Topic 2.6 + 2.7 - Structure of DNA and RNA + DNA Replication, Transcription & Translation
Transcription
(genetics) the organic process whereby the DNA sequence in a gene is copied into mRNA
1. 100 amino acids: STEP 1: One amino acid is coded for by three nucleotides: 100×3=300 STEP 2: There is no stop amino acid so the stop codon must be added: 300+3=303 2. 423 nucleotides: STEP 1: Three nucleotides code for one amino acid: 423÷3=141 STEP 2: The final codon is the stop codon. There is no stop amino acid so one must be removed: 141-1=140
1. If a polypeptide is 100 amino acids long, how many nucleotides make up the mRNA? 2. If a mRNA sequence is 423 nucleotides long, how many amino acids make up the polypeptide?
Taq polymerase
A DNA synthesis enzyme that can withstand the high temperatures of PCR without denaturing. It extends the nucleotide chain from the primers - therefore primers are used to select the sequence to be copied
Anti-codon
A sequence of three bases of a tRNA molecule that pairs with the complementary three-nucleotide codon of an mRNA molecule during protein synthesis.
polymerase chain reaction (PCR)
A technique for amplifying DNA in vitro by incubating with special primers, DNA polymerase molecules, and nucleotides.
Codons
A three-nucleotide sequence of DNA or mRNA that specifies a particular amino acid or termination signal; the basic unit of the genetic code.
conservative model
An entirely new molecule is synthesised from a DNA template (which remains unaltered)
Helicase
An enzyme that untwists the double helix at the replication forks, separating the two parental strands and making them available as template strands.
The nitrogenous base is attached to the 1'- carbon atom (right point). The phosphate base is attached to the 5'- carbon atom (left point)
At which carbon does the phosphate group and nitrogenous base attach to?
Together with their knowledge of chemistry, Crick and Watson used X-ray diffraction patterns of DNA to solve the structure of DNA. X-ray diffraction patterns revealed DNA was a helix, that the molecule had a consistent width, the distance between bases, and that the bases were at right angles to the sugar-phosphate backbone. They used wires to build the the sugar-phosphate backbone and metal cutouts for bases, all to scale. The model allowed them to visualize their interpretations from the diffraction patterns in three dimensions. Model building allowed Crick and Watson to test new ideas as more data became available and to rule out wrong ideas. A breakthrough came with their realization of complementary base pairs joined by hydrogen bonds. With complementary bases positioned on the inside, the model had all the correct dimensions and they had solved the structure of DNA.
Crick and Watson determined the structure of DNA by interpreting X-ray diffraction patterns and building a model of the molecule. How did building a model help them solve the structure?
Each strand of the parent DNA molecule acts as a template to make a new strand. Each new molecule of DNA has one old strand (from the parent DNA molecule) and one new strand. Due to the fact that each of the parent DNA strands are complementary, complementary base pairing ensures the two new DNA molecules will be identical to the parent DNA molecule.
DNA replication is semi-conservative. What does semi-conservative replication mean?
DNA replication
DNA unzips into two parts and splits with the cell. In it's new home each side of the DNA strand attack to matching nucleotides to create 2 exact copies. It is important in puberty and other times of growth as it is the reproducing of your cells.
(DNA) TAC GGT CAC TGA AGT CCC TGC TTA CTG AAT
Decode (mRNA) AUG CCA GUG ACU UCA GGG ACG AAU GAC UUA into DNA
(codons) GU AUG(start) CAC GUG ACU UUC CUC AUG AGC UGA(stop) U (amino acid) Met His Val Thr Phe Leu Met Ser STOP
Decode (mRNA) GUA UGC ACG UGA CUU UCC UCA UGA GCU GAU into both the codon and amino acid
Prokaryotic cells are free in the cytoplasm whilst eukaryotic are in the cell membrane
Describe the differences between prokaryotic and eukaryotic cell ribosomes
RNA polymerase binds to the DNA double helix at the start of the gene. RNA polymerase unwinds the double helix. RNA polymerase breaks hydrogen bonds, separating the two strands of the DNA molecule. One strand acts as a template (the antisense strand). Free RNA nucleotides pair up with their complementary bases in the template strand. Uracil replaces thymine in RNA and pairs up with adenine, cytosine with guanine. RNA polymerase forms the mRNA molecule by joining RNA nucleotides with covalent bonds between the sugar and phosphate. As RNA polymerase moves down the gene, the growing mRNA molecule separates from the template strand and the DNA strands re-join and then twist into a helix. RNA polymerase reaches the end of the gene and releases the mRNA strand.
Describe the process of transcription.
There are many different tRNA molecules in the cytoplasm carrying different amino acids. Ribosome attaches to mRNA (at the start codon). tRNA molecules can be positioned over the mRNA in one of three sites in the ribosome. A tRNA with a complimentary anitcodon binds to the start codon on the mRNA. A second tRNA with an anitcodon complimentary to the next codon binds to mRNA. A peptide bond forms between the two amino acids. Ribosome moves along one codon. The first tRNA (now without an attached amino acid) floats away. A third tRNA (with an anticodon complementary to the third codon) now enters the ribosome and the amino acid chain grows. Ribosome continues until stop codon. Ribosome, mRNA, polypeptide chain are released.
Describe the process of translation.
Waston and Crick
Developed the current model for the DNA double helix; determine the structure of DNA
DNA polymerase
Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
RNA polymerase separates the DNA strands and synthesises a complementary RNA copy from one of the DNA strands. When the DNA strands are separated, ribonucleoside triphosphates align opposite their exposed complementary base partner. RNA polymerase removes the additional phosphate groups and uses the energy from this cleavage to covalently join the nucleotide to the growing sequence. Once the RNA sequence has been synthesised, RNA polymerase detaches from the DNA molecule and the double helix reforms
Explain the steps of Transcription
Ribosomes bind to mRNA in the cytoplasm and move along the molecule in a 5' - 3' direction until it reaches a start codon (AUG). Anticodons on tRNA molecules align opposite appropriate codons according to complementary base pairing (e.g. AUG = UAC). Each tRNA molecule carries a specific amino acid (according to the genetic code). Ribosomes catalyse the formation of peptide bonds between adjacent amino acids (via condensation reactions). The ribosome moves along the mRNA molecule synthesising a polypeptide chain until it reaches a stop codon. At this point translation ceases and the polypeptide chain is released
Explain the steps of translation
The first model generated was a triple helix, Early models had bases on the outside and sugar-phosphate residues in the centre, Nitrogenous bases were not initially configured correctly and hence did not demonstrate complementarity
Faults in the Watson + Crick Model
code, amino acids. nucleotides,G1 phase, differentiation
Fill in the blanks: Genes __________ for proteins. The sequence of __________- in a protein is determined by the sequence of _________ in a gene. Many new proteins are synthesized in cells during the __________ of interphase. This enables cell ___________ .
The phosphate group of one nucleotide attaches to the sugar of another nucleotide (at the 3'- hydroxyl (-OH) group). This results in a phosphodiester bond forming between the two nucleotides (and water is produced as a by-product). Successive condensation reactions result in the formation of long polynucleotide strands
How are DNA linked together in a single strand with a condensation reaction?
After one division, DNA molecules were found to contain a mix of 15N and 14N, disproving the conservative model. After two divisions, some molecules of DNA were found to consist solely of 14N, disproving the dispersive model
How did Meselson and Stahl support that the semi-conservative method was correct?
The gene responsible for insulin production is extracted from a human cell. It is spliced into a plasmid vector (for autonomous replication and expression) before being inserted into a bacterial cell. The transgenic bacteria (typically E. coli) are then selected and cultured in a fermentation tank (to increase bacterial numbers). The bacteria now produce human insulin, which is harvested, purified and packaged for human use (i.e. by diabetics)
How has the ability to transfer genes between species been utilised to produce human insulin in bacteria (for mass production)?
DNA polymerase synthesises new strands from the two parental template strands. Free deoxynucleoside triphosphates (nucleotides with 3 phosphate groups) align opposite their complementary base partner. DNA polymerase cleaves the two excess phosphates and uses the energy released to link the nucleotide to the new strand
How is the role of the enzyme DNA polymerase in DNA replication?
Helicase unwinds the double helix and separates the two polynucleotide strands. It does this by breaking the hydrogen bonds that exist between complementary base pairs. The two separated polynucleotide strands will act as templates for the synthesis of new complementary strands
How is the role of the enzyme Helicase in DNA replication?
They used using radioactive isotopes of nitrogen. Nitrogen is a key component of DNA and can exist as a heavier 15N or a lighter 14N. DNA molecules were prepared using the heavier 15N and then induced to replicate in the presence of the lighter 14N. DNA samples were then separated via centrifugation to determine the composition of DNA in the replicated molecules
How were Meselson and Stahl able to test the validity of the three models; conservative model, semi-conservative model, dispersive model?
semi-conservative replication
Method of DNA replication in which parental strands separate, act as templates, and produce molecules of DNA with one parental DNA strand and one new DNA strand
Transcription (stage 1) and translation (stage 2). Transcription occurs in the nucleus, translation occurs in the cytoplasm. A gene is transcribed to produce a RNA copy. The RNA copy is called a messenger RNA (mRNA). The mRNA leaves the nucleus (through a nuclear pore) and enters the cytoplasm. The mRNA is translated to produce a polypeptide. Ribosomes and transfer RNA (tRNA) molecules.
Name the two stages involved in the synthesis of a polypeptide from a gene. In eukaryotic cells, where does each process occur? What is produced by stage 1? What happens to the product of stage 1? What is produced in stage 2? What other cell components are required for stage 2?
Dispersive Model
New molecules are made of segments of new and old DNA
Nucleotides within the same strand are joined by covalent bonds. Between the phosphate group of one nucleotide and the pentose sugar of the other. This is known as a sugar-phosphate bond.
Nucleotides join together to make polynucleotide strands. How are nucleotides in the same strand joined?
The first step of each PCR cycle is to separate DNA strands by heating to 94˚C (to break the hydrogen bonds). This temperature would denature DNA polymerase isolated from nearly all organisms. A heat-stable DNA polymerase has been isolated from a bacterium, called Thermus aquaticus, that lives in hot volcanic springs. Taq DNA polymerase has an optimum temperature of 72˚C and is not denatured at 94˚C.
Outline how heat-stable Taq DNA polymerase enables DNA amplification by PCR.
Transfer amino acids to the ribosome. There are at least 20 different tRNA molecules, each with a specific anticodon. The anticodon on the tRNA will only bind to a complementary codon the mRNA. Due to complementary base pair rules. This ensures amino acids are added in the correct sequence at the ribosome.
Outline the function of tRNA molecules.
Helicase unwinds the double helix. Helicase breaks hydrogen bonds, separating the two strands of the DNA molecule. Each strand acts as a template. Free DNA nucleotides pair up with their complementary bases in each template strand. Adenine with thymine and guanine with cytosine. DNA polymerase forms each new strand by joining nucleotides together with covalent bonds between the sugar and phosphate. Two identical DNA molecules are formed.
Outline the process of DNA replication.
DNA molecules are double stranded.. The two DNA strands are connected by hydrogen bonds between the nitrogenous bases. Adenine pairs with thymine. Guanine pairs with cytosine. A - T and G - C are complementary base pairs. Each DNA strand is the complementary sequence of the other. The DNA strands are antiparallel. This means they are orientated in opposite directions. The DNA strands are twisted into a double helix. The sugar and phosphate groups are on the outside of the molecule. The nitrogenous bases are on the inside of the molecule.
Outline the structure of a DNA molecule.
The mRNA sequence read by the ribosome in triplets of bases
State what a codon is.
sense strand
The DNA strand which is always represented on paper. The strand is always the one running from the 5' to the 3'. mRNA is identical to the strand except Thymine is replaced with Uracil.
The Rosalind Franklin Controversy
The final construction of a correct DNA molecule owed heavily to the X-ray crystallography data generated by Franklin. This data confirmed the arrangement of the DNA strands into a helical structure. The data was shared without Franklin's knowledge or permission and contributed profoundly to the final design. Hence, Franklin is now recognised as a key contributor to the elucidation of DNA structure
The genetic code is degenerate because more than one codon sequence can code for the same amino acid
The genetic code is said to be degenerate. What does this mean?
Gene
The sequence of DNA that is transcribed into RNA
Meselson and Stahl grew bacteria in broth. The nitrogen source was heavy nitrogen (15N). Since DNA contains nitrogen, 15N became incorporated into the DNA. A bacteria sample was taken and DNA isolated. Bacteria were then transferred to broth containing light nitrogen (14N). All new DNA synthesized from this point would contain light nitrogen. After one and two generations, samples were taken and DNA isolated. For each generation, there was one DNA replication event. All DNA samples were analyzed by density gradient centrifugation. This technique allows DNA to be separated by its density. The more dense the DNA, the lower a DNA band is seen in the centrifugation tube. DNA isolated from the bacteria grown in 15N broth was present in a single band. DNA isolated from bacteria after one generation in 14N broth had a band intermediate between the bacteria grown in 15N broth and control the bacteria grown in 14N broth. This intermediate band indicated a hybrid DNA molecule, half 15N DNA (the parent strand) and half 14N DNA (the new strand). DNA isolated from bacteria after two generations in 14N broth had the intermediate 15N/14N band and a band equivalent to the bacteria grown in 14N broth. This was the confirmation that DNA replication was semi-conservative. Half of the new DNA molecules should still have one 15N strand and one 14N strand, and the other half of the new DNA molecules should be all 14N.
Use evidence from the Meselson and Stahl's experiment to support the hypothesis of semi-conservative replication.
Amino acids: Met - Gly - Lys - Gly - Arg - Ser
Use the genetic code table to convert the mRNA codons into amino acid sequence. mRNA: AUGGGCAAAGGACGCAGUUAG
Adenine (A) pairs with Thymine (T) via two hydrogen bonds. Guanine (G) pairs with Cytosine (C) via three hydrogen bonds
What are the base pairing in DNA and how many hydrogen bonds are in between?
5-carbon pentose sugar (pentagon), Phosphate group (circle), Nitrogenous base (rectangle)
What are the components of a nucleotide?
Denaturation - DNA sample is heated (~90ºC) to separate the two strands. Annealing - Sample is cooled (~55ºC) to allow primers to anneal (primers designate sequence to be copied). Elongation - Sample is heated to the optimal temperature for a heat-tolerant polymerase (Taq) to function (~75ºC)
What are the steps of PCR?
The theory that each gene is responsible for the synthesis of a single polypeptide.
What does the one gene/one polypeptide hypothesis state?
All living organisms use the same genetic code. This enables a gene from one organism to be introduced into another organism and the same polypeptide is made. This enables the genetic modification of organisms by gene transfer. The human insulin gene was inserted into bacteria. Insulin produced by the genetically modified bacteria is used to treat patients with diabetes.
What feature of the genetic code allows human insulin to be produced by genetically modified bacteria?
rRNA, is responsible fo reading the order of amino acids and linking amino acids together
What is a third type of RNA involved in translation? What does it do? (not tRNA or mRNA)
Nitrogenous bases: DNA (A,G,C,T) + RNA (A,G,C,U); Pentose sugar: DNA (Ribose-OH) + RNA (Deoxyribose-H)
What is the difference between a DNA + RNA nucleotide?
to decode a specific codon of mRNA, using its anticodon, in order to transfer a specific amino acid to the end of a chain in the ribosome.
What is the function of tRNA in protein synthesis?
The genetic code is a triplet code. This means one amino acid is coded for by three nucleotides. There are 64 possible combinations of three nucleotides (43), which is sufficient to code 20 amino acids. On a mRNA molecule, a triplet of nucleotides is called a codon. All 64 codons and the amino acids they code for have been established. Nearly all codons code for a specific amino acid. All living organisms use the same genetic code; the genetic code is universal.
What is the genetic code?
Hydrogen bonds
What type of bond allows the connection between the anti-codon of the tRNA and the codon of the mRNA at the ribosome?
START codon (AUG)
What will the coding region of an mRNA sequence start with?
DNA replication occurs in the S phase of interphase. From one parent DNA molecule, two daughter DNA molecules are made.
When does DNA replication occur (in terms of mitosis)? How many new DNA molecules are made from each parent DNA molecule?
Almost every living organism uses the same code (there are a few rare and minor exceptions). As the same codons code for the same amino acids in all living things, genetic information is transferrable between species
Why is the genetic code considered universal?
RNA
a more versatile single stranded form that transfers the genetic information for decoding (single stranded)
Taq polymerase
an enzyme isolated from the thermophilic bacterium Thermus aquaticus
Nucleotide
monomer of nucleic acids made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base
DNA
more stable double stranded form that stores the genetic blueprint for cells (double stranded)
Translation
process of protein synthesis in which the genetic information encoded in mRNA is translated into a sequence of amino acids on a polypeptide chain
genetic code
the nucleotide triplets of DNA and RNA molecules that carry genetic information in living cells.
antisense strand
the strand of DNA that runs 3' to 5' and is complementary to the sense strand. It acts as a template strand during transcription.
Anti-parrallel strands
the strands must be running in opposite directions, the two strands of DNA
