BIO Old midterms
Indicate the order of events in The Epic Journey of Gene Expression of a eukaryotic gene A) tRNA anticodon base pairs with mRNA codon B) 5' cap added to the mRNA C) Rat1 binds to 5' end of cleaved RNA D) Release Factor enters ribosomal A site E) RNA polymerase II binds to the promoter
1- E 2- B 3- C 4- A 5- D
Which of the following elements would NOT be found in an mRNA molecule? (You may choose more than one.) A) Origin of replication B) Protein - coding region C) 3' untranslated region D) TATA box E) exons F) start codon
A & D
A mother of blood type A gives birth to a child with blood type O. Which of the following could NOT be the blood type of the father? A) AB B) A C) O D) Any of these is a possible blood type of the father. E) B
A)
A three-point test cross produced the following genetic map. A total of 6 double-crossovers were observed out of a total of 300 progeny. What is the Interference value? a _________22________ b _________15 ______c A) 0.033 B) 0.39 C) 0.61 D) 0.967
B
Match each of the following with its function in replication of the E. coli chromosome. Initiator proteins (DnaA)
Bind to origin of replication
A testcross of an AaBb dihybrid produced the following numbers of progeny in each of the phenotypic groups: 18 AB, 20 ab, 42 aB, 40 Ab. Which of the following accurately describes the relative locations of alleles A and B? A) They are linked in the coupling configuration. B) Their locations relative to each other cannot be determined using this information. C) They are not linked. D) They are linked in the repulsion configuration.
D
Brown coat color in a hypothetical animal species is determined by an allele of a gene that is dominant in males and recessive in females. Heterozygous males are brown, whereas heterozygous females are yellow. Females that are homozygous for this allele are brown. What type of inheritance is exhibited by this trait? A) Sex-limited B) Pleiotropic C) Incomplete dominance D) Sex-influenced E) Cytoplasmic
D
You learn that a Mars lander has retrieved a single-celled organism from the polar ice caps. You obtain a sample of these cells and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars organism replicates its DNA. Based on the following equilibrium density gradient centrifugation results, what type of replication would you propose for this new organism? Band position moves slightly up with each centrifugation A) Semiconservative B) Conservative C) Semiconservative or dispersive D) Dispersive E) Conservative or dispersive
D
Assume that the diploid or 2n number of chromosomes is 18 for a certain species of animal. How many DNA molecules will be found in meiotic metaphase II for this species? A) 72 B) 9 C) 36 D) 24 E) 18
E
Match each of the statements concerning DNA replication with the appropriate mode or modes. DNA synthesis begins from many origins of replication
Linear eukaryotic only
Match each of the statements concerning DNA replication with the appropriate mode or modes. Replication of most of the genome is completed by fusion of the replicons
Linear eukaryotic only
Match each of the following with its function in replication of the E. coli chromosome. DNA polymerase I
Removes primers and replaces with DNA
Match each of the following with its function in replication of the E. coli chromosome. DNA polymerase III
Responsible for leading and most lagging strand synthesis
Match each of the statements concerning DNA replication with the appropriate mode or modes. DNA synthesis is always continuous
Rolling circle only
Match each of the statements concerning DNA replication with the appropriate mode or modes. Initiation of DNA Synthesis requires a single-strand nick in the DNA
Rolling circle only
Match each of the following with its function in replication of the E. coli chromosome. Primase
Synthesizes short RNA strands
Match each of the following with its function in replication of the E. coli chromosome. Helicase
Unwinds DNA strands at replication forks
Match each of the following with its function in replication of the E. coli chromosome. DNA Gyrase
relieves torsional stress
A color blind woman and a man with normal vision have a son who has normal vision and has an XXY karyotype (Klinefelter syndrome). What is the most likely explanation for this result? (Note: color blindness is a recessive X-linked trait) A) Nondisjunction in meiosis I in the father. B) Nondisjunction in meiosis I or meiosis II of the mother. C) Nondisjunciton in meiosis I in the mother. D) Nondisjunction in meiosis I or meiosis II in the father.
A
A geneticist is studying the insulin gene, which has a TATA box in its promoter. Through genetic engineering, the scientist mutates the TATA Binding Protein (TBP) from human cells in culture. This mutation prevents TBP from binding to DNA. What is the most likely effect of this mutation on the cells that possess it? A) All gene containing a TATA box will not be transcribed B) There will likely be no effect C) The insulin gene will be transcribed and translated D) All genes containing a TATA box will be transcribed but not translated E) The insulin gene will be transcribed but not translated
A
A series of two-point test crosses are performed for genes a, b, c, and d. The following percent recombinants were observed. What is the most correct genetic map, including the most accurate distance between the genes that are farthest apart? The numbers in the possible answers represent map units. % Recombinants a - b 19 a - c 36 a - d 15 b - c 20 b - d 5 c - d 23 A) a---------15---------d---5---b----------20-------------c ; most distant genes are 40 map units apart B) b------------20----------c----------23------------d------15-----a ; most distant genes are 36 map units apart C) d---------15---------a-----------19----------b---5-----c ; most distant genes are 36 map units apart D) a---------15---------d---5---b----------20-------------c ; most distant genes are 36 map units apart
A
A true breeding plant with red leaves is crossed to a true breeding plant with green leaves. The F1, all of which had green leaves, were self-crossed resulting in the following F2: 67 green leaves and 13 red leaves. Use the chi-square goodness of fit test to calculate the chi-square value and consult the provided chi-square table to determine probability range. What is the probability range and are the observed results consistent with Mendelian predictions? A) 0.05 < P < 0.1; consistent with Mendelian predictions B) 0.5 < P < 0.1; not consistent with Mendelian predictions C) 0.5 < P < 0.1; consistent with Mendelian predictions D) 0.05 < P < 0.1; not consistent with Mendelian predictions
A
Freckles are caused by a dominant allele. A man has freckles, but one of his parents does not have freckles. The man has fathered two children with a woman that does not have freckles. What is the probability that both of their children have freckles? A) 1/4 B) 1/16 C) 1/2 D) 1/8
A
How many introns are present in an intron-containing gene that consists of five exons? A) 4 B) 6 C) 3 D) 0 E) 2 F) 5
A
Imagine you're an astrobiologist trying to crack the genetic code of a microbe in another galaxy. You isolate a mutant with a one base-pair insertion in Gene X which causes the gene to be frameshifted and therefore nonfunctional. You then isolate a base-pair deletion in Gene X a few nucleotides downstream of the first mutation. When combined, these two mutations result in a functional version of Gene X. What does this experiment reveal about the genetic code of this alien microbe? A) This experiment does not reveal anything about the genetic code B) The genetic code is universal C) The genetic code is quadruplet (words of 4 nucleotides) D) The genetic code is doublet (words of 2 nucleotides) E) The genetic code is degenerated
A
In humans, occasionally a baby is found that has the XX chromosomal karyotype but is phenotypically male. Which of the following statements is the most likely explanation for at least some of these cases? A) A piece of chromosomal material containing an active SRY gene is found attached to one of the X chromosomes. B) The ratio of number of X chromosomes to number of sets of autosomes is incorrect. C) A mutation has occurred in the SRY gene making it inactive. D) A small piece of autosomal chromosome 15 is missing but is too small to be detected. E) An extra piece of autosomal chromosome 15 is probably present in the genome but is too small to detect.
A
The pedigree below shows the X-linked recessive inheritance of Nance-Horan syndrome, a rare Mendelian disorder in which affected persons have cataracts and abnormally shaped teeth. What is the probability that the first child of IV-6 and V-3 would have Nance-Horan syndrome? II-3, III-2, IV-3,4,5,7 are effected. A) 1/8 B) 1/2 C) 3/4 D) 3/16 E) 1/4
A
Which of the following does not contribute to genetic variation? A) Crossing over between sister chromatids of the same chromosome. B) All of the events described contribute to genetic diversity. C) Crossing over between nonsister chromatids of homologous chromosomes. D) None of the events described contribute to genetic diversity. E) Independent assortment of nonhomologous chromosomes.
A
Which of the following is not involved in either causing or solving the end replication problem in eukaryotes? Correct answer: A) Lengthening the 5' end to match the length of the 3' end. B) Extension of the 3' end by telomerase. C) An RNA-dependent DNA polymerase. D) Incomplete replication by lagging strand synthesis.
A
Which of the following statements comparing RNA to DNA is INCORRECT? A) The bases in RNA include thymine instead of uracil. B) RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA. C) The 2' carbon of the sugar in RNA has an OH, unlike the H in that position of the sugar in DNA. D) The RNA sugar is ribose instead of deoxyribose. E) All of the other statements are correct.
A
Which of these sequences could form a stem-loop? A) 5'-CGTGTTTTTACACG-3' B) 5'-CGTGTTTTCGTGT-3' C) 5'-TTTTTTTCCCCCC-3' D) 5'-AAAAAAAAAAAA-3' E) 5'- AAAAACCCCCCC -3'
A
You just isolated a mutant in the eukaryotic single-cell organism Saccharomyces cerevisiae ("Brewer's Yeast") that fails to transcribe your favorite gene. Which of the following is highly unlikely to contain your mutation? (You can choose more than one.) A) Rut site B) sigma subunit binding site C) shine-Dalgarno sequence D) Promoter E) TATA box F) transcription start site
A&B&C
According to both the Holliday and double-strand break models for homologous recombination, resolving Holliday junctions A) only results in heteroduplex regions if a crossover is produced. B) may or may not result in a crossover, depending on the planes of cleavage. C) involves making double-strand nicks in DNA and joining the ends together. D) occurs spontaneously without the need for protein activities. E) always results in a crossover.
B
An individual that is heterozygous for three linked genes is testcrossed. The phenotypes and number of progeny are below. What is the correct genetic map, including map unit distances between genes? +++ 74 abc 70 a++ 44 +bc 50 ++c 4 ab+ 2 a+c 368 +b+ 388 Total 1000 A) b---------14.4-------- a-----9.4-----c B) b----------15.0--------a-----10.0-----c C) b-----10.0------c---------15.0--------a D) a----------15.0--------b-----10.0-----c
B
Bacteria are said to be "competent" if they are able to A) donate DNA to a recipient by conjugation B) be transformed by directly take up DNA from their environment. C) participate in bacteriophage-mediated transfer of DNA. D) receive DNA from an F' donor.
B
Consider pedigrees showing the following characteristics: - Usually appears in both sexes with equal frequency. - Does not skip generations. - Unaffected parents do not transmit the trait. - Affected fathers transmit the trait to sons and daughters with equal frequency. What is the MOST likely mode of inheritance for this disorder? A) Autosomal recessive B) Autosomal dominant C) X-linked dominant D) Y-linked E) X-linked recessive
B
Failure to degrade Shugoshin at the appropriate time will result in A) premature separation of homologous chromosomes. B) nondisjunction in meiosis II. C) incomplete replication of chromosomes. D) nondisjunction in meiosis I.
B
In an organism that has 7 pairs of homologous chromosomes (2n = 14), how many different combinations of chromosomes in the gametes are possible? A) 7 B) 128 C) 32 D) 64 E) 14
B
Two linked genes, (A) and (B), are separated by 18 m.u. A man with genotype Aa Bb marries a woman who is aa bb. The man's father was AA BB. What is the probability that their first child will be Aa bb? A) 0.41 B) 0.09 C) 0.18 D) 0.50 E) 0.25
B
Which of the following is INCORRECT about SARS-CoV-2 RNA? A) Both the + strand and the - strand are synthesized by the same enzyme B) The - strand serves as the template for translation C) The - strand serves as a template for the + strand, and the + strand serves as a template for the - strand D) Viral RNA is transcribed from an RNA template E) The + strand is the strand that gets packaged into the virus
B
Which of the following would NOT necessarily be true for the percentage of bases in a double-stranded DNA molecule? A) A + G = C + T B) A + T = G + C C) C = G D) A = T E) A + C = G + T
B
Which term correctly describes the molecule below? A) Thymine base B) Purine base C) Nucleotide D) Pyrimidine base E) Nucleoside
B
Why is the formation of Barr Bodies necessary? A) It is in response to environmental stimuli that determines phenotypic sex. B) It is necessary for dosage compensation. C) It is not necessary, but it contributes to genetic variation. D) It determines the sex of the individual.
B
Many types of RNA are naturally present in both eukaryotes and prokaryotes. Which of the following RNAs are NOT present in both eukaryotes and prokaryotes? (You can choose more than 1.) A) Messenger RNA B) Micro RNA C) Ribosomal RNA D) Transfer RNA E) CRISPR RNA
B & E
The following biological molecules are held together by either hydrogen bonding or covalent bonding. Select the ones held together by hydrogen bonding. (You can choose more than one.) A) Amino acids joined together through peptide bonds B) Two complementary strands of DNA binding to each other C) tRNA binding to its amino acid D) tRNA anticodon binding to its codon
B&D
A man is heterozygous for a rare trait that is assumed to be caused by a dominant autosomal mutant allele. He marries a woman who is phenotypically normal. They have a phenotypically normal daughter who marries a phenotypically normal man. Unexpectedly their first child, a girl, has the same abnormal trait as her grandfather. Which of the following BEST explains this situation? A) This is an example of genomic imprinting, and the mutant allele is only expressed if it is inherited from the father. B) This is a sex-influenced trait and alleles are differently expressed in females and in males. C) The mutant allele shows incomplete penetrance, and the normal daughter carries the mutant allele. D) The mutant allele shows incomplete dominance when heterozygous with the normal allele. E) The trait is really due to a mutation in a cytoplasmic gene and can be inherited only from the mother.
C
How do germ-line mutations differ from somatic mutations? A) Germ-line mutations are reversible, while somatic mutations are not B) Germ-line mutations occur during DNA replication, while somatic mutations do not C) Germ-line mutations can be passed on to offspring, while somatic mutations cannot D) Germ-line mutations result in cancers, while somatic mutations do not E) Germ-line mutations involve small changes to DNA such as base-pair substitutions, while somatic mutations usually involve large deletions
C
The table below shows the results of interrupted-mating experiments with three different Hfr strains. What is the order of the genes, starting with C? 1 - A, B, E, D, F 2 - D, F, C, G, A 3 - D, E, B, A, G A) C, B, E, D, F, G, A B) C, F, D, B, A, E, G C) C, G, A, B, E, D, F D) C, D, F, G, A, B, E E) C, G, A, D, F, B, E
C
Through genetic engineering, a geneticist mutates the TATA box for the insulin gene in cultured human cells. This mutation prevents TBP from binding to the TATA box. What is the most likely effect of this mutation on the cells that possess it? A) There will likely be no effect B) All genes containing a TATA box will not be transcribed C) The insulin gene will not be transcribed D) The insulin gene will be transcribed but not translated E) All genes containing a TATA box will be transcribed but not translated
C
Two loci control body color in beetles. In a cross between a black beetle and a white beetle you obtain a ratio of 9 black to 7 white beetles. What kind of gene interaction is this? A) Recessive epistasis B) Codominance C) Duplicate recessive epistasis D) Compound heterozygotes E) Dominant epistasis
C
What is the most likely mode of inheritance for the trait segregating in the pedigree below? II-1,4 and IV-3,6,9 are affected both males and females. A) X-linked dominant B) X-linked recessive C) Autosomal recessive D) Autosomal dominant
C
Which of the following statements about genetic exchange in bacteria is NOT true? A) A major difference between Hfr strains is caused by the different chromosomal locations of transposable elements in the F+ strain from which they are derived. B) Plasmids do not have to integrate into the host cell chromosome in order to be replicated. C) Conjugation results in the production of a new Hfr strain. D) In conjugation there has to be a physical connection between the donor cell and the recipient cell.
C
Which of the following statements about nutritional requirements and growth of bacteria is NOT true? A) Specific auxotrophic bacteria may be identified based on whether they can grow on defined media. B) Prototrophic bacteria can grow on defined media. C) Auxotrophic bacteria can grow on minimal media. D) Culture media developed for bacteria must contain a carbon source and simple salts for the survival of the bacteria. E) All of the other answers are true statements.
C
Which of the following statements about ribosomes and ribosomal RNA is NOT true? A) Multiple different ribosomal RNAs are processed from a single ribosomal RNA transcript B) Ribosomal RNA is typically the most abundant RNA in a cell C) Ribosomal RNA is processed in eukaryotes but not in prokaryotes D) The human genome has many copies of ribosomal RNA genes
C
You are interested in studying large-scale chromosome rearrangements, such as transversions and duplications. Which of the following sources will be most likely to provide you with a high level of such rearrangements. A) Zebrafish treated with 5-Bromouracil B) Prokaryotic cells grown in a petri dish C) Cancer cell lines grown in a petri dish D) Tissue from humans afflicted with Huntington's Disease E) SARS-CoV-2 F) Siamese cats
C
You just isolated a mutant in the eukaryotic single-cell organism Saccharomyces cerevisiae ("Brewer's Yeast") that fails to transcribe your favorite gene. Which of the following regions is most likely to contain your mutation? A) Sigma subunit binding site B) 5' splice site C) TATA Box D) Rat1 exonuclease
C
A husband and wife are both heterozygous for autosomal recessive alleles that cause cystic fibrosis. If they have four children, what is the probability that three children will be healthy and one will have cystic fibrosis? A) 0.211 B) 0.026 C) 0.047 D) 0.422
D
Explain what the following data say about the genetic and environmental influence on each characteristic. (MZ = monozygotic twins and DZ = dizygotic twins) Trait Concordance in MZ Concordance in DZ A MZ - 80 DZ- 75 B MZ- 80 DZ - 20 A)Traits A and B both are strongly affected by environmental factors with little or no genetic basis. B) Traits A and B both are strongly affected by both environmental factors and genetic factors. C) Traits A and B both have a strong genetic basis and little or no environmental basis. D) Trait A is strongly affected by environmental factors with little or no genetic basis, whereas trait B is significantly affected by genetic factors.
D
If an AaBbCcdd individual is crossed to an AabbccDd individual, what is the probability that the first offspring will have the same genotype as one of the parents? A) 1/4 B) 1/16 C) 1/32 D) 1/8
D
In a species of bird, males are the homogametic sex and females are the heterogametic sex. Which of the following statements is TRUE in this system of sex determination? A) Female offspring have a ZZ chromosome constitution. B) Male offspring have a ZW chromosome constitution. C) The gender of the offspring is determined by gametes from the male parent. D) The gender of the offspring is determined by gametes from the female parent. E) Female and male offspring have the same chromosome constitution.
D
The beginning of a protein has the following amino acid sequence: Met-Ala-Gln-Arg-Ser-His. The gene encoding this protein was mutated to produce the following mutant sequence: Met-Ala-Gln-Leu-Glu-Tyr. Which describes the MOST likely type of mutation that occurred? A) transition B) transversion C) missense mutation D) frameshift mutation E) temperature sensitive mutation
D
The following is a short sequence near the beginning of exon 1 of an mRNA. 5' AUG GCU AAC 3' What will be the sequence of the anticodon (from 5' to 3', left to right) that will pair with the second codon in the mRNA? A) GTT B) CGA C) CAU D) AGC E) GCU F) GCT
D
Which of the following Before/After statements best describes the change in scientific knowledge brought about by the Neurospora experiments performed by Beatle & Tatum + Srb & Horowitz? A) Before: we thought Neurospora were auxotrophic. After: we know that Neurospora are autotrophic! B) Before: we thought genes and proteins were colinear. After: we know that RNA splicing violates the principle of colinearity in eukaryotes! C) Before: we thought protein was the genetic material. After: we know DNA is the genetic material! D) Before: we thought proteins did all the important work in a cell, while genes played minor roles. After: we know that proteins are the products of genes!
D
Which of the following RNA molecules serves as an adapter molecule during protein synthesis? A) All of the above B) rRNA C) mRNA D) tRNA
D
Which of the following could base pair with the sequence below? 5'-ACTGGGCATTACTC-3' A) 3'-CTCATTACGGGTCA-5' B) None of these sequences could base pair with the sequence above. C) 5'-CTCATTACGGGTCA-3' D) 5'-GAGTAATGCCCAGT-3' E) 3'-GAGTAATGCCCAGT-5'
D
Which of the following occurs during prometaphase of mitosis? A) Crossing over. B) The two sister chromatids separate. C) The chromosome align in a single plane. D) Microtubules attach to the kinetochores. E) DNA is replicated.
D
Which of the following statements is TRUE regarding transcription in most organisms? A) Different genes may be translated from different strands of DNA B) The strand encoding an mRNA is chosen randomly by RNA polymerase II C) The DNA contemplate strand is used to encode double-stranded RNA D) The DNA template strand is used as a template for mRNA synthesis E) All genes are transcribed from the same strand of DNA
D
Which of the following statements is correct concerning cytoplasmic inheritance? A) Depending on the specific gene, inheritance of a mutant allele from the paternal parent may produce a more severe phenotype. B) Females that inherit a mutant allele usually are more severely affected than males. C) They may be inherited from either parent. D) The same mutant allele may produce highly variable phenotypes.
D
Which of the following statements about how transposons violate basic laws of genetics is CORRECT. (You may choose more than one.) A) Some transposons have a single stranded RNA genome B) All transposons require RNA intermediates C) Transposons are post-transcriptionally stimulated by piRNAS D) Some transposons can create additional copies of themselves at new locations in the genome E) Some transposons can synthesize DNA from an RNA template
D & E
A mapping study was done with the E. coli genes cheA, cheB, eda, and supD using generalized transduction. The frequency of cotransduction was determined for pairs of genes as shown below. What is the MOST probable order for the four genes? Markers % Cotransduction cheA-eda 15 cheA-supD 5 cheB-eda 28 cheB-supD 2.7 eda-supD 0 A) cheA-supD-eda-cheB: B) supD-cheA-eda-cheB C) cheB-cheA-eda-supD D) cheA-eda-cheB-supD E) supD-cheA-cheB-eda
E
Huntington's disease can strike at an earlier age and bring about a more rapid degeneration and death in successive generations within a family. This phenomenon can be explained by which mechanism? A) absence of a gene product that is involved in DNA repair B) presence of a transposable element in the gene C) chronic exposure to mutagens in the environment D) presence of an extra chromosome in the germ line E) expansion of a trinucleotide repeat in the coding sequence of the gene
E
If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA polymerase), what would be the most likely outcome for the virus? A) The virus will be able to replicate its genome but unable to translate its structural proteins B) The virus will be able to transcribe its RNA but unable to translate its structural proteins C) The virus will be able to replicate its genome but unable to transcribe its RNA D) The virus will have to rely on the RNA polymerase of its eukaryotic host E) The virus will be unable to replicate F) The virus will be able to transcribe its RNA but unable to replicate its genome
E
In order to determine whether an individual with a dominant phenotype is homozygous or heterozygous, you would perform a(n) A) complementation test. B) phenocopy test. C) allelic series test. D) epistasis test. E) testcross.
E
The Drosophila staufen mutation (stau-) is inherited as a maternal effect recessive allele. Heterozygous males and females were crossed and homozygous (stau- / stau-) female offspring were isolated. These homozygous females were then crossed to heterozygous (stau+/ stau-) males. What would be the expected phenotypic ratio in the offspring of this cross? A) 1 normal : 1 mutant B) 3 normal : 1 mutant C) All normal D) 1 normal : 3 mutant E) All mutant
E
Which of the following contributed to Mendel's success in identifying genetic principles? A) Several of the traits that he chose to study happen to be located on the same chromosome. B) Each of the traits that he chose to study were represented by three or more alleles that could be grouped into allelic series. C) All of the other answers are correct. D) Pea plants produce low numbers of offspring. E) He quantitatively analyzed the results of crosses. Results for item 11.
E
Which of the following statements concerning use of bacteriophage in gene mapping is correct? A) Bacteriophage are useful for mapping the locations of bacterial chromosomal genes, but not for mapping the genes of the bacteriophage themselves. B) In order to map bacteriophage genes, they need to form prophages. C) The CRISPR-Cas system enables mapping of bacteriophage genes. D) Bacteriophage do not produce phenotypes that permit identification of bacteriophage with different alleles. E) It is possible to map the locations of bacteriophage genes due to recombination of DNA from two different bacteriophage inside a bacteria cell.
E
Which of the following statements concerning viruses is correct? A) Coronaviruses have a high mutation rate due to lack of proofreading during replication of their RNA genome. B) All of the other answers are correct. C) New human viruses evolve only within the human population and are not acquired from animals. D) Rhinoviruses form proviruses as part of their replication cycle. E) Reassortment of their RNA genome contributes to the evolution of new influenza viruses.
E
Which part of a eukaryotic mRNA encodes the 3' UTR? A) Intron B) Promoter C) Shine-Dalgarno sequence D) Enhancer E) Exon
E
Based on what we learned about the most important splicing consensus sequences, what is the sequence of the intron in this simplified intron-containing gene sequence? (Don't write anything besides nucleotide letters.) CAAGGUCCCUCCCACCUAGCAA
GUCCCUCCCACCUAG
Match each of the following with its function in replication of the E. coli chromosome. Single strand binding proteins
Prevent re-annealing of DNA strands
Match each of the following with its function in replication of the E. coli chromosome. DNA Ligase
Seals nicks by catalyzing formation of phosphodiester bonds
The following is part of an mRNA sequence, written from 5' to 3' (left to right): UAAAAA Write out the corresponding sequence of the non-template DNA (write it from 5' to 3', left to right). (Don't include anything besides the nucleotide letters, for example don't write 5', 3', etc.)
TAAAAA
Match each of the statements concerning DNA replication with the appropriate mode or modes. DNA synthesis is both continuous and discontinuous
Theta and linear eukaryotic but not rolling circle
Match each of the statements concerning DNA replication with the appropriate mode or modes. DNA synthesis requires synthesis of RNA primers
Theta and linear eukaryotic but not rolling circle
Match each of the statements concerning DNA replication with the appropriate mode or modes. DNA synthesis may be unidirectional or bidirectional
Theta replication only
Match each of the statements concerning DNA replication with the appropriate mode or modes. DNA synthesis begins with a 3' primer
all 3 modes of replication
