BIO-100 Test #2

Translation is helped along by molecules of _____, each of which recognizes one nucleotide triplet and carries the corresponding amino acid.

tRNA

A _____ is made up of hundreds or thousands of smaller units called amino acids, attached to one another in long chains.

Protein

The genetic code is ________. A) what allows codons to be translated into amino acids B) our DNA - what makes us who we are C) our genes D) our genome E) the complementary base-pairing of A going with T and C going with G

A) what allows codons to be translated into amino acids

Which of the following is correct regarding stem cells: A) All are correct B) Play critical roles in development and regeneration C) Can be used in regenerative medicine D) Stem cells can self renew and generate differentiated cells E) Model organism such as planaria and zebrafish are used in stem cell research

A) All are correct

What is the function of a transcription factor? A) Control the rate of transcription B) Remove exons in the mRNA C) Control the rate of DNA replication D) Bind to the promoter E) Make more than one polypeptide from the same gene

A) Control the rate of transcription

Which one of the following does not play a role in translation? A) DNA B) tRNA C) Amino acids D) Anticodon E) Ribosomes

A) DNA DNA contains the instructions for making proteins, but these instructions are transcribed to RNA before translation occurs.

Why does transcription occur in the nucleus and not in the cytoplasm in eukaryotes? A) DNA cannot leave the nucleus. B) None of the above C) RNA cannot exist in the cytoplasm. D) Ribosomes cannot leave the nucleus. E) Codons are only found in the nucleus.

A) DNA cannot leave the nucleus.

What do the letters D-N-A stand for? A) Deoxyribonucleic acid B) Dioxyribonuclear acid C) Deoxyrobonuclear acid D) Dioxyribonucleic acid

A) Deoxyribonucleic acid

When is cell-to-cell communication particularly important in regulating gene expression? A) During embryonic development B) During mitosis C) During replication D) None of the above E) During meiosis

A) During embryonic development

Which of the following is FALSE regarding a transfer RNA (tRNA): A) It is found in the nucleus B) It holds an amino acid on one end of the molecule C) Carries the anticodon on one end of the molecule D) It is made of 4 different nucleotides E) tRNA goes from 3' -5' (complementary to the mRNA)

A) It is found in the nucleus

Which of the following is FALSE regarding a calico cat: A) It would impossible, as X-chromosome inactivation happens only in XX females B) It would possible if it is heterozygote for the color allele C) It would be impossible if his genotype is XY D) It would possible to find a male cat as long as his genotype is XXY E) It would be possible but extremely rare in male cats

A) It would impossible, as X-chromosome inactivation happens only in XX females

The following mRNA sequence 5' AUG ACU AAA GAG UCA CCA UGA AUA UGG will be translated to: (* = stop codon). A) Met-Thr-Lys-Glu-Ser-Pro-* B) Met-Thr-Lys-* C) Met-Thr-Lys-Glu-Ser-Pro-Ile-* D) Met-Thr-Lys-Glu-Ser-Ile-* E) Met-Thr-Lys-Glu-Ser-Pro-Ile-Trp-*

A) Met-Thr-Lys-Glu-Ser-Pro-*

If DNA directs the production of RNA, what does RNA make? A) RNA makes proteins. B) All are correct. C) RNA makes membranes. D) RNA makes hereditary molecules. E) RNA makes more DNA.

A) RNA makes proteins.

The anti-codon of a tRNA has the sequence 3' UCG. Which amino acid is covalently attached to it? (The genetic code is shown) A) Ser B) Gln C) Arg D) Leu E) Val

A) Ser

According to the base pairing rules of DNA, if the sequence of bases on one strand was AGGCTTA, what would be the sequence of bases on the complementary strand? A) TCCGAAT B) CGGATTC C) ATTCGGA D) AGGCTTA

A) TCCGAAT

What does it mean when we say a gene is "turned off"? A) The gene cannot be transcribed and translated into a protein. B) The gene is now activated. C) The gene has a mutation. D) The gene is no longer working properly. E) The gene has lost the exons.

A) The gene cannot be transcribed and translated into a protein.

After DNA replication, __________. A) each of the two daughter DNA molecules contains one strand from the original DNA molecule and one newly synthesized strand B) a new daughter DNA molecule contains two newly synthesized strands that are identical copies of the original DNA molecule C) the original DNA molecule is destroyed D) only one of the strands of the parent DNA molecule serves as a template for DNA replication

A) each of the two daughter DNA molecules contains one strand from the original DNA molecule and one newly synthesized strand People describe DNA replication as semi-conservative because each daughter molecule contains one of the strands from the parent molecule and one newly synthesized strand.

Which of the following does not occur during RNA processing? A) mRNA attaches to the small subunit of a ribosome. B) Adenine nucleotides are added to the end of the RNA strand, forming a tail. C) Segments of the RNA strand that do not actually code for the protein are removed. D) A modified guanine nucleotide is added to the beginning of the RNA strand as a cap. E) Segments of RNA that do code for the protein are reconnected.

A) mRNA attaches to the small subunit of a ribosome. mRNA attaches to the small subunit of a ribosome at the beginning of translation.

Why do scientists measure gene expression? A) Because Gene expression relates to changes in the genomic DNA B) Because Gene expression is dynamic, and the same gene may act in different ways under different circumstances. C) None of the above. Gene expression is obsolete based on the the new massive parallel sequencing technologies D) Because Gene expression is static, and the same gene is always expressed the same

B) Because Gene expression is dynamic, and the same gene may act in different ways under different circumstances.

Where does the bond form that binds one strand of DNA to its other strand? A) Between the phosphate groups B) Between the bases C) Between the sugar and the base D) Between the phosphate group and the sugar

B) Between the bases

Gene regulation is the process of turning genes on and off, because_____ A) Different cell types express the same genes. B) Different cell types express different genes. C) All the above are true D) Only A and C E) All cell types express all genes.

B) Different cell types express different genes.

Which of the following is FALSE. Finding a male calico cat is: A) Impossible, as X-chromosome inactivation happens only in XX females B) Impossible if his genotype is XY C) Possible as long as his genotype is XXY D) Possible if it is heterozygous for the color allele E) Possible but extremely rare

B) Impossible if his genotype is XY

Using the genetic code, the following RNA sequence will be translated to: AUGACUAAAGAGUCACCAUGAAUAUGG A) Met-Thr-Lys-Glu-Ser-Pro-Ile-Trp B) Met-Thr-Lys-Glu-Ser-Pro-* C) Met-Thr-Lys-Glu-Pro-Ser-* D) Met-Thr-Lys-Glu-Ser-Pro-Ile-Trp-* E) Met-Thr-Lys-Glu-Ser-Pro-Ile-Trp-Trp-*

B) Met-Thr-Lys-Glu-Ser-Pro-*

Do all cells of the body express the same genes? A) Yes, since they all contain the same DNA B) No, since they don't all need to make the same proteins C) No, since they all make the same proteins D) No, since they don't contain the same DNA E) Yes, since they all contain the same RNA

B) No, since they don't all need to make the same proteins

What is the role of primers in the PCR techniques? A) To allow single strands of DNA to bind together B) To target specific areas of DNA C) To add free nucleotides to the newly formed DNA molecule D) To separate strands of double-stranded DNA

B) To target specific areas of DNA

Barr bodies are associated with ________. A) signal transduction B) X chromosome inactivation C) frameshift mutations D) DNA replication E) proto-oncogenes

B) X chromosome inactivation

Which of the following is a correct statement about mRNA? A) mRNA includes a cap that consists of extra adenine nucleotides. B) mRNA moves from the nucleus to the cytoplasm following RNA processing. C) mRNA is transcribed from DNA in the cytoplasm. D) mRNA binds directly to amino acids during translation. E) Segments of mRNA that code for protein are removed before translation.

B) mRNA moves from the nucleus to the cytoplasm following RNA processing. mRNA undergoes RNA processing in the nucleus and then moves to the cytoplasm for translation.

The molecule that results from transcription is called: A) transfer RNA (tRNA) B) messenger RNA (mRNA) C) ribosomal RNA (rRNA) D) messenger DNA (dDNA) E) Only B and C

B) messenger RNA (mRNA)

The small circular molecules of DNA commonly found in bacteria are called ________. A) chromatids B) plasmids C) chromophores D) plastids

B) plasmids

Which nucleic acid acts like an enzyme, stabilizing and orienting different molecules to facilitate the formation of bonds between them? A) mRNA B) rRNA C) DNA D) tRNA

B) rRNA

Which of the following is an example of a transgenic organism? A) a "test-tube" baby produced via in vitro fertilization B) a bacterium found with a plasmid that provides protection against an antibiotic C) a bacterium with human gene for producing insulin D) Dolly, the cloned sheep

C) a bacterium with human gene for producing insulin

Which of the following events occurs during transcription? A) Those segments of the RNA strand that do not actually code for the protein are removed. B) mRNA binds to a ribosome in the cytoplasm. C) A molecule of RNA is formed based on the sequence of nucleotides in DNA. D) The message in mRNA is translated into a protein. E) A cap is added to the RNA molecule.

C) A molecule of RNA is formed based on the sequence of nucleotides in DNA. During transcription, RNA nucleotides line up with their complementary DNA partners, transcribing the information in DNA into RNA

Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand? A) DNA peptidase B) DNA ligase C) DNA polymerase D) DNA helicase

C) DNA polymerase

What separates the strands of DNA in the polymerase chain reaction (PCR) technique? A) Helicase B) Restriction enzymes C) Heat D) pH E) Centrifuge

C) Heat

Which of the following is NOT a modification to the mRNA? A) End capping B) Intron removal C) Promoter binding D) Poly A tail E) Exon splicing

C) Promoter binding

Which of the following is not a modification to the mRNA? A) Exon splicing B) End capping C) Promoter binding D) Intron removal

C) Promoter binding

PCR is used to copy just a relatively small region of DNA, not the entire genome. How do researchers specifically target the region of interest? A) They construct a probe that encodes the entire region of interest. B) They use a shotgun technique, which involves duplicating everything, and then they select the region of interest. C) They use two primers, each about 15 to 20 nucleotides long, that flank the region of interest. D) They cut the region of interest out of the DNA sample and use that as a template for DNA synthesis.

C) They use two primers, each about 15 to 20 nucleotides long, that flank the region of interest. The primers set the endpoints for the region of DNA that is copied through the PCR procedure.

What is the role of primers in the PCR techniques? A) To allow single strands of DNA to bind together B) To add free nucleotides to the newly formed DNA molecule C) To target specific areas of DNA D) To separate strands of double-stranded DNA E) To double the amount of DNA in each cycle

C) To target specific areas of DNA

How is translation initiated? A) DNA helicase binds to the origins of replication. B) RNA polymerase binds to the promoter sequence. C) Two ribosomal subunits bind to the mRNA transcript. D) Two ribosomal subunits bind to the DNA sequence. E) tRNAs bind to the ribosome.

C) Two ribosomal subunits bind to the mRNA transcript.

RNA polymerase is transcribing a segment of DNA that contains the sequence shown below, using the upper strand as template. What will the sequence of this segment of RNA be? 5'GATCTACGTA3' 3'CTAGATGCAT5' A) GAUCUACGUA B) AUGCAUCUAG C) UACGUAGAUC D) CUAGAUGCAU E) None of the above

C) UACGUAGAUC

Can one gene make different proteins? A) No, because genes do not make proteins B) No, because one gene can code for only a single protein C) Yes, by splicing the resulting mRNA differently (i.e., removing different exons) D) Yes, by modifying the original DNA

C) Yes, by splicing the resulting mRNA differently (i.e., removing different exons)

Puberty is caused by the release of follicle stimulating hormone and luteinizing hormone from the pituitary gland. These hormones are delivered to the ovary in girls and initiate the monthly release of mature egg cells. This is an example of what mechanism of regulation of gene expression? A) homeotic genes B) activation of micro RNAs C) a typical signal transduction pathway D) induction

C) a typical signal transduction pathway The hallmarks of a typical signal transduction pathway include a signal molecule sent by another cell that binds to a receptor protein embedded in the plasma membrane of the receiving cell. This activates a series of events inside the cell that can result in turning on or turning off the expression of one or more genes.

Restriction enzymes __________________________. A) restrict access to the DNA of a cell B) bind DNA together at specific nucleotide sequences C) cut DNA at specific nucleotide sequences D) copy DNA

C) cut DNA at specific nucleotide sequences

Gel electrophoresis separates DNA fragments according to their ________. A) base sequences B) polarity C) length D) charge

C) length

The signal transduction pathway allows ________. A) a cell to repair damage to its DNA B) genes from one organism to be inserted into the nucleus of another organism's cells C) one cell to regulate the gene expression of another cell D) cell regulation via homeotic gene expression E) regulate gene expression within a cell

C) one cell to regulate the gene expression of another cell

Gene cloning is used to ________. A) help cure cancer B) make other organisms, such as Dolly, the first cloned sheep C) produce large quantities of human proteins D) cure genetic disorders

C) produce large quantities of human proteins

The site of translation is A) the cell nucleus. B) the plasma membrane. C) ribosomes in the cell cytoplasm. D) ribosomes in the cell nucleus. E) the Golgi apparatus.

C) ribosomes in the cell cytoplasm. Translation occurs at ribosomes in the cell cytoplasm.

Gel electrophoresis separates pieces of DNA based on _________. A) quantity B) sequence C) size D) charge

C) size

The process of accurately amplifying a sample of DNA is called __________________________. A) recombinant DNA B) short tandem repeats C) the polymerase chain reaction D) gel electrophoresis

C) the polymerase chain reaction

In what way(s) can mRNAs be processed? A) By removing the introns (the noncoding regions) of the mRNAs B) By splicing the exons (the coding regions) of the mRNAs in different ways C) By adding caps and tails to the ends of the mRNAs D) All of the above

D) All of the above

Why is cDNA used in RNAseq? A) Because it captures all the genes expressed in a tissue or a cell B) Because cDNA is more stable than RNA C) Existing sequencing protocols are designed for sequencing DNA D) All the above are true

D) All the above are true

Which of the following statements is FALSE regarding Okazaki fragments? A) Okazaki fragments form during DNA replication B) They exist because DNA is anti parallel and can only be synthesized in one direction C) Are found in the lagging strand during DNA replication D) Are found in the leading strand during DNA replication

D) Are found in the leading strand during DNA replication

In Drosophila (fruit fly), the homeotic genes (HOX) are master regulator genes that _____ A) Influence formation of head to tail axis B) Divide the body into segments C) All the above are true D) Determine the anatomy of the body E) None of the above are true

D) Determine the anatomy of the body

Which genes are responsible for your overall structure, such as how many legs you have and where they develop? A) Oncogenes B) Proto-oncogenes C) Growth factor genes D) Homeotic genes

D) Homeotic genes

DNA helicase breaks which type of bond in the DNA molecule? A) Covalent bonds B) Ionic bonds C) Peptide bonds D) Hydrogen bonds

D) Hydrogen bonds

Which of the following is FALSE regarding X-chromosome inactivation? A) In female mammals, one of the two X chromosomes is highly compacted and transcriptionally inactive B) Calico fur coloration is due to inactivation of X chromosomes in heterozygous female cats C) Inactivated X chromosome is called a Barr body D) Inactivated X chromosome happens in the Zygote E) X-chromosome inactivation is Random (either the maternal or paternal chromosome)

D) Inactivated X chromosome happens in the Zygote

How is translation initiated? A) RNA polymerase binds to the promoter sequence. B) DNA helicase binds to the origins of replication. C) Two ribosomal subunits bind to the DNA sequence. D) Two ribosomal subunits bind to the mRNA transcript.

D) Two ribosomal subunits bind to the mRNA transcript.

Which of the following is NOT used in DNA ancestry? A) Y chromosome testing B) Single nucleotide polymorphism (SNP's) testing C) Mitochondrial DNA testing D) X chromosome testing

D) X chromosome testing

A collection of cloned DNA fragments representing an organism's entire genome is called a ________. A) clonal anthology B) complementary DNA collection C) transgenic assembly D) genomic library E) clonal genes

D) genomic library

The gene for the beta chain of normal human hemoglobin has the sequence CTC at the position for the seventh amino acid in the protein. A point mutation changing the sequence to CAC results in sickle cell hemoglobin. Use the genetic code to determine the change in the amino acid at position seven of the hemoglobin beta chain. A) glutamic acid to histidine B) glutamine to histidine C) glutamic acid to leucine D) glutamic acid to valine

D) glutamic acid to valine This single amino acid change makes sickle cell hemoglobin aggregate in red blood cells, changing their shape from a disc to a crescent

The signal transduction pathway allows ________. A) a cell to repair damage to its DNA B) whole genomes to be sequenced C) genes from one organism to be inserted into the nucleus of another organism's cells D) one cell to regulate the gene expression of another cell E) whole genomes to be assembled

D) one cell to regulate the gene expression of another cell

A supplemental appendix is to a book as a ____________ is to a bacterial chromosome. A) genetically modified organism B) bacterium C) restriction enzyme D) plasmid

D) plasmid

Which part of a nucleotide molecule in DNA encodes genetic information? A) the sugar B) the sequence of phosphates and ribose molecules C) hydrogen bonds D) the base

D) the base Genetic information is encoded in the four-letter alphabet that corresponds to the four bases: adenine, guanine, cytosine, and thymine

DNA profiling relies on an individual's ________, no two of which are the same between different people, except identical twins. A) unique set of genes B) unique mRNA sequences C) unique fingerprints D) unique set of short tandem repeats within DNA

D) unique set of short tandem repeats within DNA

_____ is a long linear polymer found in the nucleus of a cell, shaped like a double helix, and associated with the transmission of genetic information.

DNA

Characteristics of DNA only

Deoxyribose sugar Thymine base Double-stranded

Based on the translation below, the subsequent peptide would have: Met-Thr-Lys-Glu-Ser-Pro-* A) 9 amino acids B) 8 amino acids C) 7 amino acids D) 5 amino acids E) 6 amino acids

E) 6 amino acids

The messenger RNA (mRNA) is protected (kept from being degraded) in the nucleus by : A) Removing exons B) Adding a modified guanine (G) at the 3' end of the mRNA C) Removing introns D) Adding a poly A-tail to the 5' end of the mRNA E) Adding a modified guanine (G) at the 5' end of the mRNA

E) Adding a modified guanine (G) at the 5' end of the mRNA

Which of the following statements is incorrect regarding DNA and RNA? A) They each contain a slightly different sugar molecule. B) One of the bases is different. C) DNA is double stranded, and RNA is a single strand. D) They are found in different locations in the cell. E) All of the above are correct

E) All of the above are correct

Histone modification can disrupt its close attachment to DNA, which can lead to: A) "open chromatin", in actively transcribed genes B) "closed chromatin", areas where genes are less expressed C) "open chromatin", areas where genes are more expressed D) "closed chromatin", areas where genes are less expressed E) All the above are true

E) All the above are true

The anti-codon of a tRNA has the sequence 5' UCG. Which amino acid is covalently attached to it? A) Leu B) Gln C) Val D) Asp E) Arg

E) Arg

DNA polymerase III adds nucleotides to the 3′ end of a preexisting strand of nucleic acid during DNA replication. What will the polymerase need to get started? A) Short stretch of DNA called an DNA primer B) Short stretch of DNA palindromic sequence C) Short stretch of a chromosomes D) Short stretch of a gene E) Short stretch of RNA called an RNA primer

E) Short stretch of RNA called an RNA primer

DNA ancestry relies on next generation sequencing. Which is FALSE for DNA ancestry? A) Specific markers (genes) sequencing B) Y chromosome sequencing C) Single nucleotide polymorphism (SNP's) sequencing D) Mitochondrial DNA sequencing E) Whole genome sequencing

E) Whole genome sequencing

DNA replication happens _________ A) in both leading strands B) only in the lagging strand C) in both the lagging strands D) only in the leading strand E) both strands of DNA at the same time

E) both strands of DNA at the same time

Gel electrophoresis separates DNA fragments according to their ________. A) polarity B) base sequences C) all of the above D) charge E) length

E) length

T/F: Both genetically modified plants and animals make up a significant part of our food supply.

False Genetically modified plants make up a significant part of our food supply. However, as of 2013, there are no genetically modified animals that are part of the food supply.

T/F: Standard STR analysis of a DNA sample from a crime scene and DNA from a suspect shows matches at four sites. The suspect is guilty.

False It is possible that multiple individuals could match at four sites. The actual standard STR analysis compares STRs at 13 different sites. Except for identical twins, the chances of two individuals matching at all 13 sites would be extremely remote.

T/F: Transcription factors control exon spicing.

False Transcription factors must bind to DNA before it can be transcribed.

In the nucleus, the process of _____ creates a molecule of RNA from a molecule of DNA.

Transcription

The cellular processes that results in the production of protein begin in the _____, where the DNA resides.

Nucleus

Characteristics shared by both DNA and RNA

Phosphate Guanine base Nucleotides

The principal role of _____ is to act as a messenger carrying instructions from DNA out of the nucleus for the synthesis of proteins.

RNA

The enzyme that performs transcription is called _____.

RNA polymerase

Characteristics of RNA only

Ribose sugar Uracil base Single-stranded

A _____ serves as the site of protein synthesis in the cytoplasm.

Ribosome

Once the mRNA exits the nucleus via the nuclear pores, this molecule travels to a cellular organelle called the _____.

Ribosome

_____ is the first step of gene expression, during which a particular segment of DNA is converted into RNA.

Transcription

There with the ribosome, the sequence of nucleotides on this molecule is used to create a molecule of protein through the process called _____.

Translation

_____ is the process in which mRNA codons are converted into an amino acid sequence.

Translation

T/F: During transcription of a specific gene, only one DNA strand serves as a template for the formation of RNA.

True RNA polymerase binds to a specific DNA sequence on the template strand to initiate transcription. The other strand is not transcribed.

The RNA molecule, which exits the nucleus, is a specific kind of RNA called _____.

mRNA