Bio101 Sapling hw #7,8,9,10,11

What conclusions can be drawn about the genetic code?

- Many amino acids are encoded by multiple codons. - There are three codons that specify the end of translation.

Features of Translation

- Produces a protein - Requires tRNA - Takes place in ribosomes

Features of Transcription

- Takes Place in the nucleus - Builds strands of mRNA

Harmful mutations

- a mutation causes alzheimer's disease in humans - a mutation induces chlorophyll deficiency in plants

Beneficial Mutations

- a mutation confers radiation resistance in yeast - a mutation leads to malarial resistance in humans

Neutral mutations

- a mutation produces curly-furred coats in cats - a mutation results in red hair color in humans

Description of pluripotent cells

- can become all cells in the body, but not extraembryonic cells - an example is embryonic stem cells

Description of totipotent cells

- can become all cells in the body, including extraembryonic cells - can develop into a new organism - an example is a zygote

Description of multipotent cells

- can only become different cell types within a tissue type - an example is adult stem cells

What are the functions of mitotic cell division?

- cell regeneration - asexual reproduction - growth of multicellular organisms

A cell with mutated DNA may not be able to produce proteins accurately. What can lead to mutations in the DNA?

- exposure to X-ray radiation - uncorrected DNA replication errors - chemicals in tobacco smoke

Germline mutations

- inherited by offspring - incorporated into all cells of an offspring - occurs in reproductive cells

Somatic mutations

- not inherited from a parent - found in a few body cells or tissues in an organism

Order the events that occur in one cycle of the polymerase chain reaction (PCR).

-The reaction mixture contains four copies of a particular DNA sequence -The reaction mixture is heated to 94 degrees C -The double-stranded DNA is denatured to form single stranded DNA -The temperature of the reaction mixture is lowered to allow the primers to anneal to the DNA template -The reaction mixture is heated to 72 degrees C -Taq polymerase synthesizes a new DNA strand - The reaction mixture contains eight copies of the DNA sequence

The following segment of DNA is unwound in preparation for transcription. 5' G T G C T G G T A 3' 3' C A C G A C C A T 5' <--- Template strand

5' G U G C U G G U A 3'

The study of biology can be understood through the organizational hierarchy of life. Each level of life builds upon the next level, and this increasing complexity is what leads from molecules up to an entire ecosystem. How is the cellular level different from the other levels of life?

A cell is a collection of molecules and reactions that form the basic unit of all living things

The study of biology can be understood through the organizational hierarchy of life. Each level of life builds upon the next level, and this increasing complexity is what leads from molecules up to an entire ecosystem. How is the tissue level different from the other levels of life?

A tissue is a group of similar cells that work together to perform a function.

M checkpoint

All chromatids are checked for proper attachment to spindle fibers

The study of biology can be understood through the organizational hierarchy of life. Each level of life builds upon the next level, and this increasing complexity is what leads from molecules up to an entire ecosystem. How is the organ level different from the other levels of life?

An organ is a collection of several tissues that interact to perform specific functions.

The study of biology can be understood through the organizational hierarchy of life. Each level of life builds upon the next level, and this increasing complexity is what leads from molecules up to an entire ecosystem. How is the system level different from the other levels of life?

An organ system is a group of multiple organs that work together to perform vital functions for the organism

Stem cell

An undifferentiated cell that can replicate itself indefinitely and differentiate into specialized cell types when appropriate.

Benign tumors are non-cancerous tumors. How are malignant tumors different from benign tumors?

Cells in a malignant tumor grow uncontrollably, invade and damage nearby tissues, and may metastasize.

What are the structures in a cell that group genes together, are composed of chromatin (DNA and protein), and become visible under a light microscope during mitosis?

Chromosomes

Nucleus

Contains DNA in the cell

Which enzyme pairs corresponding nucleotides to a preexisting DNA chain in order to synthesize a new strand of DNA?

DNA Polymerase

Which enzyme pairs corresponding nucleotides to a preexisting DNA chain in order to synthesize a new strand of DNA?

DNA polymerase

Recombinant DNA

DNA that is composed of a combination of DNA sequences from two or more organisms.

Which of the following cellular processes is a form of transcriptional control?

Differential mRNA expression with inducers

Why does radiation therapy increase the risk of cancer reoccurring?

Exposure to radiation can damage the DNA of normal cells, which can contribute to cancer.

G1, S, G2, M

G1: Cell prepares to replicate DNA S: DNA synthesized G2: Sister chromatids are present M: Mitosis occurs

Use the transcription interactive lab to help you answer this question. Suppose the \"Non-template strand\" at the bottom of the lab were instead used as the template strand for transcribing a new molecule of RNA. What would be the first six nucleotides of this RNA? 5' GAATGACACAGCGTTTAACACGGCTGAGC 3'

GCUCAG because when transcribing RNA its goes from 3' to 5'

Which enzyme separates the two complimentary strands of DNA during DNA replication?

Helicase

What intermolecular force is responsible for holding the two strands of a DNA double helix together?

Hydrogen Bond

How do the nucleus and ribosomes work together to generate a protein?

In the nucleus, an mRNA copy of a gene is produced, which ribosomes use as instructions to synthesize a specific protein.

Why does the UGA codon function as a stop codon.

It is a nonsense codon that does not code for an amino acid.

G2 checkpoint

Proper replication of all chromosomes is verified

Complete the transcription of the RNA sequence using the DNA template: ATCGAC

RNA Sequence: UAGCUG

Ribosome

Site of protein synthesis

How are DNA fragments separated using gel electrophoresis?

Smaller DNA fragments move through the gel more quickly than larger fragments move.

Some mutations do not affect the amino acid sequence of the protein produced using the mutated gene. How can the correct amino acid be incorporated into the protein despite a mutation in the gene sequence?

The amino acid specified by the mutated codon may be unchanged by the mutation.

During the cell cycle, the cell must pass through several checkpoints that confirm that the cell is ready to progress to the next phase of the cycle. If the requirements of one phase have not been met, the cell cannot proceed to the next phase. These checkpoints help control the rate of cell division. If a mutation disables one of these checkpoints, what is most likely to happen?

The cell begins dividing too often, forming a tumor.

G1 checkpoint

The cell determines whether resources are sufficient to proceed with the cell cycle

Dolly the sheep was the clone of an adult sheep. Identify how an adult animal is cloned.

The haploid nucleus of an egg cell is removed and replaced with the diploid nucleus of a donor cell.

Why are some stem cells referred to as totipotent?

Totipotent stem cells can differentiate into all cell types such that any daughter cell can become any type of cell in a multicellular organism.

The codon table identifies the amino acid sequence that can be translated from a human mRNA sequence. This chart can also be used to identify amino acid sequences for other organisms. Select the organisms that use the codon assignments shown in the codon table.

Turtles, Poison Ivy, Staphylococcus aureus, mouse, and a White shark

Stop codons:

UAG, UAA, UGA

When does a cell use apoptosis?

Unneeded cells or irreparably damaged cells are removed through apoptosis.

mRNA

a linear sequence of ribonucleotides transcribed from DNA that carries instructions for protein production

What is short tandem repeat (STR) analysis?

a procedure that compares the lengths of short, repeated DNA regions across samples

What is apoptosis?

a process in which cells direct their own destruction

Gene

a section of DNA in which the code for a protein is located

tRNA

carries an amino acid to ribosomes and binds to mRNA

Which of the following best describes the function of chromosomes?

compact DNA, facilitating proper distribution during cell division

During which phase of mitosis does the cytoplasm of a cell divide, fully separating the two daughter cells?

cytokinesis

The table below contains the DNA sequence for a segment of the human insulin gene and the same DNA sequence with a mutation. Original sequence: ATG CTG TAC CAG CAT CTG CTC CCT Mutated sequence: ATG CTG TAC CAG CTA TCT GCT CCC Which type of mutation occurred in the mutated DNA sequence, as compared to the original DNA sequence?

insertion

In general, what causes normal cells to become cancer cells?

loss of cell cycle control

During which phase of mitosis do chromosomes line up along the middle of a cell?

metaphase

Allele

one variation of the code for a protein

RNA Polymerase

protein complex that makes RNA polymers corresponding to a DNA template

Promoter

region of DNA that recruits the transcriptional machinery

What is the function of the mitotic spindle?

separating sister chromatids

During which phase of mitosis do nuclear membranes reform around the separated copies of DNA?

telophase

Which of the following describes a genome?

the collection of genetic material in a cell or organism

Cell division by mitosis is a mechanism of asexual cell replication. Some single-cell organisms reproduce by cell division, and cell division enables multicellular organisms to grow and to repair damaged cells. Which of the following are products of cell division by mitosis?v

two daughter cells with identical chromosomes

Which of the following describes the mechanism by which new alleles are formed?

Mutations can occur within existing genes, which brings about new allele variations.