoking. Waking up early.
Smoking.
How did some strains of Staphylococcus aureus become resistant to antibiotic drugs?
Some members of the bacteria population must have had a genetic variation that made them resistant to antibiotics.
In 1959, doctors began using the powerful antibiotic methicillin to treat infections of Staphylococcus aureus, but within two years, methicillin-resistant strains of S. aureus (MRSA) appeared. How did the resistant strains of S. aureus emerge?
Staphylococcus aureus bacteria that were able to synthesize cell walls using a protein that was not affected by methicillin survived the methicillin treatments and reproduced at higher rates than did other individuals. Over time, these resistant individuals became increasingly common.
What structural difference accounts for the functional differences between starch and cellulose?
Starch and cellulose differ in the glycosidic linkages between their glucose monomers.
Codes of Start/methionine Stop codon Amino acid
Start/methionine- AUG Stop codon- UAA, UAG, & UGA Amino acid- CAC, AUC, GCA, AAA, ACU, & UGC
A bacterium is infected with an experimentally constructed bacteriophage composed of the T2 phage protein coat and T4 phage DNA. The new phages produced would have:
T4 protein and T4 DNA
How do the E values change as you go from the top of the list of hits to the bottom?
The E values get larger.
How do the E values change as you go from the top of the list of hits to the bottom? The E values get larger. The E values get smaller. The E values remain the same.
The E values get larger.
What is the most commonly used vector for introducing transgenes into plants?
The Ti plasmid (The Ti plasmid comes from Agrobacterium tumefaciens, and it is effective at integrating with the host cell's DNA.)
Soapberry bugs use needlelike "beaks" to feed on seeds within the fruits of various plants. Bugs feed most successfully when their beak length matches the size of the fruit on which they are feeding. For 25 years, populations of soapberry bugs in central Florida have been feeding on small goldenrain tree fruits that were introduced to the area, rather than on the larger native balloon vine fruits that serve as food for other soapberry bug populations. Beak lengths of soapberry bugs are variable, but the average beak length is shorter in soapberry bug populations that feed on goldenrain tree fruits than in populations that feed on balloon vine fruits, as shown in the graph. How does natural selection act on beak length in soapberry bug populations?
The action of natural selection on beak length in soapberry bug populations varies with the environment.
Which of the functional groups shown above is most likely to gain a proton and become positively charged?
The amino group is most likely to gain a proton.
Which of the following is true?
The borna virus only targets mammals and birds.
Which statements about viruses are true? Select the four statements that are true. The capsid enters the host cell if the virus is enveloped. A retrovirus contains RNA. HIV contains two identical strands of DNA. Enveloped viruses bud from the host cell. All viral genomes contain both DNA and RNA. HIV contains reverse transcriptase. All RNA-containing viruses are retroviruses.
The capsid enters the host cell if the virus is enveloped. A retrovirus contains RNA. Enveloped viruses bud from the host cell. HIV contains reverse transcriptase.
Humans have 23 pairs of chromosomes. In contrast, chimpanzees have 24 pairs of chromosomes and lack any pair resembling the long human chromosome 2 pair; instead, chimpanzees have two pairs of medium-sized chromosomes. What is the most likely explanation for these differences in the human and chimpanzee genomes? Transposable elements transferred significantly large segments of the chromosomes to new locations. At some point in evolution, human ancestors and chimpanzee ancestors were able to mate and produce fertile offspring, making a new species. The common ancestor of humans and chimpanzees had 24 pairs of chromosomes, and at some point in the human lineage, two chromosomes fused end to end, providing some selective advantage. The common ancestor of humans and chimpanzees had 23 pairs of chromosomes, but when chimpanzees evolved, one of the chromosomes broke in half. Chromosome breakage resulted in additional centromeres being made, allowing meiosis to proceed successfully.
The common ancestor of humans and chimpanzees had 24 pairs of chromosomes, and at some point in the human lineage, two chromosomes fused end to end, providing some selective advantage.
Why is the outdated term "junk DNA" a misnomer for noncoding regions of the human genome?
The conservation of "junk DNA" sequences in diverse genomes suggests that they have important functions.
Part F In the United States today, about half of the corn crop is genetically engineered with a protein that is toxic to corn borers, an insect pest of corn. Which of the following conditions would be necessary for evolution of resistance to the toxic protein to occur in the corn borer?
The corn borer must have or generate (by mutation) heritable variation in resistance to the toxic protein. The resistant corn borers must survive better or reproduce more than nonresistant corn borers
Why is Suspect 1 considered more likely to have committed the crime than Suspect 2?
The crime scene sample contains DNA fragments from both the victim and Suspect 1. (Such a good match between crime scene DNA fragments and Suspect 1 DNA fragments strongly suggest that Suspect 1 committed the crime.)
Part E Which of the following statements describes the evolution by natural selection of Mycobacterium tuberculosis bacteria in their new environment?
The drug-resistance trait is an adaptation to the environment in which human hosts are medicated with the antibiotic rifampin.
MRSA infections are occurring at alarming rates. One reason for this could be that people do not finish their antibiotics. Which of the following is the most likely reason that this could lead to something like MRSA?
The first few days of antibiotics kill off the weak bacteria, making people feel better. Then, when people stop taking the antibiotics, the strong bacteria that survived have been selected, breed with one another, and create a stronger population.
You discover fish living in a cave with no natural light. The fish have no eyes, but they do have eye sockets. Using a Lamarckian thought process, which of the following would be the reason for this?
The fish were in a dark environment, and therefore didn't need eyes. Over time, they used their developmental energy for other more useful features, so because they didn't use them, they lost them.
How does the company raising these fish claim to prevent the genetically modified fish from breeding with wild fish?
The genetically modified fish are sterile.
As a result of the lytic cycle, _____.
The host cell's DNA is destroyed.
As a result of the lytic cycle_____.
The host cell's DNA is destroyed.
HIV
The human immunodeficiency virus infects cells of the human immune system. Its primary targe is a subset of lymphocytes called helper T cells, or CD4* T cells, so named because of the CD4 proteins that stud their surface.
Lytic cycle
The lytic cycle result in the destruction of the infected cell and its membrane.
Which feature of large biological molecules explains their great diversity?
The many ways that monomers of each class of biological molecule can be combined into polymers
DNA is a self-replicating molecule. What accounts for this important property of DNA? Replication is thermodynamically spontaneous and requires no enzymes. The nitrogenous bases of the double helix are paired in specific combinations: A with T and G with C. Its two strands are held together by easily broken covalent bonds.
The nitrogenous bases of the double helix are paired in specific combinations: A with T and G with C.
Why doesn't a clone in nuclear transplantation resemble the surrogate mother?
The nucleus is the package of DNA and the surrogate mother only houses the zygote's development she doesn't contribute to the cell's characteristics that has to do with the nucleus. The unfertilized egg has no nucleus therefore it's only being manipulated thus, there's no DNA. Therefore, the clone would exhibit characteristics of the genetic donor, not the surrogate.
A group of small fish live in a lake with a uniformly light-brown sandy bottom. Most of the fish are light brown, but about 10% are mottled. This fish species is often prey for large birds that live on the shore. A construction company dumps a load of gravel in the bottom of the lake, giving it a mottled appearance. Which of these statements presents the most accurate prediction of what will happen to this fish population?
The proportion of mottled fish will increase over time.
You are a member of the jury for a murder case. The prosecution has presented DNA evidence linking the defendant to the crime scene. The defense claims that DNA evidence using STR analysis with 13 markers is not sufficient to reliably distinguish between people. What do you think? (Concept 20.4)
The prosecution is right. STR analysis with 13 markers gives a 1 in 10 billion or greater chance that two people will have the same pattern. This person was at the crime scene. (Given the current population of the Earth, STR analysis with 13 markers should be sufficient to distinguish between any two people (excluding identical twins, of course) on the planet.)
Emerging viruses arise by:
The spread of existing viruses more widely within their host species, mutation of existing viruses, and the spread of existing viruses to new host species.
Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the operator to the far end of the operon, past the transacetylase (lacA) gene, which of the following would likely occur when the cell is exposed to lactose? The operon will never be transcribed. The structural genes will be transcribed continuously. The repressor protein will no longer be produced. The inducer will no longer bind to the repressor. The repressor will no longer bind to the operator.
The structural genes will be transcribed continuously.
What is the source of a viral envelope?
The viral envelope is derived from host cell membrane.
How does HIV bind to a host cell?
The viral envelope proteins interact with CD4 and a co-receptor on the cell membrane.
How does HIV bind to a host cell?
The viral envelope proteins interact with CD4 and a co-receptor on the cell membrane. -The viral envelope proteins gp120 and gp41 interact with CD4 and a co-receptor on the host-cell membrane.
A plant that has been raised in a sterile environment shows symptoms of a viral infection. How would you explain this?
The viral infection was acquired by vertical transmission.
Part F As Wallace traveled the Malay Archipelago, he noticed that western islands had placental mammals, like monkeys. Eastern islands had marsupial mammals, like kangaroos. How did Wallace explain this distribution?
The western islands were once connected to Asia and the eastern islands had been connected to Australia. The islands had never been connected to each other
What happens to the expression of the lacI gene if lactose is not available in the cell? The lacI gene increases its rate of transcription. There is no change—the lacI gene is constitutively expressed. The lacI gene turns off. The lacI gene turns on.
There is no change—the lacI gene is constitutively expressed.
Part B Why do dark-colored rock pocket mice on dark lava flows have white bellies?
There is no selection for dark bellies by visual predators
What did Darwin observe about species on islands?
They are often closely related to species from the nearest mainland or neighboring islands.
Which of the following is true of stem cells?
They can be found in both embryonic and adult tissues. Their use is highly controversial. They can differentiate to produce many different kinds of specialized cells. They can reproduce indefinitely in culture.
Other than the genus and species information, what characteristics do most of the top hit sequences share? Select the two best answers. They contain a ribosomal RNA (rRNA) sequence. They contain a sequence of an internal transcribed spacer. They contain a sequence of an intergenic spacer. They contain a genomic DNA sequence.
They contain a ribosomal RNA (rRNA) sequence. They contain a sequence of an internal transcribed spacer.
Other than the genus and species information, what characteristics do most of the top hit sequences share? Select the two best answers.
They contain a sequence of an internal transcribed spacer. They contain a ribosomal RNA (rRNA) sequence.
Which of the following statements does not accurately describe gene microarrays?
They contain thousands of different spots of protein.
Part A Why did dark-colored rock pocket mice first appear in a population of light-colored rock pocket mice?
They have a genetic mutation that affects their fur color
How do enveloped viruses differ from nonenveloped viruses?
They have a membrane-like outer covering.
How do enveloped viruses differ from nonenveloped viruses?
They have a membrane-like outer covering. -Enveloped viruses have a membrane-like outer covering (an envelope) surrounding their capsid.
How does HIV cause disease?
They infect the cells that defend the body against disease
Why are viruses called obligate intracellular parasites?
They must use a host cell's amino acids to synthesize proteins; They must use a host cell's ribosomes to synthesize proteins; They must use a host cell's nucleotides for transcription and replication; They must use a host cell's metabolic enzymes and pathways to obtain energy;
Why are retroviruses considered a special class of viruses?
They transcribe RNA to DNA uing reverse transcriptase.
Why are retroviruses considered a special class of viruses?
They transcribe RNA to DNA using reverse transcriptase
Why are retroviruses considered a special class of viruses? They have an RNA genome. They have a phospholipids membrane cloak. They carry their own RNA-RNA synthesis enzymes inside their capsids. They transcribe RNA to DNA using reverse transcriptase. They leave behind mini-chromosomes when they leave a cell.
They transcribe RNA to DNA using reverse transcriptase.
Why are viruses referred to as obligate parasites?
They use the host cell to reproduce.
What concerns do some consumer groups have about genetically modified fish?
They want food from genetically modified fish to be clearly labeled as genetically modified. They want to prevent genetically modified fish from breeding with wild fish. They want more studies on the health effects that genetically modified fish may have on people who eat it.
Part I - Making and testing a prediction Suppose that after 22 months, guppies from the transplanted population were returned to the source pool. What would most likely happen to those guppies?
They would experience a higher rate of predation than the native population, and over time they would evolve and resemble the original source population
Suppose that after 22 months, guppies from the transplanted population were returned to the source pool. What would most likely happen to those guppies?
They would experience a higher rate of predation than the native population, and over time they would evolve and resemble the original source population.
What illustrates a property that emerges at the community level?
This emergent property emerges at the community level, due to the interactions among prokaryotic species forming the biofilm. Read about levels of biological organization in and emergent properties.
What is the function of the lacZ gene? This gene encodes an enzyme, galactoside permease, which transports lactose into the cell. This gene encodes an enzyme, b-galactosidase, which cleaves lactose into glucose and galactose. This gene encodes the repressor of the lac operon. This gene encodes an enzyme, b-galactosidase, that cleaves lactose into two glucose molecules.
This gene encodes an enzyme, b-galactosidase, which cleaves lactose into glucose and galactose.
How did the types of data the researchers collected enable them to test their prediction?
Tracking the number and area of colored spots provided a quantitative way to compare the brightness of different populations.
Part F How did the types of data the researchers collected enable them to test their prediction?
Tracking the number and area of colored spots provided a quantitative way to compare the brightness of different populations.
Viral DNA makes mRNA by the process of _____.
Transcription
Drag the labels to the appropriate bins to identify the step in protein synthesis where each type of RNA first plays a role. If an RNA does not play a role in protein synthesis, drag it to the "not used in protein synthesis" bin. Transcription/RNA processing Translation Not used in protein synthesis
Transcription/RNA processing- pre-mRNA, snRNA, & mRNA Translation- rRNA, & tRNA Not used in protein synthesis- RNA primers
Identify the correct statement(s) about transposable elements. Select all that apply. -Transposable elements are called "jumping genes" because they detach from their location in DNA before reattaching in a different location. -Telomeric simple sequence DNA is made up of transposable elements. -Transposable elements and related sequences make up 44% of the human genome.
Transposable elements and related sequences make up 44% of the human genome.
Identify the correct statement(s) about transposable elements. Select all that apply. Transposable elements and related sequences make up 44% of the human genome. Transposable elements are called "jumping genes" because they detach from their location in DNA before reattaching in a different location. Telomeric simple sequence DNA is made up of transposable elements.
Transposable elements and related sequences make up 44% of the human genome.
What type of non-coding DNA comprises the largest portion of multicellular eukaryotic genomes?
Transposons
By what mechanism might transposons contribute to gene duplication?
Transposons may promote unequal crossing over during meiosis.
By what mechanism might transposons contribute to gene duplication?
Transposons may promote unequal crossing over during meiosis. (Illegitimate recombination between transposon sequences at different loci leads to chromosome rearrangements and gene deletions and duplications.)
Part G True or false? It would be difficult to assess whether the drug-susceptible or drug-resistant phenotype in a population of Mycobacterium tuberculosis was more fit in an environment without antibiotics.
True
True or false? Comparison of the sequences of the same gene across species can give some insight into the existence of a common ancestor with that gene.
True (DNA sequence comparisons are a powerful tool by which to estimate how closely related different species are along the evolutionary timeline.)
True or false? The term "sticky ends" refers to the overhanging ends on DNA that are generated by restriction enzymes, which can base pair with any DNA molecules that contain complementary sticky ends.
True (Restriction enzymes cut DNA and generate "sticky ends," which can then base pair with DNA molecules that contain the same sticky ends.)
Which of the following would make the most suitable outgroup species for a phylogenetic tree relative to the other species?
Tuna
If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein? One. Two. Three. None.
Two.
How do prions differ from viruses?
Unlike a virus, a prion is a single molecule; Unlike viruses, prions do not include any nucleic acids; Unlike viruses, prions are infectious proteins;
Identify all correct statements about how viroids differ from viruses.
Unlike viruses, viroids do not encode proteins.
Archaeologists unearthed a human skull with a small dried fragment of the scalp still attached. They extracted a tiny amount of DNA from the scalp tissue. How could they obtain sufficient DNA for an analysis of the ancient human's genes? (Concept 20.1)
Use the polymerase chain reaction (PCR is a method of DNA amplification.)
What is the most effective way to stop viral infections?
Vaccines.
Which of the following bonds can form between atoms of equal electronegativity?
Van der Waals interactions can form between atoms of equal electronegativity.
Using the Galápagos finches example from the book, which of the following best explains the Darwinian reason why the insect-eating finch has such a long, narrow beak?
Variation existed in the finch population. Those that naturally had longer, narrower beaks could reach their food more easily, allowing finches with these features to survive and reproduce more often than those that did not.
prophage
Viral DNA incorporated into host DNA is referred to as a "prophage."
In the lysogenic cycle_______.
Viral DNA is replicated along with host DNA.
Non enveloped and enveloped virus
Viruses are classified into two major groups: nonenveloped and enveloped. •Nonenveloped viruses (a) typically exit the host cell by bursting through the plasma membrane. •Enveloped viruses (b) generally escape from the host cell by budding. Because of this, the viral envelope is often derived from the host cell's plasma membrane.
Which is not an accepted theory about the evolution of viruses:
Viruses are the descendents of precellular life forms.
How does a virus differ from a bacterium?
Viruses, unlike bacteria, lack metabolic enzymes
How does a virus differ from a bacterium?
Viruses, unlike bacteria, lack metabolic enzymes.
How does a virus differ from a bacterium? Select all that apply. A virus, unlike a bacterium, lacks a genome. Viruses, unlike bacteria, lack metabolic enzymes. Viruses are two-dimensional, whereas bacteria are three-dimensional.
Viruses, unlike bacteria, lack metabolic enzymes.
Which statement about weak bonds is correct?
Weak bonds are transient and easily reversible.
Part C Researchers further hypothesized that if predation pressure is reduced, drab coloration would become less beneficial (since females prefer brightly colored mates). Based on this hypothesis, what prediction did the researchers test in this experiment?
When guppies with drab colors are transferred to a pool with only killifish, the transplanted population will evolve brighter colors than the original source population.
Researchers further hypothesized that if predation pressure is reduced, drab coloration would become less beneficial (since females prefer brightly colored mates). Based on this hypothesis, what prediction did the researchers test in this experiment?
When guppies with drab colors are transferred to a pool with only killifish, the transplanted population will evolve brighter colors than the original source population.
What information can not be obtained from the sequence of a gene?
Whether the gene is methylated.
Which of these examples illustrates deductive reasoning?
You learned in elementary school that as temperature drops, liquids change into solid form. You are given an unfamiliar liquid and hypothesize that it will become solid if you put it in the freezer.
If the frequency of a particular allele that is present in a small, isolated population of alpine plants decreases due to a landslide that leaves an even smaller remnant of surviving plants bearing this allele, then what has occurred?
a bottleneck, genetic drift, and microevolution
Although quite different in structure, plants and animals share some basic similarities in their development, such as
a cascade of transcription factors that regulate gene expression on a finer and finer scale.
What is genetic drift?
a change in allele frequencies caused by random events
Part C Mutations are always __________.
a change in an individual's DNA
2 families of globin genes exist in humans. In each family, there are multiple copies of the genes. How did these multiple copies come about?
a common ancestral gene was duplicated early in the evolutionary history of the globin gene and then multiple times since
Within a few weeks of treatment with the drug 3TC, a patient's HIV population consists entirely of 3TC-resistant viruses. How can this result best be explained?
a few drug-resistant viruses were present at the start of treatment, and natural selection increased their frequency
Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene? Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene? a base substitution at the beginning of the gene a base substitution at the end of the gene a frameshift deletion at the beginning of the gene a frameshift deletion at the end of the gene
a frameshift deletion at the beginning of the gene
Based on the genetic code chart above, which of the following would be the result of this single base-pair substitution? a missense mutation causing a single amino acid change in the protein a silent mutation (no change in the amino acid sequence of the protein) a frameshift mutation causing a single amino acid change in the protein a nonsense mutation resulting in early termination of translation a frameshift mutation causing extensive change in the amino acid sequence of the protein
a nonsense mutation resulting in early termination of translation
Vertical transmission
a plant inherits a viral infection from a parent
In recombinant DNA methods, the term vector can refer to
a plasmid used to transfer DNA into a living cell.
In recombinant DNA experiments, _____ is used to cut pieces of DNA and _____ joins the resulting fragments to form recombinant DNA.
a restriction enzyme ... DNA ligase (Restriction enzymes cut DNA molecules at specific points; in most cases, the restriction fragments have sticky ends that can base-pair with complementary sticky ends. The joined segments are then covalently fused by DNA ligase.)
Virus
a small infectious agent that replicates only inside the living cells of other organisms. Virus can infect all types of life forms, from animals and plants to bacteria and archaea.
Plants are more readily manipulated by genetic engineering than are animals because
a somatic plant cell can often give rise to a complete plant.
How do transposable elements promote functional genetic diversity in a population?
a transposable element may cause genetic diversity by any of the listed methods
Which of the following is a major distinction between a transposon and a retrotransposon?
a transposon moves via a DNA intermediate and retrotransposon via an RNA intermediate
Part B - Phylogenetic trees and geographic relationships
a) Ancestor of gray foxes and island foxes b) ancestor of santa rosa and San Miguel Foxes c) dwarfism d) ancestor of northern Channel Island Foxes e)mostly closely related f)ancestor of southern channel island foxes g)ancestor of island foxes h)ancestor of Santa Catalina and San Clementine
Which of the following events stimulates the production of viral particles in a host cell?
activation of the host cell by cytokines, growth factors, or antigens
The modified salmon were created by _____.
adding genetic material from a Pacific salmon and an eel-like fish
Which property of water allows a paper towel to pick up a puddle of water?
adhesion of water molecules to other kinds of molecules
A population of zooplankton is exposed to a small number of predatory fish that feed on the larger-sized (adult) zooplankton. Which of the following predictions would most likely occur based on the principles of natural selection?
adult zooplankton will start to reach sexual maturity when they are still relatively small
In which section of the search results can you find nucleotide-by-nucleotide comparisons between your query sequence and similar database sequences?
alignments.
All known organisms transcribe genetic information to protein molecules via the same genetic code. This finding strongly supports the hypothesis that
all organisms are descended from a single common ancestor
All known organisms transcribe genetic information to protein molecules via the same genetic code. This finding strongly supports the hypothesis that _____.
all organisms are descended from a single common ancestor
A specific gene is known to code for three different but related proteins. This could be due to which of the following?
alternative RNA splicing
The number of genes in an organism's genome is not a perfect indication of the organism's complexity because
alternative splicing can increase the number of polypeptides made from a single pre-mRNA; post-translational modifications can increase the types of proteins produced by a single gene; individual polypeptides can interact to form multiple types of protein complexes; individual genes can be expressed in more or less complex ways in different organisms
A statement that supports the view that most biologists that viruses are nonliving
an isolated virus is unable to replicate its genes or regenerate ATP
Why is it ineffective to treat viral disease with antibiotics?
antibiotics inhibit enzymes specific to bacteria and have no effect on virally encoded enzymes
How many genes is the human genome thought to contain?
approx. 20,000-22,000
Alu elements
are derived from or related to transposable elements
Prions
are infections proteins that spread disease
The breeding of plants and animals for particular traits by humans is called
artificial selection
The breeding of plants and animals for particular traits by humans is called _____.
artificial selection
In order to insert a human gene into a plasmid, both must _____
be cut by the same restriction enzyme (Doing so will result in the formation of complementary sticky ends.)
To cause a human pandemic, the H5N1 avian flu virus would have to
become capable of human-to-human transmission.
Prezygotic barriers
behavioral isolation, mechanical isolation, habitat isolation, temporal isolation, gametic isolation
In this example the marker DNA includes fragments that have 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, and 564 base pairs. Approximately how many base pairs are in the DNA fragment indicated by the letter B? The figure shows the results of gel electrophoresis. In this figure, the marker DNA has seven bands; their lengths are 23130, 9416, 6557, 4361, 2322, 2027, and 564 base pairs respectively. The first researched DNA has two bands. The first, indicated by the letter A, complies to the third band of the marker DNA and the second is located between the sixth and the seventh bands of the marker DNA. The second researched DNA has three bands. The first, indicated by the letter B, is located between the third and the fourth bands of the marker DNA and two others are located between the sixth and the seventh bands.
between 6,557 and 4,361 base pairs
Which of the various species concepts distinguishes 2 species based on the degree of genetic exchange between their gene pools?
biological
Which of the following statements about species, as defined by the biological species concept, are correct?
biological species are defined by reproductive isolation; the biological species is the largest unit of population in which successful reproduction is possible
You are a cardiovascular surgeon. Where do you insert stents? blocked veins healthy veins healthy arteries blocked arteries
blocked arteries
Examine the descriptions for the group of hits that align with the N-terminal end of the query sequence. Which of the following terms are found among these descriptions? Select all that apply.
breakpoint cluster region. unnamed protein product. BCR variant.
Tumor suppressor genes
can encode proteins that promote DNA repair, control cell adhesion and inhibit the cell cycle.
The nucleic acid of a virus particle is enclosed in a protein coat called
capsid
The nucleic acid of a virus particle is enclosed in a protein coat. What is it called? genome capsid nucleoid nuclear envelope envelope
capsid
The nucleic acid of a virus particle is enclosed in a protein coat. What is it called?
capsid -The protein shell that encloses a viral genome is a capsid.
The shape of an organ, the number of brain cells in an embryonic brain, the removal of mutated cells, and the webbing cells between the toes of a human embryo are all regulated by which of the following
certain cells dying
Chromosomal rearrangements may be important in evolution because
chromosome rearrangements lead to gene duplication, thus generating a "spare" copy of the gene that is free to evolve and acquire a new function
You find a section of sedimentary rock in which the strata and some fossils have been exposed. You notice that a clam fossil is in deeper strata than a fish fossil you can see. Using relative dating, which fossil is most likely older?
clam
Comparing Distantly related Species
clarifies evolutionary relationship among all diverged species
Evidence from molecular biology supports the theory of evolution by demonstrating that _____.
closely related organisms have more similar DNA and proteins
BLAST is a computational tool used by genome biologists to _____.
compare a given DNA or protein sequence to all other DNA or protein sequences in a database
BLAST is a computational tool used by genome biologists to _____. identify sites in the DNA where restriction endonucleases cut assemble short overlapping DNA sequences into long contiguous DNA sequences called contigs disassemble a genomic DNA sequence into small segments compare a given DNA or protein sequence to all other DNA or protein sequences in a database align genetic maps based on recombination frequencies to physical maps of chromosomes
compare a given DNA or protein sequence to all other DNA or protein sequences in a database
BLAST is a computational tool used by genome biologists to_________.
compare a given DNA or protein sequence to all other DNA or protein sequences in a database
BLAST is a computational tool used by genome biologists to _____.
compare a given DNA or protein sequence to all other DNA or protein sequences in a database (BLAST is the key tool used to compare newly sequenced DNA and proteins to previously sequenced DNA and proteins.)
Comparing Closely Related Speices
comparing similar sequences and studying the characteristics of what differ, in humans and chimpanzees
What can be learned from comparing the genomes of distantly related species, such as yeast and humans, or plants and fruit flies?
conserved genes provide insight into their evolutionary relationships
Repetitive DNA is DNA that
consists of sequences present in multiple copies in the genome
Even thought rodents known as sugar gliders and flying squirrels are members of distinctly different groups of organisms and live on different continents, they possess similar characteristics. This is an example of
convergent evolution
Imagine that you have discovered a new lizard that lives in a foggy desert in southwestern South America. As fog rolls in, this lizard stands on its head and lets water condense on its back and roll in grooves to its mouth. Considering the Namibian beetle in the figure below, this trait is an example of which of the following?
convergent evolution
The number of genes ________.
correlates well with the size of the genome in prokaryotes (Prokaryotic genomes are compact, so the size of the genome accurately reflects the number of genes.)
Identify three possible components of a DNA nucleotide. guanine, phosphate group, ribose deoxyribose, phosphate group, uracil cytosine, phosphate group, ribose adenine, phosphate group, ribose cytidine, phosphate group, ribose deoxyribose, phosphate group, thymine
deoxyribose, phosphate group, thymine
Darwin originally defined evolution as
descent with modification
Darwin originally defined evolution as _____.
descent with modification
Habitat isolation
differences in habitat occupied EX.) 2 fish species spawn at different depths
Behavioral isolation
differences in mating rituals or displays EX.) beetle mating displays show different spot patterns
Temporal isolation
differences in the timing of mating EX.) birds are active during different times of day
Multilane families include 2 or more nearly identical genes or genes sharing nearly identical sequences. A classical example is the set of genes for global molecules, including genes on human chromosomes 11 and 16. Several of the different global genes are expressed in humans, but at different times in development. What mechanism could allow for this?
differential gene regulation over time
Several of the different globin genes are expressed in humans, but at different times in development. What mechanism could allow for this?
differential gene regulation over time
An important challenge to traditional (pre-1860) ideas about species was the observation that seemingly dissimilar organisms such as hummingbirds, humans, and whales have similar skeletal structures. This most directly suggested to biologists that
dissimilar organisms might have evolved from a distant, common ancestor
An important challenge to traditional (pre-1860) ideas about species was the observation that seemingly dissimilar organisms such as hummingbirds, humans, and whales have similar skeletal structures. This most directly suggested to biologists that _____.
dissimilar organisms might have evolved from a distant, common ancestor
DNA normally moves ______________ through a gel due to the attraction of opposite charges.
down
A challenge to traditional (pre-1860) ideas about species came from embryology, when it was discovered that _____.
embryos of dissimilar organisms, such as sharks and humans, resemble each other
Part A A challenge to traditional (pre-1860) ideas about species came from embryology, when it was discovered that _____.
embryos of dissimilar organisms, such as sharks and humans, resemble each other
Homeotic genes
encode transcription factors that control the expression of genes responsible for specific anatomical structures
Homeotic genes
encode transcription factors that control the expression of genes responsible for specific anatomical structures.
Homeotic genes: -are found only in Drosophila and other arthropods. -encode proteins that form anatomical structures in the fly. -encode transcription factors that control the expression of genes responsible for the organism's development. -are responsible for patterning during plant development. -are the only genes that contain the homeobox domain.
encode transcription factors that control the expression of genes responsible for the organism's development.
Organisms found only in specific places in the world are referred to as
endemic
Multigene families arise as a result of
errors during DNA replication and recombination
What does it mean to describe evolution as a scientific theory?
evolution is a broad model that is supported by many observations and much experimental evidence
Animals that possess homologous structures probably _____.
evolved from the same ancestor
Ichthyosaurs were aquatic dinosaurs. Fossils show us that they had dorsal fins and tails, as do fish, even though their closest relatives were terrestrial reptiles that had neither dorsal fins nor aquatic tails. The dorsal fins and tails of ichthyosaurs and fish are
examples of convergent evolution, and adaptations to a common environment
The occasional mixing and matching of different exons within a gene or between 2 different (nonallelic) genes can be caused by errors in meiotic recombination. This process is called
exon shuffling
Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this phenomenon?
exon shuffling
Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this similarity?
exon shuffling
Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this similarity? exon shuffling RNA splicing random point mutations gene duplication histone modification
exon shuffling
Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this similarity? -RNA splicing -exon shuffling -gene duplication -random point mutations -histone modification
exon shuffling
The majority of human genome consists of all but which of the following?
exons
How does our understanding of genetics today refute Lamarick's principle of the inheritance of acquired characteristics?
experiments in genetics show that traits acquired during an individual's lifetime are not inherited in the way proposed by Lamarck
The last ice age produced many different species mainly because populations dispersed and colonized new habitats
false
Of the following anatomical structures, which is homologous to the wing of a bird?
flipper of a cetacean
For the first time, the U.S. Food and Drug Adminis
food from a genetically altered animal
Part B Can you match these prefixes, suffixes, and word roots with their definitions?
foot: -pod same: homo- chromosomes: ploid both, double, two: amphi- first: prim- behind: post- joint: arthr-
Which "ingredients" for PCR and for the dideoxy chain-termination method of DNA sequencing are the same?
free nucleotides, DNA polymerase, DNA primers (If DNA polymerase encounters a DNA template strand with a primer attached to it, and free nucleotides are available, DNA synthesis will proceed.)
Which kingdom does Hypocreales belong to?
fungi.
Which of these genes are located on the q arm of chromosome 17? gastrin and GH1 MPO and GLUT4 BLMH and RP13 RP13 and GLUT4 TP53 and KRTHA1
gastrin and GH1
Which of these genes are located on the q arm of chromosome 17? The figure shows the human chromosome. On the short arm of this chromosome, there are several genes. From top to bottom, they are RP13, TP53, GLUT4. On the long arm, there are BLMH, SLC6A4, KRTHA1, Gastrin, GH1, DCP1, MPO genes.
gastrin and GH1 (The q arm is the long arm of a chromosome.)
A multigene family is composed of multiple genes whose products must be coordinately expressed. the many tandem repeats such as those found in centromeres and telomeres. a highly conserved gene found in a number of different species. genes whose sequences are very similar and that probably arose by duplication. a gene whose exons can be spliced in a number of different ways.
genes whose sequences are very similar and that probably arose by duplication.
Why might a dog genome sequencing project prove particularly informative, compared to other mammalian genomes?
genetic variation between breeds may be linked to phenotypic variation
A defining characteristic of allopatric speciation is
geographic isolation
The fish in the video have been genetically engineered to _____.
grow faster
At the time Darwin voyaged on the HMS Beagle, the popularly accepted theory in Western culture that explained the origin of Earth's plants and animals held that the various species _____.
had been created by divine intervention a few thousand years before
At the time Darwin voyaged on the HMS Beagle, the popularly accepted theory in Western culture that explained the origin of Earth's plants and animals held that the various species
had been created by divine intervention an few thousand years before
If you were to observe the activity of methylated DNA you would expect it to
have turned off or slowed down the process of transcription
Which of the following is an example of the process of evolution?
herbivory
The ____ is the highly conserved sequence element found within homeotic genes
homeobox
Comparing Developmental Processes
homeotic genes include homeobox (180-nuc eq), specifies (60-amino acid homeodomain, domain is a specific functioning part of protein)
On an evolutionary tree
homologous characteristics form a nested pattern
On an evolutionary tree _____.
homologous characteristics form a nested pattern
What is the source of a viral envelope? host cell DNA prophages provirus host cell membrane viral glycoproteins
host cell membrane
Reduced hybrid viability
hybrid offspring are produced but are feeble or unable to compete for mates EX.) lion-tiger hybrids don't reach maturity
Reduced hybrid fertility
hybrid offspring are produced but are sterile EX.) offspring of 2 newts are sterile
The two strands of a DNA double helix are held together by _____ that form between pairs of nitrogenous bases. S—S bonds ionic bonds hydrophilic interactions hydrogen bonds covalent bonds
hydrogen bonds
Multigene families are
identical or similar genes that have evolved by gene duplication.
How can the varying fitness of double-mutant yeast cells provide insights into interactions between gene products?
if double-gene mutations produced smaller colonies than single-gene mutants, then the 2 genes and their products likely interact; if double-gene mutants produced larger colonies than single-gene mutants, then the 2 genes and their products likely interact; if double-gene mutants produced colonies equal in size to single-gene mutants, then the 2 genes and their products do not interact
Part H Which of the following would help strengthen the researchers' conclusion?
if no other characteristics differed significantly between the source and transplanted populations
Which of the following would help strengthen the researchers' conclusion?
if no other characteristics differed significantly between the source and transplanted populations
DNA methylation is a mechanism used by eukaryotes to do what? increase the rate of transcription inactivate genes terminate transcription facilitate the binding of DNA to intermediate filaments cause apoptosis
inactivate genes
A population of birds colonizes an area in which the insects upon which they feed live inside trees. Which of the following events accounts for an observed increase in average beak size in the bird population over time?
increased fitness of large-beaked birds, leading to natural selection
Adaptations are
inherited characteristics of organisms that enhance their survival and reproduction in specific environments
Which enzymes inserts viral DNA into the host's chromosomal DNA?
integrase
Which of the following is not an observation or inference that Darwin made while developing his theory of evolution?
interactions between individuals and their environment cause individuals to evolve
Which of the following is an example of "recombinant DNA technology?"
introducing a human gene into a bacterial plasmid (Recombinant DNA technology involves combining DNA from different sources into a single molecule, such as inserting a gene from one species into a plasmid from another.)
DNA technology has many medical applications. Which of the following is not done routinely at present? genetic testing for carriers of harmful alleles prenatal identification of genetic disease genes production of hormones for treating diabetes and dwarfism introduction of genetically engineered genes into human gametes production of viral proteins for vaccines
introduction of genetically engineered genes into human gametes
The RP13 gene of chromosome 17 codes for a protein _____. involved in glucose transport that is a component of hair and nails in the regulation of blood pressure involved in eye development involved in the determination of personality
involved in eye development
The RP13 gene of chromosome 17 codes for a protein _____.
involved in eye development (The RP13 gene codes for a protein that plays a role in eye development.)
The TP53 gene of chromosome 17 codes for a protein _____.
involved in the regulation of the cell cycle
Pandemic
is a epidemic of infectious disease that has spread through human populations across a large region; up to worldwide
Provirus
is a genome that is integrated into the DNA of host cell.
Retrovirus
is a single stranded RNA virus that stores its nucleic acid in the form of an mRNA genome and targets a host cell as an obligate parasite.
Bacteriophage (phage)
is a virus that infects and replicates within bacteria. Bacteriophanges are composed of proteins that encapslate a DNA or RNA genome, and may have relatively simple or elaborate structures. Their genomes may encode as few as four genes and as many as hundreds of gene. Phage replicate witin bacteria following the injection of their genome into cytoplasm. Bacteriaphage are among the most common and diverse entities in the biosphere.
Integrase
is an enzyme produced by a retrovirus that enables its genetic material to be integrated into the DNA of the infected cell. (transport the transcribed DNA to the cell's DNA and integrates it) It typically lay dormant. However, if the T cells is activated by growth faters, cytokines, or antigens, the cell's transcriptional machinery increases the rate of transcription of viral DNA into messenger RNA.
Lysogenic cycle
is characterized by integration of the bacteriophage nucleic acid into the host bacterium's genome or formation of a circular replicon in the bacterium's cytoplames.The key difference between the lytic cycle and the lysogenic cycle is that the lysogenic cycle does not lyse the host cell.
To describe evolution as a "scientific theory" means that _____.
it is a broad model that is supported by many observations and much experimental evidence
Which is a true statement concerning genetic variation?
it must be present in a population before natural selection can act upon the population
After allowing phages grown with bacteria in a medium that contained 32P and 35S, Hershey and Chase used a centrifuge to separate the phage ghosts from the infected cell. They then examined the infected cells and found that they contained _____, which demonstrated that _____ is the phage's genetic material. labeled protein .... protein labeled DNA ... labeled protein labeled protein ... DNA labeled DNA .... protein labeled DNA ... DNA
labeled DNA ... DNA
When we say than an individual organism has a greater fitness than another individual, we specifically mean that the organism
leaves more viable offspring than others of its species
Gel electrophoresis separates DNA fragments on the basis of what characteristic?
length
Gel electrophoresis separates DNA fragments on the basis of ________.
length (As the DNA fragments move through the gel, longer fragments are impeded more than shorter fragments, producing characteristic banded patterns in the gel.)
What happens first when a phage infects a bacterial cell and is going to enter a lysogenic cycle?
linear DNA circularizes
For mapping studies of genomes, most of which were far along before 2000, the three-stage method was often used. Which of the following is the usual order in which the stages were performed, assuming some overlap of the three?
linkage map, physical map, sequencing of fragments
According to the producers of the genetically modified salmon, the meat _____.
looks and tastes the same as unmodified salmon
Initially, cytoplasmic determinants are localized in one part of a zygote and could be which of the following?
mRNA transcription factor
cDNA is synthesized from _____ using an enzyme called _________
mRNA ... reverse transcriptase (Reverse transcriptase is a viral enzyme that can synthesize DNA from an RNA template.)
cDNA is synthesized from what molecule using an enzyme known as what?
mRNA ... reverse transcriptase (Reverse transcriptase is a viral enzyme that can synthesize DNA from an RNA template.)
Why might the number of genes in the genome underestimate the number of different proteins that an organism makes?
many genes undergo alternative splicing, so that different proteins with different exon combinations are produced from the same gene
When they were first sold, aerosol insecticides were highly effective in killing flies and mosquitoes. Now, several decades later, a much smaller proportion of these insects die when sprayed. The reason fewer insects die when they are sprayed is that _____.
many mosquitoes today are descendants of mosquitoes with insecticide-resistant characteristics
The main goal of the Human Genome Project (HGP) was to ________.
map all the human genes and determine the nucleotide sequence of the entire human genome
Generation-to-generation change in the allele frequencies in a population is
microevolution
During drought years on the Galapagos, small, easily eaten seeds become rare, leaving mostly large, hand-cased seeds that only birds with large beaks can eat. If a drought persists for several years, what should one expect to result from natural selection?
more small-beaked birds dying than larger-beaked birds. The offspring produced in subsequent generations have a higher percentage of birds with large beaks
Detailed comparison of the human and chimpanzee genomes has revealed that
most differences are in the form of chromosomal rearrangements
What is not true regarding multigene families?
multigene families arise as a result of transposition from one part of a genome to another
Darwin's explanation of how adaptations arise centered on
natural selection
Which of these evolutionary agents is most consistent at causing populations to become better suited to their environments over the course of generations?
natural selection
In Darwin's view of descent with modificaiton
natural selection can improve the match between an organism and its environment
In Darwin's view of descent with modification _____.
natural selection can improve the match between an organism and its environment
Why are the large finches now living on the Galapagos Islands different from the original source population from a nearby island?
natural selection favored individuals that were more fit in the new environment, the separation of habitats reduced gene flow between the populations, genetic drift occurred in the two populations
The upper forelimbs of humans and bats have fairly similar skeletal structures, whereas the corresponding bones in whales have very different shapes and proportions. However, genetic data suggest that all 3 kinds of organisms diverged from a common ancestor at about the same time. Which of the following is the most likely explanation for these data?
natural selection in an aquatic environment resulted in significant changes to whale forelimb anatomy
Which of the following is correct regarding natural selection?
natural selection is a process in which individuals that have certain inherited traits tend to survive and reproduce at higher rates than do individuals without those traits; over time, natural selection can increase the correspondence between organisms and their environments; if an environment changes, or if individuals move to a new environment, natural selection may result in adaptation to these new conditions, sometimes giving rise to new species; individuals do not evolve, populations do
In gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel.
negative ... positive (An electrical current is generated across the gel, and DNA molecules migrate from the negative end toward the positive end.)
lytic cycle
new phages are assembled from viral DNA and proteins, the cell is lysed, and the host is destroyed
In the presence of a regulatory protein the lac operon is _____. transcribed not transcribed transcribed at a faster than usual rate is turned on either transcribed or not transcribed
not transcribed
In nucleotide excision repair, damaged DNA is excised by what enzyme(s)? helicase nuclease ligase primase DNA polymerases
nuclease
Where in the eukaryotic cell does RNA processing of a primary transcript occur?
nucleus
Epidemic
occurs when new cases of a certain disease, in a given human population, and given a given period, substantially exceed what is expected based on recent experience.
Part A From his observations of organisms in the Galapagos islands, Darwin reasoned that _____.
organisms had adapted to new environments, giving rise to new species
What insight did Darwin gain from reading Thomas Malthus's essay on human suffering?
organisms have the capacity to overproduce
To produce a DNA fragment that contains the whole gene and has two sticky ends, where must the enzyme's restriction sites be located?
outside the gene on both sides, but not inside the gene
The H1N1 2009 outbreak is considered a
pandemic
What do we call a virus that attacks a bacterium?
phage
The _________________________ of a nucleotide, represented here as a yellow ball, contains a negative charge.
phosphate group
A nucleotide is composed of a(n) _____. amino group, a nitrogen-containing base, and a five-carbon sugar phosphate group, a nitrogen-containing base, and a five-carbon sugar glycerol, a nitrogen-containing base, and a five-carbon sugar phosphate group, a nitrogen-containing base, and a hydrocarbon sulfhydryl group, a nitrogen-containing base, and a five-carbon sugar
phosphate group, a nitrogen-containing base, and a five-carbon sugar
You have isolated viral particles from a patient, but you are not sure whether they are adenoviruses or influenza viruses. The presence of which class of biological molecules would allow you to distinguish between the two types of virus?
phospholipids
A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). The researcher would like to compare a specific region of the DNA from the sample with DNA from living birds. Which of the following would be most useful for increasing the amount of dodo DNA available for testing?
polymerase chain reaction (PCR)
Which of the following is not an observation or inference on which natural selection is based?
poorly adapted individuals never produce offspring
A ____ is the smallest unit that can evolve
population
The smallest unit that can evolve is a(n) _____.
population
Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problem of
post-transcriptional processing.
Part J What data should you collect in order to test your prediction?
predation rate on transplanted versus original source guppies, and color patterns of the population over time
What data should you collect in order to test your prediction?
predation rate on transplanted versus original source guppies, and color patterns of the population over time
Animals that possess homologous structures
probably evolved from the same ancestor
According to the theory of evolution, anatomical and molecular homologies should _____.
produce similar patterns of evolutionary relatedness
Gene duplication has played a critical role in evolution because it ________.
produces redundant copies of existing genes, which are then free to mutate and adopt new functions (The prevalence of multigene families attests to the importance of gene duplication.)
Which statement best describes one of the differences between prokaryotic and eukaryotic genomes?
prokaryotic genomes do not include noncoding regions (introns) while eukaryotic genomes do
Which element(s) from the following list constitute(s) a bacterial operon?
promoter
Enzyme complexes that break down protein are called _____. lipases ubiquitins amylase proteasomes nucleases
proteasomes
Protein-phosphorylating enzymes' role in the regulation of gene expression involves _____. protein activation translation protein degradation regulating the transport of mRNA to the cytoplasm RNA processing
protein activation
Double stranded viral DNA is incorporated into a host cell as a
provirus
Double-stranded viral DNA is incorporated into a host cell as a _____. promoter provirus transposon lac homeoboxes
provirus
The gene that codes for gastrin is located on the _____ of chromosome 17. q2 q arm p2 p arm centromere
q arm
The gene that codes for gastrin is located on the _____ of chromosome 17. The figure shows the human chromosome. On the short arm of this chromosome, there are several genes. From top to bottom, they are RP13, TP53, GLUT4. On the long arm, there are BLMH, SLC6A4, KRTHA1, Gastrin, GH1, DCP1, MPO genes.
q arm (The gene that codes for gastrin is located on the long arm of chromosome 17.)
By what mechanism might transposons contribute to gene duplication?
ransposons may promote unequal crossing over during meiosis.
Postzygotic barriers
reduced hybrid fertility, reduced hybrid viability
lysing
refers to the breaking down of a cell, often by viral, ezymic, or osmotic mechanisms that compromise its integrity.
The nuclear membrane's role in the regulation of gene expression involves _____. protein activation translation protein degradation regulating the transport of mRNA to the cytoplasm RNA processing
regulating the transport of mRNA to the cytoplasm
Which of these is NOT a component of the lac operon? lactose-utilization genes only promoter only regulatory gene only operator only promoter and operator
regulatory gene only
Which of the following statements about reinforcement is true?
reinforcement is a type of natural selection
Vestigial organs are _____.
remnants of structures that were useful to an organism's ancestors
Virulent phages
replicate only by a lytic cycle.
Which of the following is a type of regulatory protein (ie: transcription factor) produced by a regulatory gene?
repressor
Mechanical isolation
reproductive structure incompatibility EX.) flowers accommodate different insect pollinaters
If cells from a carrot are removed and placed in a culture medium, they can develop into a normal adult plant. This demonstrates that carrot cells _____.
retain all the genes that were in the zygote that developed into the original plant (Furthermore, the carrot cells are totipotent.)
Retrotransposons differ from other transposons in that ________.
retrotransposons move via an RNA transcript, whereas other transposons do not (Retrotransposons are transcribed into RNA, which is then converted back into DNA by reverse transcriptase.)
HIV uses which of the following processes to synthesize a DNA strand using its RNA genome as a template? conjugation reverse translation transcription translation reverse transcription
reverse transcription
HIV uses which process to synthesize a DNA strand using its RNA genome as a template?
reverse transcription
HIV uses which of the following processes to synthesize a DNA strand using its RNA genome as a template?
reverse transcription -Retroviruses are equipped with an enzyme called reverse transcriptase, which makes a DNA copy of an RNA template, providing information flow from RNA to DNA.
The lytic cycle of bacteriophage infection ends with the
rupture of the bacterium
The lytic cycle of bacteriophage infection ends with the _____.
rupture of the bacterium
The lytic cycle of bacteriophage infection ends with the _____. replication of viral DNA entry of the phage protein coat into the host cell assembly of viral particles into phages the injection of phage DNA into a bacterium rupture of the bacterium
rupture of the bacterium
Identify the three main categories of hits in terms of similarity to the query sequence. (For help approaching this question, see Hint 1.) sequences that are similar to the last 170 amino acids of the query sequence sequences that are similar to the first 170 amino acids of the query sequence sequences that are similar to the entire length of the query sequence sequences that are similar to the first 75 amino acids of the query sequence sequences that are similar to the last 75 amino acids of the query sequence
sequences that are similar to the last 170 amino acids of the query sequence sequences that are similar to the entire length of the query sequence sequences that are similar to the first 75 amino acids of the query sequence
Identify the three main categories of hits in terms of similarity to the query sequence. (For help approaching this question, see Hint 1.)
sequences that are similar to the last 170 amino acids of the query sequence. sequences that are similar to the entire length of the query sequence. sequences that are similar to the first 75 amino acids of the query sequence.
At the time Charles Darwin sailed on the HMS Beagle, _____.
several biologists had proposed that species might change over time, but none had suggested a convincing mechanism that might cause the change
Imagine two species that are thought to have a recent common ancestor. If this idea is correct, these two species most likely have
several homologous structures similar embryological development.
How does sequence by synthesis techniques differ from previous sequencing methodologies?
simultaneous sequencing of many small fragments of DNA, thereby reducing the amount of time required to sequence a genome
The genetic material of HIV consists of
single-stranded RNA
The genetic material of HIV consists of _____. single-stranded DNA single-stranded RNA double-stranded DNA double-stranded RNA none of the above
single-stranded RNA
The genetic material of HIV consists of _____.
single-stranded RNA -The genetic material of HIV consists of two molecules of single-stranded RNA.
The brine shrimp Artemia and the grasshopper, an insect, have very similar homeobox genes but very different body forms. What accounts for the differences?
small changes in regulatory sequences of particular genes cause changes in gene expression patterns that can lead to major changes in body form
What tool or resource is useful for identifying previously unknown protein-coding genes in a genomic DNA sequence?
software that searches for translational start and stop signals
The bacteria Staphylococcus aureus has developed resistance to some antibiotic drugs. How did this resistance come about?
some members of the bacteria population possessed some sort of genetic variation for antibiotic resistance that was selected for when the bacteria was exposed to the drugs
Gametic isolation
sperm and egg are incompatible EX.) a coral's sperm can't fertilize during different times of day
Transcription of the structural genes in an inducible operon starts when the pathway's product is present. does not result in the production of enzymes. starts when the pathway's substrate is present. occurs continuously in the cell. stops when the pathway's product is present.
starts when the pathway's substrate is present.
The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____.
sticky ends
Lyell's principle of uniformitarianism _____.
strongly influenced Darwin's view of how living organisms could change over time
In the science of genomics, scientists
study whole sets of genes and their interactions
AZT is a nucleoside analog used to treat HIV infections. It is a modified nucleoside. Which step does AZT hamper in the reproductive cycle of the HIV virus?
synthesis of DNA from RNA catalyzed by reverse transcription
How Systems are studied
systems biology approach model the dynamic behavior of whole biological systems, gene circuits and protein interation networks, microarrays, cancer project iin different stages to look at the entire organism as one body
How has gene duplication played a critical role in evolution?
t produces redundant copies of existing genes, which are then free to mutate and adopt new functions.
Homeotic genes contain a homeobox sequence that is highly conserved among very diverse species. The homeobox is the code for that domain of a protein that binds to DNA in a regulatory developmental process. Which of the following would you then expect? that all organisms must have homeotic genes that all organisms must have homeobox-containing genes that a homeobox-containing gene has to be a developmental regulator that homeoboxes cannot be expressed in nonhomeotic genes that homeotic genes are selectively expressed over developmental time
that homeotic genes are selectively expressed over developmental time
What is the most reasonable conclusion that can be drawn from the fact that the frequency of the recessive trait (aa) has not changed over time?
the 2 phenotypes are about equally adaptive under laboratory conditions
Which of the following is a property of life shared by prokaryotic cells and eukaryotic cells, but not viruses?
the ability to process energy to replicate without invading a host cell
What is bioinformatics? a technique using 3-D images of genes to predict how and when they will be expressed the application of computational methods to the storage and analysis of biological data software programs available from NIH to design and synthesize genes a procedure that uses software to order DNA sequences in a variety of comparable ways a series of search programs that allow a student to identify which labs around the world are trying to sequence the genome of a given species
the application of computational methods to the storage and analysis of biological data
For any given gene, what ultimately determines which DNA strand serves as the template strand? the base sequence of the gene's promoter which of the two strands of DNA carries the RNA primer the location along the chromosome where the double-stranded DNA unwinds the location of specific proteins (transcription factors) that bind to the DNA
the base sequence of the gene's promoter
Carolus Linnaeus is considered to be the founder of _____, and he _____.
the binomial classification system ... thought that resemblances among different species reflected the pattern of their creation
Carolus Linnaeus is considered to be the founder of ____, and he
the binomial classification system; thought that resemblances among different species reflected the pattern of their creation
The Lactose (lac) operon is likely to be transcribed when
the cAMP and lactose levels are both high within the cell, while glucose levels are low
lysogenic cycle
the cell reproduces normally, and the viral DNA integrates into the chromosome of the host cell
What does each branch point on an evolutionary tree represent?
the common ancestor of the lineages beginning there and to the right of it
What does the operon model attempt to explain?
the coordinated control of gene expression in bacteria
Genome
the entirety of an organism's heredity informatioin. It is encoded either in DNA or, for many type of viruses, in RNA.
What does the similarity in the DNA sequence of homeobox genes in distantly related species indicate about the evolution of these genes?
the homeobox DNA sequence must have evolved very early in the history of life on Earth
As a result of the lytic cycle,
the host cell's DNA is destroyed
As a result of the lytic cycle, _____. the host cell is not destroyed the host cell's DNA is destroyed viral ribosomes are produced viral DNA is incorporated into host cell DNA a prophage is created
the host cell's DNA is destroyed
Regulatory proteins bind to _____. the operator the lactose-utilization genes the regulatory gene RNA polymerase transcription factors
the operator
A subset of a population of birds leaves its habitat on the mainland and colonizes a nearby island. The birds, after a period of time, become reproductively isolated. The island sinks and the population returns to its original habitat. Which of the following statements about these bird populations is true?
the populations will not be able to interbreed because they are different species
When a tryptophan (an amino acid) is present in the external medium the bacterium brings in the tryptophan and does not need to make this amino acid. Which is true when there is no tryptophan in the medium?
the repressor is inactive and RNA polymerase moves through the operator to initiate transcription
The number of genes correlates with _____.
the size of the genome in prokaryotes
The number of genes correlates with _____. and is approximately equal to the number of different proteins that a species can make being higher in Archaea than in eukaryotes the size of the genome in eukaryotes being much higher among Eubacteria than in Archaea the size of the genome in prokaryotes
the size of the genome in prokaryotes
The number of genes correlates with _____
the size of the genome in prokaryotes Prokaryotic genomes are compact,
Part D What was the control group in this study?
the source population in the pike-cichlid pools
What was the control group in this study?
the source population in the pike-cichlid pools
About which of these did Darwin have a poor understanding?
the sources of genetic variations among individuals
During periods of rapid environmental change, what may happen to a species that was well-suited to the former environment?
the species may go extinct; individuals with particular traits that provide an advantage in the new environment will have higher reproductive success; the population may change so much in adapting to the new environment that it is considered a new species; traits that were favorable in the original environment may be detrimental in the new environment
What is proteomics? the linkage of each gene to a particular protein the totality of the functional possibilities of a single protein the study of the full protein set encoded by a genome the study of how amino acids are ordered in a protein the study of how a single gene activates many proteins
the study of the full protein set encoded by a genome
Part E What was the experimental group in this study?
the transplanted population in the killifish pools
What was the experimental group in this study?
the transplanted population in the killifish pools
What information can be learned by comparing genomes from distantly related groups of organisms such as eukarya and archaea?
these comparisons can help clarify evolutionary relationships between organisms that diverged from each other many millions or even billions of years ago
Which of the following statements describes proto-oncogenes?
they can code for proteins that simulate normal cell growth and cell division
One of the characteristics of retrotransposons is that
they code for an enzyme that synthesizes DNA using an RNA template
*One of the characteristics of retrotransposons is that: -they code for an enzyme that synthesizes DNA using an RNA template. -they contribute a significant portion of the genetic variability seen within a population of gametes. -their amplification is dependent on a retrovirus. they generally move by a cut-and-paste mechanism. they are found only in animal cells.
they code for an enzyme that synthesizes DNA using an RNA template.
One of the characteristics of retrotransposons is that
they code for an enzyme that synthesizes DNA using an RNA template.
Notice that the cells in the lower left half of the table are blank. Why?
they represent duplicates of the comparisons in the upper right half of the table
Which of these nitrogenous bases is found in DNA but not in RNA? cytosine adenine thymine uracil guanine Submit
thymine
In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand. thymine ... cytosine guanine ... adenine cytosine ... uracil uracil ... cytosine cytosine ... thymine
thymine ... cytosine
A goal of comparative genomic studies is_________.
to identify genes that are important for evolution of a particular species to identify homologues in model organisms for genes involved in human disease to study genetic variation within a species or a population to study how genomes evolve
What is the goal of comparative genomic studies?
to identify genes that are important for evolution of a particular species to identify homologues in model organisms for genes involved in human disease to study genetic variation within a species or a population to study how genomes evolve
What is the goal of comparative genomic studies?
to identify homologues in model organisms for genes involved in human disease, to identify genes that are important for evolution of a particular species, to study how genomes evolve, to study genetic variation within a species or a population
What was the main goal of the Human Genome Project (HGP)?
to map all the human genes and determine the nucleotide sequence of the entire human genome
What was the main goal of the Human Genome Project (HGP)? to compare the genomes of a large number of individuals from different parts of the world to develop new technologies for studying DNA to map and sequence the genomes of important research organisms such as Drosophila melanogaster to find cures for human genetic disorders to map all the human genes and determine the nucleotide sequence of the entire human genome
to map all the human genes and determine the nucleotide sequence of the entire human genome
Viral DNA makes mRNA by the process
transcription
Viral DNA makes mRNA by the process of _____.
transcription -Viral DNA co-opts the cell's reproductive machinery.
The functioning of enhancers in genes is an example of
transcriptional control of gene expression
Which type of chromosomal rearrangement accounts for the creation of the gene that encodes the BCR-ABL chimeric protein? (For a review of the four different types of chromosomal rearrangements, see Hint 1.)
translocation.
What type of noncoding DNA comprises the largest portion of multicellular eukaryotic genomes?
transposons
What type of noncoding DNA comprises the largest portion of multicellular eukaryotic genomes? pseudogenes gene regulatory sequences introns centromeric sequences transposons
transposons
Which statement correctly describes the difference between transposons and retrotransposons?
transposons move around in a genome by means of DNA intermediate, and retrotransposons move around in a genome by means of RNA intermediate
A flood that separates a population of frogs into opposite sides of a lake is an example of a vicariance event that may result in allopatric speciation.
true
The tryptophan operon is a repressible operon that is turned on only when tryptophan is present in the growth medium. turned on only when glucose is present in the growth medium. permanently turned on. turned off whenever tryptophan is added to the growth medium. turned off only when glucose is present in the growth medium.
turned off whenever tryptophan is added to the growth medium.
Various procedures can be used to detect genetic disorders before birth. Among the tests discussed in this chapter, which is the least invasive (list first), and which two allow the chromosomes of the fetus to be examined?
ultrasound imaging ... chorionic villus sampling ... amniocentesis (Both CVS and amniocentesis involve the preparation of a karyotype using fetal cells.)
How do viroids differ from viruses?
unlike viruses, viroids do not encode proteins
Temperate phages
use both lytic and lysogenic cycles.
Bioinformatics includes all of the following except
using molecular biology to combine DNA from two different sources in a test tube
Bioinformatics includes all of the following except: -developing computer-based tools for genome analysis. -using mathematical tools to make sense of biological systems. -using molecular biology to combine DNA from two different sources in a test tube. -analyzing protein interactions in a species. -using computer programs to align DNA sequences.
using molecular biology to combine DNA from two different sources in a test tube.
Bioinformatics includes all of the following except: analyzing protein interactions in a species. use of mathematical tools to make sense of biological systems. development of computer-based tools for genome analysis. using molecular biology to provide biological information to a system so that it gets expressed. using computer programs to align DNA sequences.
using molecular biology to provide biological information to a system so that it gets expressed.
Comparing Genomes Within a Species
usually SNPS with no ill effect, with duplications, inversions, deletios, studdy migrsation and diff betweem pop
What is the most effective way to stop viral infections?
vaccines
What is the most effective way to stop viral infections? vaccines antiviral drugs wear a hat when you go outside in the winter antibiotics drug cocktails
vaccines
What factor accounts most for the difference in genome size between vertebrates and prokaryotes?
vertebrates have more noncoding DNA sequences
Homologies that appear to have marginal, if any, importance to an organism are called
vestigial structures
In the lysogenic cycle
viral DNA is replicated along with host DNA
In the lysogenic cycle _____.
viral DNA is replicated along with host DNA -Viral DNA, incorporated into host DNA as a prophage, is replicated along with host DNA.
Which of the following molecules make up the viral envelope?
viral glycoproteins phospholipids from human host cell membrane membrane proteins from human host cell
The pointer is indicating the _____.
viral protein coat (head)
Sort the items according to whether they may be found only in free virus particles, only in uninfected host cells, or in both viruses and host cells.
viruses only: capsid, envelope with glycoproteins, capsomere (core protein) host cell only: ribosome both: DNA, RNA, Protein
Which property of water allows a water strider to walk on water?
water's high surface tension
Which of the following terms does not identify a specific area within that infrastructure?
weinbergomics.
Does the order of pairs in the table above describe the same relative "closeness" of globin family members as shown in the model?
yes. pairs of globins at the top of the table are drawn with the closest connections in the model
Based on the premise, identify which 2 globin genes are the most recently duplicated. What is percent amino acid identity between them?
α1 and α2 , with 100% amino acid identity
Which 2 globin genes are most divergent from each other? What is the percent amino acid identity between them?
α1 and α2 , with 100% amino acid identity