BC463 FINAL PAST MATERIAL

f we isolate the gene for a particular tRNA, and compare the denaturation of the tRNA with the denaturation of a double-stranded DNA form of the tRNA gene, we found that the two curves are different. Describe 3 molecular differences between tRNA and DNA that could give rise to these differences.

1) The tRNA will have some bases which are not stacked because they are saturated or in loops, and these will result in a quantitative difference in the absorbance change. (2) Some bases in the tRNA are modified (non-canonical) bases which could affect both the temperature of denaturation, and the absorbance change that results. (3) tRNA refolds as mostly A form helices, while the DNA will renature as a B form helix. (4) Some bases in the tRNA form non-Watson/Crick base pairs, which could affect the temperature of denaturation. (5) dsDNA will have twice as many base pairs given the same molar concentration, which was not specified in this question.

Based on the crystal structure, a nucleosome core particle is composed of __________ copies each of histone H2A, H2B, H3, H4 and ________ bp of DNA. In eukaryotic cells, linker DNA between nucleosome core particles are bound by histone _________.

2 146 or 147 H1

How many different types of histones are there in the 30 nm fiber?

5

What experimental method would you use to determine the precise transcription start site of the ovalbumin gene?

5' RACE

If the RNA sequence of a pre-mRNA is 5'-AUGCGUAGU-3', what was the sequence of the template strand of DNA from which this pre-mRNA was transcribed?

5'-ACTACGCAT-3'

For eukaryotic mRNA splicing, the 5' splice site consensus sequence is 5'GUAAGU3'. This consensus sequence is recognized by the U1 snRNP. Based on this information, which one of the following sequences is most likely to be found in U1 snRNA?

5'ACUUAC3'

For an experiment, the 5' splice site sequence of a test mRNA was mutated to 5'CUAAGU3' and splicing no longer occurs. To restore splicing of this test mRNA, which of the following U1 snRNA sequence is the best candidate?

5'ACUUAG3'

What are the 5' ends of eukaryotic mRNA capped with?

7-methyl-Guanidine nucleotide

What is the peak absorption of a mixture of protein and PCR product?

>260

Translation elongation

A charged tRNA is loaded into the ribosomal A site for the first time

What is a mutation that inappropriately introduces a stop codon called?

A nonsense mutation

What is bromodomain?

A reader

To determine sequence conservation between alcohol dehydrogenase genes five different species of cichlid, one should perform ________

A sequence alignment

Histone proteins can be recombinantly expressed in E.coli. Frequently purified histone proteins are contaminated with E.coli DNA. Given the absorbance at 260 and 280 nm of the following histone preparations, which sample has the most DNA contamination?

A260=.75 A280=.25

What is an example of an mRNA sequence that will form a short hairpin with a poly-U linker?

AAACCCGGUUUUUCCGGGUUU

Histone acetyltransferases catalyze the transfer of an acetyl group from ________ to the side chain of ________.

Acetyl-CoA Lysine

When cells are exposed to estrogen, the estrogen:ER complex moves into the nucleus, binds to ERE and promotes recruitment of TFIID. What would ERE be classified as?

An Enchancer

Gene A and Gene B reside next to each other on a mouse chromosome. Normally, Gene A is transcribed completely independently of Gene B. That is, Gene A is transcribed under one set of conditions, and Gene B under a different set of conditions. Scientists discover a mutant mouse where Gene A is now transcribed under the same set of conditions that Gene B is normally transcribed. What is the most likely explanation for the observation in mutant mice?

An insulator found between Gene A and Gene B has been mutated so that a gene regulatory enhancer element that normally acts to regulate Gene B now also regulates Gene A

What are the three phases of a PCR cycle?

Annealing of complementary primers to the target sequence to be amplified

Which of the following is most unlikely to interact with DNA? A. A bHLH domain B. A domain with acetyltransferase activity C. A zinc finger domain D. A homeodomain E. Sigma factor

B. a domain with acetyltransferase activity

Why does the antibody that recognizes histone methylation only stain one of the X chromosomes in females?

Because one of the X chromosomes is silenced in females

What are the five steps of translation?

Binding of the initiator methionine tRNA with the small subunit of the ribosome Joining together of the small and large ribosomal subunits Iterative elongation steps through the incorporation of amino acids into the growing polypeptide chain Termination of polypeptide chain by release factors Dissociation of the ribosomal subunits

RNA Pol II from the "death cap" mushroom is not inhibited by alpha-amanitin. Which part of the mushroom polymerase would you predict is substantially different from its homolog in humans?

Bridge Helix

Working with a newly discovered, novel extraterrestrial life form, some scientists believe they have found an excellent new reporter gene. Which of the following statements would be INCONSISTENT (in other words, not compatible or feasible) with the gene being an excellent reporter gene? A. The potential reporter gene encodes a purple pigmented protein that once it is expressed can be seen under a microscope or with the naked eye. B. The potential reporter gene has codon usage that is similar to that of model eukaryotic organisms, including yeast, Drosophila, C. elegans, and humans. C. Detection of the purple protein relies on an enzymatic reaction using the rare, and expensive substrate purpleum. D. Fusion proteins between the purple protein gene product and other proteins of interest are functional and localize to the subcellular location of the un-tagged protein of interest. E. The potential reporter gene is not toxic.

C. Detection of the purple protein relies on an enzymatic reaction using the rare, and expensive substrate purpleum.

Which of the below is not a characteristic of eukaryotic gene expression? A. The GTF machinery shows a small degree of diversity, but activators and repressors show enormous diversity. B. Different activators can homodimerize or heterodimerize to control expression of multiple genes. C. Genes that control the same metabolic pathway tend to locate in a cluster on one chromosome. D. Gene expression is determined in part by whether the gene is localized in euchromatin or heterochromatin. E. Enhancers and promoters that are localized a few hundred kilobases apart can be brought in close proximity.

C. Genes that control the same metabolic pathway tend to locate in cluster on one chromosome

Which is true about RNA Pol II transcription termination? A. Termination occurs when 3'-end of RNA folds into a stem-loop structure. B. Termination occurs when RNA Pol II recognizes the AATAAA signal. C. RNA Pol II transcribes beyond the polyadenylation site and transcription terminates. D. Termination only occurs after splicing is completed. E. Termination only occurs after the CTD is completely phosphorylated.

C. RNA Pol II transcribes beyond the polyadenylation site and transcription terminates.

Anabel is interested in understanding the transcription factor PHA-4. To identify all the regions in the genome where PHA-4 binds, Anabel performs a(n) DNA-seq assay. To determine the gene expression patterns that differ between wild-type and pha-4 mutants, she performs a(n) ChIP-seq in the wild-type and mutant samples.

CHIP-seq RNA-seq

What is a function of aminoacyl tRNA synthase?

Catalyze the ligation of individual amino acids to a tRNA molecule

In eukaryotic chromosomes, _______ is the structure where kinetochores form during chromosome segregation and _________ is the structure that is synthesized using RNA as a template.

Centromere Telomere

Of the methods we discussed in class, which can be used to detect in vivo DNA-protein interactions?

ChIP

What experimental method would you use to determine whether TFIID is recruited to the promoter of the ovalbumingene in a breast cancer cell line?

ChIP

What experimental method would you use to determine whether histone acetyltransferases are recruited to the promoter of the ovalbumin gene in vivo in a breast cancer cell line?

ChIP

What experimental method would you use to determine where TBX-23 protein binds in the C. elegans genome and thereby infer the genes whose expression it regulates?

ChIP-seq

The Brem lab is interested in pursuing the hypothesis that the histone modification H3 K27 acetylation is abundant in nucleosomes located at the 5' end of transcribed genes. What experiments would BEST help the Brem lab test this hypothesis?

ChIP-seq using an antibody against H3 K27 acetylation + RNA-seq

What does the c in cDNA stand for?

Complementary

Which of the following is NOT likely to be recruited to modified gene X in response to estrogen? A. a chromatin remodeling enzyme B. a histone acetyltransferase C. Mediator D. CTCF(CTCF binds to insulators to establish chromatin domains) E. an architectural transcription factor

D. CTCF

The Listeria monocytogenes transcription factor PrfA regulates genes involved in pathogenesis. Which of the below statements is NOT true about the mechanism of PrfA regulation? A. PrfA translation only occurs at body temperature. B. The Shine-Dalgarno sequence is blocked at low temperatures preventing translational initiation. C. PrfA transcription occurs in both low (environmental) and high (body temp) temperatures. D. PrfA translational repression requires ligand binding directly to the 5'UTR of PrfA. E. PrfA translation induces actin comet tails to rocket the bacteria around and between host cells.

D. PrfA translational repression requires ligand binding directly to the 5'UTR of PrfA.

Is a promoter a protein or DNA?

DNA

Is a silencer a protein or DNA?

DNA

Is an enhancer a protein or DNA?

DNA

Is an insulator a protein or DNA?

DNA

Is an operon a protein or DNA?

DNA

What do DNA microarrays utilize many of?

DNAs immobilized on a solid support

This method can be used to determine where Replication complex is bound on DNA during different phases of the cell cycle?

DNase footprinting

What experimental method would you use to determine which part of the enhancer sequence is bound by the estrogen receptor in vitro?

DNase footprinting

What is an example of using functional genomics to learn more about the genes in a genome?

Determining which genes are required for viability by performing RNAi on each gene

What accounts for the biggest differences between the genomes of chimpanzee and human?

Differences in non-coding DNA

Which statement is FALSE about miRNAs? A. miRNAs are encoded in the nucleus. B. miRNAs are typically processed by both Drosha and Dicer. C. As part of their processing, miRNAs form hairpins. D. miRNAs are loaded into Argonaute proteins. E. Both strands of the miRNA short duplex are retained in Argonaute proteins.

E. Both strands of the miRNA short duplex are retained in Argonaute proteins.

This method can be used to determine the binding affinity between a protein and a RNA fragment?

EMSA

Two DNA binding proteins of different molecular weights recognize the same DNA sequence. Of the methods we discussed in class, which can be used to differentiate between these two proteins?

EMSA

What experimental method would you use to determine whether ER directly binds to the ERE with the sequence: 5'-TGGTCAGGCTGGCT-3' in vitro?

EMSA

If you want to determine whether the protein binds to the PCR product, which technique would you use?

Electrophoretic mobility shift assay

What type of activity does polyadenylation-cleavage complex have?

Endonuclease activity

What experimental method would you use to identify the co-activators that are recruited by the estrogen:estrogen receptor complex

Epitope tagging and affinity purification

Is HDAC a reader, writer or eraser?

Eraser

What are the steps for NextGen sequencing?

Extract DNA Fragment the DNA Add adapters Adhere fragments to flow cell Amplify fragments into clusters Directly image each nucleotide in a cluster using a specialized polymerization reaction

During mRNA splicing by the spliceosome, what is the first trans-esterification reaction?

Formation of a 5' to 2' phosphodiester bond between the 5' end of the intron and the branch point

What is an ongoing process that integrates comparative and functional genomics to create a map of descriptive features at specific locations on a genome?

Genome annotation

What is very unlikely to be found associated with heterochromatin?

HAT

The model organisms Saccharomyces cerevisiae and Schizosaccharomyces pombe can both do what?

Have both haploid and diploid life cycles

What non-covalent interactions are involved in the formation of tRNA structures?

Hydrogen bond, Salt Bridge, and Van der Waals

Rachel is interested in performing a western blot to detect the protein ELT-1. She has obtained a batch of very active camel anti-ELT-1 antibody but she is not sure whether it will be compatible with any of the other antibodies her lab currently has in stock. Below is a list of the antibodies in their stock. What could she use in conjunction with camel anti-ELT-1 to do a Western blot?

IRdye labeled rabbit anti-camel AlexaFluor labeled donkey anti-camel

Anh recently performed a screen in a human colon cancer cell line and discovered that the gene GATA4 is important for maintaining high rates of cell division in that line. Anh wants to learn more about GATA4 so she looks it up in the ENCODE database. What type of information would she learn about GATA4 through ENCODE?

In tissues where GATA4 is expressed, nucleosomes around its promoter adopt regular spacing GATA4's promoter region is bound by the transcription factor EDF2 in most cell types GATA4 is predominantly transcribed in human endoderm tissues GATA4 itself is a transcription factor that binds upstream of key cell identity genes in the intestine and colon

What is folding of the 10 nm fiber into a more condensed 30 nm fiber facilitated by?

Increased salt concentration

What would be a method for demonstrating the denaturation of a tRNA molecule?

Increasing concentrations of ions should result in increased interaction of cations with the phosphate backbones of the double helical regions, decreasing the repulsion forces and increasing the temperature required to get denaturation.

What do DNA-binding proteins that bind to specific sequences primarily recognize dsDNA through?

Interactions with the exposed chemical groups in the major groove of the DNA

The complete set of all the different protein-protein interactions in a cell is called what?

Interactome

The complete set of all the different protein-protein interactions in a cell type is referred to as ________.

Interactome

In the Positional Effect Variegation (PEV) of drosophila eye color, inversion of the chromosome led to a white-eyed phenotype. What's the molecular mechanism that underlies this observation?

Inversion of the chromosome led to placement of the White gene in heterochromatin

Which of the following statements are correct about IPTG? It binds to the lac repressor and causes conformational changes of the protein It is a metabolite produced by E.coli It acts as an allosteric effector It binds to the lac operator and causes conformational changes of the DNA Its effect on the lac operon mimics that of lactose

It binds to the lac repressor and causes conformational changes of the protein It acts as an allosteric effector Its effect on the lac operon mimics that of lactose

SYBR-Green is commonly used in Real-time PCR to monitor the progress of PCR because....?

It fluoresces upon binding to dsDNA

The estrogen receptor (ER)is a transcription factor that regulates the expression of many genes by binding to a specific DNA sequence found in their regulatory regions. This sequence is called the estrogen response element (ERE). When cells are exposed to estrogen, the estrogen:ER complex moves into the nucleus, binds to ERE and promotes recruitment of TFIID. What would you predict about the structure of ER with estrogen bound to it?

It would be a multidomain protein with DNA binding and transcriptional activation functions

What would be the effect of increasing the salt concentration in the buffer on the denaturation of tRNA?

It would increase the Tm

This method can be used to reveal chromosome translocation events that often occur in cancers?

Karyotype analysis

What experimental method would you use to determine whether the ERE is occupied by nucleosomes in the absence or presence of estrogen

MNase digest followed by PCR OR ChIP

What would you conclude about how yeast respond to these three stress types?

Many genes are either up or down-regulated in response to all three stress types. Temporally gene expression changes slower in response to H2O2 treatment than Heat treatment. Similar group of genes are either up or down-regulated in response to all three stress types.

What is evidence that the mediator is a co-activator commonly used in promoting transcription in eukaryotes?

Mediator binds to RNA Pol II Mediator binds to multiple activators, such as Gal4-VP16 and the Vitamin D receptor Mediator subunits fused to Gal4 DNA binding domain can activate transcription in the absence of the activation domain Mediator subunits were identified as genetic suppressors of RNA Pol II CTD truncation in yeast

What is composed of all the genetic material that is present in an environmental sample, obtained from many different organisms?

Metagenome

What catalyzes the formation of phosphodiester bonds and produces RNA and pyrophosphate as products?

Mg++

You are studying two mutants of the trp operon in E. coli. In Mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function. Mutant B expresses a trp repressor protein unable to bind tryptophan. In the presence of high tryptophan, which cells behave like wild-type cells? Which mutant can be ''cured'' by expressing wild-type trp repressor in them?

Neither of the mutants Mutant B

In the electronmicrograph of cellular chromatin, which parts of the cell are enriched in heterochromatin?

Nucleolus and nuclear envelope

If dendritic neurons express ACT-B higher than any other gene in their genome, what do you expect to happen in RNA-seq assays of dendritic neurons on the Illumina platform?

On the sequencing flow cell, the clusters that form from ACT-B cDNA fragments will be more numerous than the clusters formed from most other genes.

In addition to staining with the antibody that recognizes methylated histones, scientists also stained female cells with an antibody that recognizes acetylated histone H4. What would you predict about the staining pattern of the two X chromosomes?

One of the X chromosomes will stain with anti-methylation antibody, the other will stain with anti acetylation antibody

The new sequencing facility technician has made a mistake and added only dye-labeled dideoxynucleotides that were intended for Sanger Sequencing to an Illumina nextSEQ flow cell. What do you expect to happen?

Only one nucleotide will be incorporated and the sequencing will fail.

What is one enzymatic activity involved in protein synthesis that uses a ribozyme?

Peptidyl transferase

Restriction enzymes cleave __________ bonds and two pieces of DNA with compatible ends can be rejoined by the enzyme _______

Phosphodiester DNA ligase

During this stage, the RNA-DNA hybrid and polymerase complex is extremely stable

Promoter clearance

Ser5 in the RNA Pol II CTD is phosphorylated during this stage

Promoter clearance OR Transcription elongation

Transcription cleavage factors help to rescue arrested polymerase during this stage

Promoter clearance OR Transcription elongation

Within the cell, restriction endonucleases serve the purpose of...?

Protecting the bacterial cell against invading viruses

Is a mediator a protein or DNA?

Protein

Is a reader a protein or DNA?

Protein

Is an activator/repressor a protein or DNA?

Protein

Is an eraser a protein or DNA?

Protein

This method can be used to determine the beginning sequence of mRNA?

RACE

What does an Argonaute protein bound to a small regulatory RNA together form?

RISC or miRISC or RISC complex

Eukaryotic ribosomes are composed of roughly of 65%_____ and 35%________

RNA Protein

What experimental method would you use to determine which genes are dependent on tbx- 32 by knocking out the gene tbx-32 and determining any resulting gene expression differences in that mutant compared to wild type?

RNA-seq

Is chromodomain a reader, writer or eraser?

Reader

Sequence elements in the 3'UTR can __________ regulate translation

Recruit RNA binding proteins to Block mRNA circularization to Prevent translation initiation factors from binding their proper target to Be fused to GFP in a reporter construct to determine whether and how they

What is RNA Pol II CTD phosphorylated at Ser5 a signal for?

Recruitment of the capping enzyme

Translation termination

Release factors, proteins with a similar structure to tRNAs, recognize stop codons and promote the hydrolytic release of the peptide

What experimental method would you use to determine whether the ovalbumin transcription unit can be used in zebrafish to report estrogen levels in water

Reporter gene assay

What experimental method would you use to test whether a sequence in the 3'UTR of the tbx-32 mRNA transcript regulates its expression through translational control?

Reporter gene assay

What are conserved features of RNA polymerases from three domains of life?

Require other proteins to relieve tension generated by supercoiling of DNA Require other proteins to correctly recognize the promoter Undergo conformational changes from initiation to elongation stages of transcription

What are the 3 steps to amplify mRNA by 3' RACE?

Reverse transcribe with anchor primer Anneal internal sense primer to denature and extend primer Amplify PCR with anchor and internal primers

cDNA is made from mRNA with what enzyme?

Reverse transcriptase

What are examples of RNPs that function as ribozymes?

Ribosome Group I intron Group II intron Spliceosome snRNP

What molecules are composed of RNA and protein?

Ribosome Telomerase Spliceosome snoRNP

Eukaryotic ribosomes are comprised of...

Roughly 65% RNA and 35% proteins

Histone methyltransferases catalyze the transfer of a methyl group from ___________ to the side chains of ____________ and _____________

SAM Arginine Lysine

In eukaryotes, DNA methyltransferases catalyze the transfer of a methyl group from _________________ to _____________, which is a silencing mark.

SAM Cytosine

This method separates a type of biological molecules based on their size?

SDS-PAGE

During translation, the Shine-Dalgarno sequence undergoes complementary base pairing with what?

Sequences in the 16S RNA

During translation, the anticodon undergoes complementary base pairing with what?

Sequences in the mRNA

Which of the following would describe a metagenomics sequencing project? Sequencing stool samples collected from gibbons as they transition to a new diet Sequencing all the organisms in an emu's gut Sequencing the genome of an extinct Tasmanian tiger from museum-preserved tissue Sequencing the latest flu strain isolated in a clinic Sequencing all the organisms in a sample of hot spring mud

Sequencing stool samples collected from gibbons as they transition to a new diet Sequencing all the organisms in an emu's gut Sequencing all the organisms in a sample of hot spring mud

In bacteria, what proteins are responsible for locating the transcription promoters in the genome?

Sigma factors

Ribosome Recycling

Small and large ribosomal subunits are released and quickly re-bound by initiation factors

Translation initiation

Small and large ribosomal subunits join

Diego has just made a transgenic Arabidopsis plant by incorporating the pathogen resistance gene from cotton, called RES-1, into the Arabidopsis genome. In cotton, the RES-1 gene works best if it is present in just one to two copies in the genome, not three or more, as that causes silencing. Diego has used a transgenic approach that favors 1 - 2 copies. However, to ensure that the cotton RES-1 gene has successfully incorporated into the Arabidopsis genome and to know for sure how many copies are present, he should perform a ________ blot.

Southern

What is a bacterial intrinsic transcription terminator composed of?

Stem-loop and polyU

What approaches to understanding a new gene's function could be classified as a comparative genomics approach?

Testing whether a gene's 3'UTR sequence contains a conserved RNA Binding Protein binding sequence Testing whether a gene has high sequence similarity to known tRNA sequences

What can the positions of nucleosomes be changed by?

The actions of chromatin remodeling enzymes

In the Position-effect variegation experiments, white-eyed flies arise due to disruption of the boundary element on chromosome 3. Which of the following statement is correct about boundary element?

The boundary element helps the formation of heterochromatin vs euchromatin domains

Why are tRNA and rRNA chemically modified after they are transcribed?

The chemical modifications enhance their abilities to fold into different structures

The sequence of an ERE is: 5'-TGGTCAGGCTGGCT-3'. What would be the most likely consequence of insertion of this sequence approximately 200 bases upstream (-200) of the +1 transcription start site of another gene X?

The expression of X would become estrogen responsive

What is an example of genome annotation?

The fugu genome was sequenced in 2008. In 2010, all the transcription start and end sites on the fugu genome were identified using RNA-seq information.

RNA polymerase I and snoRNA are mostly localized in what?

The nucleolus

Comparing Group I and Group II introns, what is a common characteristic shared between them?

They don't require ATP to complete splicing

What is the purpose of adding a secondary antibody in a Western blot?

To amplify the signal and allow for detection

What can DNA microarrays allow us to do?

To analyze localization of DNA-binding proteins after ChIP To analyze genome-wide mRNA expression To compare mRNA expression profiles between cell types

In cells, movement of RNA or DNA polymerase will cause supercoiling, which is relieved by the class of enzymes called what?

Topoisomerase

The yeast two-hybrid assay takes advantage of which principle below?

Transcription activators often contain independent DNA binding domains and transcription activation domains that can work together if brought to close proximity.

Why does attenuation not occur in eukaryotes?

Transcription and translation occur in one cellular compartment in bacteria, but separate compartments in eukaryotes

This is the stage Hsp70 transcription is regulated in response to heat shock

Transcription elongation

Bacteria encode different sigma factors to control this step

Transcription initiation

The leader sequence in the trp operon uses the rate of translation to regulate this step in transcription

Transcription termination

A lab uses RNA-seq to determine all the genes that are expressed uniquely in a kidney tumor as compared to the surrounding healthy kidney tissue. This is an example of what?

Transcriptomics

The process of moving proteins from a polyacrylamide SDS-PAGE gel onto a membrane support is called the __________ step.

Transfering

Zolinza is a drug marketed by Merck to treat cutaneous T-cell lymphoma. Chemically it is an HDAC inhibitor. If we harvest tumor cells from patients who are treated with Zolinza or a placebo control, which of the following observations would you expect?

Tumor cells treated with Zolinza have higher histone acetylation levels than the control

What can't DNA microarrays do?

Utilize antibodies to recognize different sequences

Which statement is true with regard to the requirement for TBP in eukaryotic transcription?

Virtually all promoters require TBP for gene expression.

Sasha is studying a zebrafish protein called PELL-1 nvolved in metabolic functions. She hypothesizes that the PELL-1 protein is processed under high temperatures into a smaller protein. To test this hypothesis, she should perform a ___________________________ under high and low temperature conditions in an attempt to see a size change.

Western Blot

What experimental method would you use to determine whether the TBX-32 protein is present in muscle tissue and not in intestine tissue?

Western blot or Reporter gene assay

What experimental method would you use to determine whether a sister species of C. elegans, C. robinoson, also contains TBX-32?

Whole Genome sequencing

Is HAT a reader, writer or eraser?

Writer

Is HMT a reader, writer or eraser?

Writer

What experimental method would you use to determine whether ER binds to TFIID subunit TAF150?

Yeast two-hybrid assay (EMSA possible but not ideal)

A frameshift during translation can introduce what?

a section of amino acids not typically found in the protein

What does 'epi' in epigenetics mean?

above or over

What are the enzymes that covalently link amino acids to tRNAs?

aminoacyl-tRNA synthetases

In NextGen sequencing, the amplified fragments of DNA adhered and amplified on a flow cell are called what?

clusters

When RNA-seq is being performed, adapters are ligated onto _______ .

fragmented cDNA

In response to low amino acid availability, the rate of translation _____

goes down

By itself, methylated H3K9 inhibits transcription but in the presence of methylated H3K4 and methylated H4K20 the three modifications act together to stimulate transcription. This is evidence that.....

histone modifications are being read as a code in which groups of modifications have specific meaning

In mammals, mutation of the 5' splice site leads to exon exclusion. This "exon definition" model of splicing is further supported by the observation that....

in mammals exons tend to be short and intron sizes vary significantly

What does LUCA stand for?

last universal common ancestor

The _______________ class of small, regulatory RNAs are encoded as genes in the genome and are transcribed by Polymerase II. This sets them apart from other classes of small, regulatory RNAs.

miRNAs

What influences splicing efficiency

phosphorylation state of RNA Pol II CTD sequence of the intron SR proteins hnRNP proteins

Is a coactivator/corepressor protein or DNA?

protein

snRNA is the RNA component of what?

the spiceosome or snRNP

What are typical targets of the siRNA pathway?

viruses and transposons

What is the peak absorbance of PCR product?

~260

What is the peak absorption of Protein?

~280

What are the similarities between prokaryotic and eukaryotic cells?

•RNA synthesis is always 5' -> 3' •Requires a DNA template •Does not require a primer •Requires NTP •Generally 3 stages: initiation, elongation, termination •Prokaryotic and eukaryotic RNA polymerases have similar architecture •Affected by supercoiliing

What are the differences between prokaryotic and eukaryotic cells?

•Requirement of the DNA template sequence: promoter •Proteins that recognize the promoter •A single RNA Polymerase in prokaryotes, 3 (or more) in eukaryotes •Transcription is coupled to translation in prokaryotes •Transcription is coupled to RNA processing (capping and splicing) in eukaryotes •Gene structure is often polycistronic in prokaryotes