bio ch 17

Réussis tes devoirs et examens dès maintenant avec Quizwiz!

taking into account the wobble hypothesis, which of the following mRNA sequences could be bound to the tRNA anticodon of 3' GGC 5'

5' CCA 3'

in what direction is RNA synthesized during transcription

5' to 3'

Where does an amino acid attach to a tRNA

At the 3′ end

How does RNA polymerase begin transcription in eukaryotes

By binding to promoter sequences in DNA

In bacteria, sigma binds to the polymerase before transcription begins. Bacterial RNA polymerase and sigma form which of the following

Holoenzyme

Which of the following best describes the significance of the TATA box in eukaryotic promoters

It is the binding site for a transcription factor

What is the term for a complex of mRNA bound with multiple ribosomes, each synthesizing its own polypeptide strand

Polyribosome

What prevents the DNA coding strand and RNA from matching exactly in base sequence

RNA has the base uracil (U) rather than the thymine (T) found in the coding strand. Adenine (A) in the DNA template strand specifies a U in the complementary RNA strand

Which of the following transcribes protein-coding genes in eukaryotes

RNA polymerase II

in eukaryotic, transcription normally stops when

RNA polymerase reaches a termination signal on the DNA that leads to the formation of a hairpin loop in the mRNA

which of the following statements best describes the termination of transcription in bacteria

RNA polymerase transcribes a terminator sequence, causing the polymerase to separate from the DNA and release the transcript

In transcription, ______ produces an RNA molecule with a base sequence complementary to the base sequence of the ____

RNA polymerase; DNA template strand

Modifications needed for converting a primary transcript into a mature RNA are called

RNA processing

modifications needed for converting a primary transcript into a mature RNA are called

RNA processing

Which of the following steps for terminating translation are correct and in the right order

Release factor binds to stop codon; polypeptide and uncharged tRNAs are released; ribosome subunits separate

In addition to RNA polymerase, transcription in eukaryotes requires which of the following

Several transcription factors

the ____ of the eukaryotic promoter is analogous to the _____ of the bacterial promoter

TATA box; -10 box

Which of the following best describes the processing of eukaryotic pre-mRNAs in the proper order

The addition of a 5′ cap; removal of introns; Poly (A) tail

Which of the following statements best describes the ribosome binding site

The ribosome binding site is where the small ribosome subunit binds; it is located upstream of the start codon

In bacteria, transcription ends at a distinct site in each gene. Which of the following best describes transcription in eukaryotes

Transcription ends at variable distances from the Poly (A) signal

in bacteria, when does transcription end

When a stem-loop structure forms in the transcribed RNA

which of the following best describes the splicesome

a complex molecular machine that splices introns out of pre-mRNA

which of the following statements about translational initiation in bacteria is true

a specific sequence on the small ribosomal subunit binds a complementary sequence on the mRNA

ribosomes translate mRNAs into proteins with the help of

adaptor molecules called tRNAs

An advantage of introns is that they

allow expression of different exon combinations from one gene

Researchers report that a protein is encoded by a gene with four promoters that give rise to at least eight different mRNAs. What mechanism could account for the production of these different mRNAs from the same gene

alternative splicing

paul zamecnik and his colleagues tracked the fate of radioactive leucine molecules attached to tRNAs. they found that

amino acids are transferred from tRNAs to proteins

which of the following statements about transcription in bacteria and eukaryotes is true

bacteria and eukaryotes rely on proteins that recognize specific DNA sequences in the promoter to initiate transcription

The release factor (RF)

binds to the stop codon in the A site in place of a tRNA

A gene is a

coding and regulatory sequence that directs the production of one or more related polypeptides or RNAs

group 2

group 2

the poly(A) tail at the end of eukaryotic mRNA

helps protect the mRNA from degradation by enzymes in the cytoplasm

in comparison to bacterial transcription, eukaryotic transcription is more complex. which of the following statements best describes why eukaryotic transcription is more complex?

in eukaryotic transcription, the promoters are more diverse, and the primary RNA transcript must be evenly processed

The process of translation, whether in bacteria or eukaryotes, requires tRNAs, amino acids, ribosomal subunits, and

initiation and elongation factors, plus GTP

a primary transcript in the nucleus of a eukaryotic cell is ____ the functional mRNA, whereas a primary transcript in a bacterial cell is ____ the function mRNA

larger than; same size as

what molecule carries a genetic message from DNA to the protein-synthesizing components of the cell

mRNA

in a eukaryotic cell, which of the following statements about post-translational modification of proteins is true

many proteins are modified chemically after they are synthesized

if there were a mutation in a ribosome that prevented tRNA molecules from moving into the E site, how many amino acids would be found in the resulting peptide chain formed on this ribosome

max of 2

according to the wobble hypothesis

more than one codon codes for an amino acid, and codons for the same amino acid tend to have the same nucleotides in the first two positions

to label amino acids within cells, researchers "pulsed" e.coli with radioactive sulfate and "chased" it with an excess of nonradioactive sulfate. they observed that radioactivity was first associated with ribosomes and then later with completed proteins. they concluded that

proteins are synthesized by ribosomes and are subsequently released

during elongation, what substances are used for the polymerization reaction catalyzed by RNA polymerase

ribonucleoside triphosphates

which of the following are proteins that associate with promoters in bacteria during transcription

sigma

what is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5' AAUCCGUAAAUAGAGACCGAUCAAUUAGCG 3'

six

During RNA splicing, which molecular component of the spliceosome catalyzes the excision reaction

snRNA

what happens to introns in eukaryotic mRNA

snRNPs bind to the primary transcript and form the spliceosome, which removes introns

RNA polymerase reads the template strand. The non-template strand is

the coding strand—its sequence matches the sequence of the RNA that is transcribed from the template strand

which of the following is true of the sequence called TATA box?

the sequence is located 30 base pairs upstream of the transcription site and is important for recognition by RNA polymerase

which of the following factors are associated with transcription in eukaryotes

thee polymerase bases, basal transcription factos, 5' cap, and 3' poly A tail

lack of membrane-bound organelles in bacteria impacts transcription and translation in which way

transcription and translation can occur simultaneously

if a mutation rendered the sigma protein nonfunctional, which of the following would result

transcription of bacterial genes would be reduced or eliminated


Ensembles d'études connexes

Planning Systems PowerPoint 3- William McLaury Rutgers University

View Set

Transport Operations (Chapter 37)

View Set

9. Cellular Respiration and Fermentation (Biology 1)

View Set

Beaufort 5 - Contact 7 - Uitdrukkingen

View Set