BIO Final

The genotypes of the parents for the cross shown in the following Punnett square were___________. (Select the one choice that uses scientific terminology correctly.)

Both heterozygous

Which of the following organelles is one type of cellular shredder that is responsible for breaking down molecules that are ingested by the cell or just not needed anymore?

lysosome

All of the following are required for translation during protein synthesis except...

primase

A ______________ is the location where DNA polymerase begins to synthesize DNA when making a copy of the DNA.

replication origin

If a reaction has a ΔG(free energy change) of -10, then what direction will it go in?

reverse

Which of the following will break one or more types of non-covalent bond, and render a protein biologically inactive?

all of the above

Which of the following statements about the Golgi apparatus is/are true?

all of the above are t

Which of the following will always increase the fluidity of a membrane, regardless of the structure of the membrane you start with?

an increase in the number of unsaturated phospholipids

Each element is unique and different from other elements because of the number of protons in the nuclei of its atoms. Which of the following indicates the number of protons in an atom's nucleus?

atomic #

Which of the following are stabilized by, or dependent on, van der Waals forces?

b and c, but not a (i.e. the second and third answers listed above, but not the first one)

Which of the following is an example of a hydrogen bond?

bond formed when the H of a hydroxyl group comes close to the O of a carbonyl group

After getting to the nucleus, the adenovirus then enters the nucleus...

by being broken apart and then going through the nuclear pore.

During receptor mediated endocytosis, the cell brings material in

by forming vesicles

How does the adenovirus enter a cell?

endocytosis

Which of the following isotopes would a researcher NOT be able to use as part of an experimental design to tell the difference between the movement of proteins and the movement of nucleic acids in their experiment? (You can answer this using what you learned about specific experiments covered in lecture, or you can answer it logically using what you know about atoms in macromolecules.)

(a) 14C

Which of the following is NOT a polymer?

DNA

If you specifically inhibit DNA polymerase I activity, which of the following would occur during DNA replication? (Like almost all problem solving situations you encounter in real-life, this is a logic puzzle. Picture the relevant process or processes. Draw if it helps you picture things.)

DNA synthesis would produce double stranded DNA with short stretches of RNA throughout one of the strands

RNA polymerase generates a nucleic acid polymer that is complementary and antiparallel to which of the following?

DNA template strand

Which of the following are components of BOTH prokaryotic and eukaryotic cells?

DNA, cell membrane, ribosomes, and cytosol.

Which of the following functional groups is/are non-polar?

-CH3

Which of the following are examples of facilitated diffusion? Select the option that includes ALL of the numbered options listed that are correct. Think about the definitions for both underlined words before jumping to conclusions.Answer 1: Water moving down its concentration gradient through an aquaporin.Answer 2: A steroid hormone moving across a membrane without a protein path.Answer 3: Sodium moving down its concentration gradient through a channel.Answer 4: Glucose moving down its concentration gradient through a carrier/passive transporter.Answer 5: Calcium moving against its concentration gradient by active transport.

1 3 4

Using the information below, determine the phenotypic ratio for F2 offspring that have white flowers with a terminal position. You should use a Punnett square on scrap paper, or look at the Punnett square examples with other characters that we went over in your notes.Flower Color: Purple Flower is dominant and white flower is recessiveFlower position: Axial position is dominant and terminal position is recessiveP generation parent 1: true-breeding for purple flowers with axial positionsP generation parent 2: true-breeding for white flowers with terminal positions

1/16

In a monohybrid cross between a true-breeding parent with an inflated seed pod and a true-breeding parent with a constricted seed pod, _____ % of the F2 generation will have a constricted seed pod. (Note: You answer this with the same skills we practiced for seed color in lecture. You need to look up seed pod shape in your notes to get the starting point. This is a real-life use of course information. You just need to know what to look for and where to look.)

25%

As a nucleic acid polymer is synthesized, new nucleotides are always added to the ______________?

3 end

The numbered list in this question is out of order. Which numerical sequence is the appropriate order of the stages when using the scientific method? (1) a falsifiable hypothesis is made along with predictions that match it; (2) the data are analyzed and used to modify the conceptual model; (3) observations are made regarding a natural phenomenon; (4) the scientist builds a conceptual model; (5) the hypothesis is tested; (6) the data are used to update the conceptual model.

3, 4, 1, 5, 2, 6

A researcher is looking at the coding region of a eukaryotic mRNA. While doing her analysis of the sequence on a computer, a program tells her the following:the mRNA is 1600 base pairs longthe 5' untranslated region is 50 base pairs longthe 3' UTR plus the poly A tail is 350 base pairs long (assume the stop codon is part of the 3'UTR)How many amino acids long is the protein that this mRNA encodes? (This is a logic puzzle that requires you to use what you know about mRNA structure and translation. Draw and label the parts of a eukaryotic mRNA like we did in class. Simple arithmetic is what you need after that, so you don't need a calculator!)

400

An atom with 6 protons, 6 electrons and 8 neutrons would have an atomic number of _________ and an atomic mass of approximately ______________.

6/14

If adenine made up 20% of the nucleotides in a sample of DNA from an organism, then what percentage of the nucleotides in this sample would be cytosine?

60

If you cross a true-breeding recessive phenotype plant with plant that has a dominant phenotype but an unknown genotype, then you will get...

A 100% dominant phenotype in F1

If you add a chemical that only stops the action of ribosomes that are found on the rough endoplasmic reticulum, then which of the following would stop?

AOTA

Which of the following are principles of the cell theory or cell doctrine?

All of the above

As a protein is synthesized the end that protrudes from the ribosome as synthesis continues is the ___________?

Amino terminus

Which of the following atoms would form a non-polar covalent bond if they shared a pair of electrons?

C-H

If the sequence of the template strand of DNA for part of a gene is CGTATACGG, then what will the sequence of the mRNA be for this part of the gene? (Take the time to write this out, and be sure you get your 5' and 3' right.)

CCGUAUACG

Which of the following would you expect to be attracted to the hydrogen atoms in a water molecule?

Cl ion

The simultaneous expression (presence) of two different branching carbohydrate flags (i.e. glycolipids and glycoproteins) on the surface of a human's red blood cells is an example of...

Codominance.

Which of the following is a polymer represented by the formula: C(H2O)n?

Complex carbohydrates

What is the difference between covalent bonds and ionic bonds?

Covalent bonds involve the sharing of electrons between atoms, whereas ionic bonds involve the electrical attraction between atoms that have opposite charges.

During DNA synthesis, the energy used specifically to make a phosphodiester linkage comes directly from...

Deoxynucleotides with 3 phosphates

____________ is the enzyme responsible for generating covalent bonds between ribonucleic acid monomers as part of the process of DNA replication. (Read this question carefully and make sure you are paying attention to the terms in the question and the answers or you will jump to conclusions. It is a simple question that requires picturing of a process.)

Dna Primase

Dogs belong to which DOMAIN of life?

Euk

The law of segregation becomes apparent at the phenotypic level (i.e. is visible) in the...

F2 generation when true breeding parents with different phenotypes are used in the P generation.

True or False, by filling in a Punnett square, you can determine the genotype of the next generation for one of the characters Mendel followed, but NOT the phenotype.

False

Phalloidin is a toxin that binds to actin and prevents its depolymerization. Which of the following cellular processes would you expect to be directly disrupted by phalloidin toxicity?

Formation of extensions of the cell membrane to take up the salmonella.

Which of the following base pairs demonstrate the strongest hydrogen bonding to each other when they are in complementary strands of a single DNA double helix?

GC

If the sequence of the coding strand of DNA for part of a gene is GCAAGTTT, then what will the sequence of the mRNA be for this part of the gene? (Take the time to write this out, and be sure you get your 5' and 3' right.)

GCAAGUUU

Which of the following cell structures is INCORRECTLY paired with its function?

Golgi apparatus: chemical breakdown of macromolecules

Which of Mendel's laws explains why a true-breeding parent with yellow round seeds can have some F2 offspring with yellow and wrinkled seeds if the parent is mated with a true-breeding plant that has green and wrinkled seeds?

Law of Independent Assortment

Which of the following is/are a reason/reasons that Mendel selected peas as an organism for his breeding experiments when he could have chosen any organism?

He noticed that there were characters that only had two distinct traits. (b) He could mate (cross) one individual with another individual or he could mate individuals with themselves (self-fertilize). (c) The short generation time and abundance of offspring in each generation would speed up his experiments. A,B,C are correct

A cross between a homozygous purple flower plant with a homozygous white flower plant produces offspring that all have a purple flower. This demonstrates...

Law of dominance

Which of the following is NOT TRUE about scientific inquiry using the scientific method?

Scientific inquiry with the scientific method always provides support for hypotheses.

By definition, the genotype of a true-breeding diploid parent is__________________.

Homozygous

A scientist is studying the total atomic make up of an organism. The elements she is examining are listed below. Select the one that she should predict to be the most abundant element among those tested.

Hydrogen

A neutron ___________________________________________.

Is an uncharged particle in the nucleus of an atom

If an atom had 12 protons, 12 neutrons and 10 electrons, then what can you say about that atom?

It has a +2 charge

Which of the following is NOT true of water?

It is a relatively poor solvent.

You are studying the membranes of a bacterium that lives in a hot spring. The bacterial evolved to live in these permanently hot waters. Knowing that, which of the following would you expect to find in the plasma membranes of the bacterial cells? (Note: You should base your answer only on what you learned about membrane fluidity and temperature in class. This is a thought question, but don't over think it!)

Lots of phospholipids with saturated acyl chains in all of the organisms

Assume that the sequence below is a complete (mature) mRNA. In a live cell, what are the first two amino acids that would be incorporated into the protein this mRNA encodes? (As you know from doing your homework, you will need to open up your notes to find the translation table in order to answer this question.)GUAAUAUCUGUAAUAUGUAUCAUAAAUAGUAUGUGAGAAGGACAACUCAGCAUCUGAUUUGAAAUAUAGCUAUAAAAAA

Met Tyr

What amino acid is found at the beginning (amino terminus) of every protein ever made?

Methionine

Which of the following is a structure that is added to the 5' end of eukaryotic mRNAs and increases the stability of the mRNA.

Methyl guanosine cap

The most common mutations that cause sickle cell anemia are "point mutations". A point mutation is when only a single nucleotide is changed. For example, an T may be converted into a C. If this mutation changes one amino acid in the protein encoded by a gene, then this type of mutation is also referred to as a _____________.

Missense mutation

You want to study diffusion of water across a synthetic phospholipid bilayer (just phospholipids) you synthesized. On one side of the artificial membrane, you have pure water. On the other side of the membrane, you have 1mM glucose. Make a prediction for your experiment! Will the rate of water diffusion be the same in both directions? Why?

No, because there are fewer freely diffusing water molecules on the side with the glucose.

Which of the listed items is one way that the nucleotides incorporated by DNA primase differ from those that DNA polymerase incorporates? (Again, this is a thought question. The important purpose of questions like this is to get you to consider things from multiple parts of your notes instead of just finding one statement in your notes.)

Number of hydroxyl groups attached to carbon atoms of sugar

Which of the following aspects of DNA synthesis differs between a prokaryote and the nuclear DNA of yeast?

Number of replication origins used

______________ are relatively short pieces of DNA that are made on the lagging strand during the DNA replication.

Okazaki fragments

The covalent bond between two amino acids is called a ________________bond and is formed by a ___________ reaction.

Peptide, dehydration

Which of the following is a list that only includes amphipathic molecules?

Phospholipids and bile salts

Water diffuses through cell membranes in certain organs such as the kidneys and bladder much faster than would occur by simple diffusion through a lipid bilayer alone. Based on what you have studied so far in this course, what you would hypothesize accounts for this more rapid rate of water transport across cell membranes in these organs? (i.e. What is the most likely way water can move quickly across the membranes?)

Presence of aquaporin channels for facilitated diffusion of water.

The 3' end of an mRNA coding region encodes the...

Protein carboxy terminus (end)

Which of the following is an enzyme responsible for generating covalent bonds between ribonucleic acid monomers.

RNA polymerase

You first run a test where the male of a mating pair has the dominant phenotype and the female is recessive. To see if sex matters for this character, you cross a female that has a dominant phenotype and a male that has a recessive phenotype. The second test is called a... (Assume all of the parents are true-breeding.)

Reciprocal cross

Which of the following researchers provided X-ray diffraction data demonstrating that DNA was helical in structure?

Rosalind Franklin

In prokaryotes, the first event in transcription is...

Sigma factor and RNA polymerase bind the promoter

Which of the following is a list of polymers that are all formed by dehydration synthesis?

Starch, glycogen and proteins

Which process is the most energetically expensive to perform?

Synthesis of the lagging strand

Evaluate the statement: "A human gene can be inserted into a yeast genome, and the yeast will be able to make the same protein that a human would have made when expressing this gene."

T

True or False, eukaryotes, but not prokaryotes, spatially separate the processes of transcription and translation (i.e. do each in different locations within the cell).

T

Which of the following is true about telomerase and telomeres?

Telomerase produces repetitive sequences that protect the ends of linear DNA

______________ are relatively short repeating DNA sequences that cap the end of linear chromosomes in eukaryotes.

Telomeres

One measure of the average amount of energy in random movement in a system is ___________________.

Temp

The bonding of two amino acid molecules to form a larger molecule when a cell makes a protein requires.

all of the above

A scientist produces an artificial membrane from phospholipids and notices that oxygen (O2) molecules, but not protons (H+), readily move through the membrane. Which explanation best accounts for these observations?

The artificial membrane is most likely impermeable to charged substances.

What would happen to an animal cell that was placed into a solution that was hypertonic to the cell?

The cell would shrivel and shrink.

You find something that looks like a life form, but it does not grow, develop or reproduce in the environmental conditions you found it in. Based on these observations, and the example we had in lecture when we covered the basic characteristics of life, you can say that...(Hint: Think back to the brine shrimp hatching slide we had in our first recorded lecture.)

The data are inconclusive, because living things may not display all of the defining qualities of life at all times.

Which of the following properties or processes are associated with living things, including cells?

all of the above

Which of the following statements best distinguishes theories from hypotheses in science?

Theories are explanations of natural phenomenon that are supported by a large body of evidence

What is the role of the spliceosome in a cell?

To remove introns from a pre-mRNA.

Which of the following enzymes prevents supercoiling of DNA during replication?

Topoisomerase

The step in protein synthesis where a code in the DNA is read in order to make an mRNA with the same code is called __________________.

Transcription

A ______________ is the location where RNA polymerase begins to synthesize an mRNA.

Transcription start site

True or False, a single nucleotide mutation in a single enzyme can stop an entire metabolic pathway from functioning. If you are unsure, then look back to the homogentisic acid oxidase example.

True

True or False, all of the characters Gregor Mendel selected for his pea breeding experiments have two possible traits.

True

True or False, in eukaryotes, chromosomes are composed of DNA wrapped around proteins.

True

Assume the sodium concentration outside of the cell is 100 mM and the sodium concentration inside of the cell is 10 mM. Sodium can pass through sodium channels in the plasma membrane. Based only on what we covered in lecture, how can the cell prevent the sodium concentration inside of the cell from increasing?

a and b

Which of the following are components that play a role the in regulation of mRNA export from the nucleus?

a and c

Sodium ion (Na+) concentrations are often higher outside a cell and glucose concentrations are often higher inside the cell. Na+-dependent glucose transporters use the Na+ electrochemical gradient to drive glucose transport into cells. Which of the following statements regarding Na+-dependent glucose transporters is TRUE?

a b c

Frederick Griffith's experiments with mice and Salmonella bacteria are important because they demonstrated that_____________.

a molecule of some type provides a genetic code that bacteria can share with each other

Organelles other than the nucleus that also contain nucleic acids include...

all of the above

The pH of the cytosol in a cell changed from 7.8 to 7.6. Which of the following might cause this change in pH if it was added to the cytosol? (This is relevant, because it happens in real life!)

acids

Consistent with the fluid mosaic model of biological membranes, phospholipids in biological membranes...

can move laterally within one leaflet of the membrane

About 25 of the 92 natural elements are known to be essential to life. Which four of these 25 elements make up 96% or more of the mass of living cells?

carbon, hydrogen, nitrogen, oxygen

Which of the following molecules can increase the fluidity of a membrane at low temperatures and decrease the fluidity of membranes at high temperatures?

cholesterol

There are 20 different amino acids. What makes one amino acid different from another?

different side chains (R groups) attached to an alpha (α) carbon

Which of the following properties describes the ability of an atom to pull in electrons that it is sharing in a covalent bond with another atom? (i.e. how strongly the electrons are drawn to the atom)

electroneg

The image below is of a real plasma membrane ion transport system that exists in the stomach. In this image, the chloride is moved by ________________________. (Important fact: The chloride concentration in the stomach lumen is higher than inside the gastric mucosal cell that surrounds the stomach lumen. FYI: lumen just means inner part of a compartment.)

facilitated diffusion

Evidence suggests that mitochondria and chloroplasts in eukaryotic cells originated evolutionarily...

from prokaryotic cells that were engulfed and not digested.

After they undergo the process called ionization, the elements sodium and chlorine become ______________________, because the ionized form of each element is ________________.

hydrophilic, charged

Which cytoskeletal structures are a highly diverse group of tension-bearing protein fibers important to the maintenance of cell shape?

intermediate filaments

Two different atoms each have the same number of protons, but a different number of neutrons. These atoms should both be described as __________.

isotopes

Which of the following is never found in the middle of a phospholipid bilayer (i.e. the part of the membrane where the phospholipid acyl chains are)?

large polar molecules

The molecule displayed in the accompanying image is __________________.

lipid

Which of the following energy forms cannot be used to do work in a cell?

mech. eng

Which of the following sequences best represents the hierarchy of biological organization from the SMALLEST level to the LARGEST level?

molecule, cell, organ system, population, ecosystem, biosphere

Microfilaments are paired with _____ motor protein(s); whereas microtubules are paired with _____ motor protein(s). (Before answering, remind yourself of the difference between motor proteins and the cytoskeletal proteins they walk on.)

myosin; kinesin and dynein

Do all of the characters we see in nature follow Mendel's laws?

no, there are examples of characters that do not follow Mendelian genetic patterns, but this does not mean that Mendel's laws are incorrect.

A researcher isolated different parts of a rat liver cell to examine transcription, mRNA processing and translation. Which part(s) of the cell should this researcher examine to study spliceosomes?

nucleus

Which of the following functional groups is removed from an ATP molecule when ATP is converted into ADP?

phosphate

Large numbers of ribosomes would be needed in cells that are actively synthesizing large amounts of _________.

proteins

Which of the following organelles is responsible for catalyzing the reactions that make peptide bonds?

ribosomes

In polypeptides, the alpha helix and the beta pleated sheet are both types of ______ structure, and that level of protein structure only requires _____ bonds to form.

secondary; hydrogen

The liver is involved in detoxification of many poisons and drugs. Which of the following structures is primarily involved in this process and, therefore, must be abundant in liver cells?

smooth er

Which structure is not directly involved in the protein secretory pathway?

smooth er

After it escapes from the endosome, which of the following does the adenovirus need to get to nucleus?

the cytoskeleton and two types of motor proteins are enough

Which of the following is NOT true of a eukaryotic cell's plasma membrane?

the extracellular and intracellular leaflets are identical in composition to one another

Which of the following incorrectly describes an aspect of the structure and/or function of tRNA? (i.e. Which one is wrong?)

there are three tRNAs that recognize stop codons

Unlike simple diffusion, facilitated diffusion additionally requires...

transmembrane channels and carriers.

Which of the following is critical for the process of translation, because it both hydrogen bonds with a specific codon in the mRNA and carries a specific amino acid?

trna

Which of the following is the main bond type or force that determines the fluidity of a membrane?

van der Waals forces