Biology final exam review 2/3

In which of the four phases of the cell cycle do sister chromatids form?

S phase

Homologous chromosomes...

not from the same parent

Which of the following statements describes translation initiation in Eukaryotes:

Initiation factors, a tRNAmet, and the ribosome's small subunit bind to the 5'cap of mRNA.

Meiosis produces gametes with reduced ploidy so that

ploidy number is maintained between generations

During meiosis II:

sister chromatids are separated.

Energy is required in order to add a nucleotide to the growing strand of DNA during replication. From where does that energy come?

the incoming nucleotide

A sequence of DNA is shown below. Assume it is in the middle of the gene, so no start codon present. The promoter is to the left as shown below (the arrow). A codon table is also provided. 5' CCG GGA TAA GTT 3' ---->>>> 3' GGC CCT ATT CAA 5' What is the correct sequence of the mRNA transcribed using this DNA? 5' CCG GGA UAA GUU 3' What is the correct sequence of the polypeptide from this mRNA. Pro-Gly

Answer 1:5' CCG GGA UAA GUU 3' Answer 2:Pro-Gly

Why is DNA ligase important for a cell? Select all that apply.

1. It joins DNA together from different origins of replication. 2. It joins Okazaki fragments on the discontinuous lagging strand.

Which of the options correctly match the type of cell division with the cellular events or results characteristic of that type of cell division? Select all that apply.

1. Meiosis produces genetically unique daughter cells. 2. Mitosis produces genetically identical daughter cells. 3. In meiosis, the original cell undergoes two rounds of cell division.

The following statements list events that occur during translation, from initiation through termination. Arrange the order of events that occur during translation by numbering them 1 (the first event) to 6 (the last event to occur). Note, not all the events are listed. Each answer should be a number, e.g. "1", "2", etc.

1. The first aminoacyl tRNA (holding Met) complementary base pairs to the start codon AUG 2. The large ribosomal subunit binds to the small ribosomal subunit 3. A new aminoacyl tRNA binds to the codon in the A site 4. A peptide bond is formed between the new amino acid at the A site to the polypeptide at the P site 5. A stop codon enters the A site 6. A release factor enters the A site

Indicate all of the phrases that accurately describe what happens in eukaryotes when a ribosome encounters a stop codon. (3 correct answers)

1. The protein is released from the tRNA. 2. A release factor binds to the A site 3. The ribosomal small subunit and ribosomal large subunit separate from the mRNA.

Examine the figure below. What will happen when the ribosome shifts one codon further on the mRNA, assuming the next codon is not a stop codon? Select all that apply.

1. The tRNA that is no longer carrying the polypeptide will be ejected from the ribosome. 2. The tRNA carrying the polypeptide will be in the P site. 3. A new tRNA will bind to the ribosome.

Some poisonous plants harm people and animals because they produce compounds that are structurally similar to amino acids. Possible reasons why these compounds are toxic include that they _______________ Select all correct phrases.

1. are recognized by amino acyl tRNA synthetases, and are linked to a tRNA molecule. 2. impair the function of proteins. 3. change the final folded shape of the protein.

Select all that apply. Why does meiosis result in more genetic variation than can be explained by mutation alone?

1. because of random fertilization. 2. because of crossing over between homologs during prophase I 3. because of the random alignment of maternal and paternal homologs during metaphase of meiosis I

1. Mendel's Law of Independent Assortment 2. In the picture below, what assorts independently from each other? 3. If the cell in the picture below undergoes S phase and then Meiosis, what are the possible gamete types?

1. refers to the random orientation of different homologous pairs (nonhomologs) at the metaphase I plate 2. Gene A is independent from gene B. 3. Gametes: AB, ab, Ab, aB

Below is a drawing of two cells. On the left is supposed to be a G1 cell and on the right is supposed to be the same cell in G2. There may be errors in the drawing. Select the choices that correctly identify the errors in this drawing. More than one choice can be made.

1. the cell on the left is 2n=4, the cell on the right is 1n=2, but they should be the same 2. ploidy should not change between G1 and G2

Use the figure below of RNA processing to answer the following questions. What is missing from the figure above for it to be a mature mRNA? PICK ALL that are correct.

5' cap 3' poly A tail

A template DNA strand contains the sequence 5'-ATGCTGAC-3'. The corresponding sequence in the RNA transcript is:____.

5'-GUCAGCAU-3' Remember: RNA has U instead of T. Base paired strands are antiparallel. New nucleotides are made in the 5' to 3' direction. When we write out a nucleotide sequence in text (like these answers), the 5' end is almost always on on the left.

Below is an image of translation occurring, use it to answer the following questions. (bubble mrna in bubble 123 <--------------------) A. If the ribosome is moving from right to left, as indicated by the arrow, what is the polarity of the mRNA? The left side of the mRNA (where the ribosome is moving towards) is the B. On the ribosome, which site is where the tRNA is ejected? C. The new aminoacyl tRNA is entering at which site? D. On which RNA do we find the anti-codon?

Answer 1:3' Answer 2:3 Answer 3:1 Answer 4:tRNA

Genes A and D are independent. Two individuals with the genotypes AaDd x aaDd are crossed. 1. What is the probability of those two individuals having an offspring with the phenotype aD? 2. What is the probability of those two individuals having an offspring with the genotype AaDD? 3. What is the probability of those two individuals having a male offspring with the phenotype Ad?

Answer 1:3/8 Answer 2:none of these answers are correct Answer 3:1/16

Match each of these cellular processes with the phase of meiosis in which it occurs. Each cellular process may be used once, multiple times, or not at all. 1. sister chromatids are separated 2. the cytoplasm of the daughter cells are separated 3. homologous chromosomes line up in the middle 4. the DNA is replicated 5. chromosomes line up single file in the middle

Answer 1:Anaphase II Answer 2:Cytokinesis Answer 3:Metaphase I Answer 4:S phase Answer 5:

1. A replication fork is shown below. The primary enzyme that catalyzes replication is 2. . That enzyme also 3. The leading strand would be 4. Helicase is a(n) 5. In this picture, helicase would be moving in the (fork up left side together right 3' top left)

Answer 1:DNA polymerase Answer 2:all of these answers are correct Answer 3:top strand Answer 4:all of these are correct Answer 5:left to right

Which statement about RNA is correct?

RNA uses the same purine bases as DNA.

Which one of the choices is capable of phosphorylating key proteins involved in regulating the cell cycle?

cyclin-CDK complex

The amount of _____ is fairly constant throughout the cell cycle, but the amount of _____ varies.

cyclin-dependent kinases (CDK); cyclins

Examine the figure shown, which depicts one stage in the process of translation in a eukaryote. Where will the tRNA be when the large subunit of the ribosome joins the complex?

in the P site of the ribosome

Carefully examine the figure below. (This is the best one to practice drawing, labeling and describing out loud) What happens next? (hint: if you are having a hard time deciding between A and P sites look at the picture in the previous question)

A polypeptide bond is formed between the arginine and the valine, transferring the polypeptide to the A site.

How does termination of translation take place?

A stop codon is reached.

A researcher is studying phases of the cell cycle in a population of cells during which there is an increase in the DNA content. This stage is most likely:

S phase.

If you made a big deletion of DNA that removes the promoter sequence of a gene, which of the following is likely to happen?

The gene would not be transcribed

What cellular process(es) is/are responsible for the increase in protein content associated with the gap (G1 and G2) phases of the cell cycle?

both transcription and translation

According to the principle of segregation, a heterozygous plant with alleles Aa will produce:

gametes in the ratio of 1 A allele:1 a allele (1:1).

Put the following DNA replication events in the correct order:

1. The initiator protein binds the origin. 2. Helicase unwinds the DNA. 3. Primase synthesizes an RNA primer. 4. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction. 5. DNA exonuclease removes mispaired nucleotides in the newly replicated strand. 6. Ligase seals up the nicks in the lagging strands.

This image below represent just one DNA template in replication. the letters A-E represent possible placement of primers. Which of these represent the correct order of primer placement? 5'---A-B-C(orgin)-D-E--->3'

1st C, 2nd D, 3rd E (leading is to left of origin)

Match the images below to the stage of mitosis.

A Anaphase B Telophase/cytokinesis C Prometaphase (late prophase) D Metaphase

If you crossed two heterozygous yellow-seed pea plants (genotypes Aa), the relative frequency of:

All of these choices are correct.

What is the correct sequence of the mRNA transcribed using this DNA? 5' GGC UUC CAA GGA 3' What is the correct sequence of the polypeptide from this mRNA. Gly-Phe-Gln-Gly

Answer 1:5' GGC UUC CAA GGA 3' Answer 2:Gly-Phe-Gln-Gly

1. A is dominant over a and B is dominant over b. Genes A/a and B/b assort independently. The parental cross (P) is between true- breeding (homozygous) strains (AA bb x aa BB). The resulting F1 offspring would be 2. A F1 x F1 cross gives the F2 generation. The ratio of phenotypes in the F2 generation can be described as 3. In the phenotypic ratio, what number refers to individuals that are: dominant for both traits? 9 recessive for both traits? 4. To what phenotypes do the "3"s in the ratio refer?

Answer 1:Aa Bb Answer 2:9:3:3:1 Answer 3:9 Answer 4:1 Answer 5:dominant for one trait and recessive for the other

Apply this knowledge and determine which areas will have new DNA made as leading strands. (replication bubble 3' top left top- A and B bottom- C and D)

B and C

Consider a ribosome that is actively engaged in translation. As the ribosome moves along the mRNA, the protein grows at the ________ end by addition of the amino acid that is bound to the tRNA at the _______ site.

C-terminus, A site

Assuming that transcription and translation both proceed from left to right, which is the correct orientation of the DNA template, the RNA transcript, and the protein product?

DNA template 3'- ......... -5' / RNA transcript 5'- ......... -3' / Protein product H2N- ......... -COOH

A mutation in _____ results in a change in _____ that sometimes produces a(n) _____ with altered structure and function.

DNA; RNA; protein

In a normal non-genetically modified organism, how can different proteins be expressed in different tissues??

Different cells have different transcription factors.

A student is examining an onion root tip cell under a microscope. Based on her observations, the student proposes that the onion root tip cell has completed interphase and is now in the first phase of mitosis. Which of the following pieces of evidence would best support the student's claim?

Discrete chromosomes are scattered throughout the cell's nucleus. Spindles are forming.

If you analyze the sequences of the two copies of any of the chromosomes shown in the karyotype, there would be slight sequence differences. What could account for the small differences between a few of the homologous chromosomes?

Each homologous chromosome in a pair is from a different parent.

If the RNA transcript 5'-AUGAUCGGAUCGAUCCAU-3' is present and translated codon by codon from one end to the other, which of the following polypeptides would correspond to this part of the mRNA? Use the table shown to answer this question.

NH2- Met-Ile-Gly-Ser-Ile-His -COOH

In transcription, the dehydration synthesis reaction is catalyzed by which enzyme?

RNA polymerase

Which example correctly lists the components necessary for eukaryotic transcription?

RNA polymerase, general transcription factors, DNA, and RNA nucleotides

If you made a big deletion of DNA in the promoter sequence of a gene, which of the following is likely to happen?

The gene would not be transcribed

Promoters of many genes have regions that are rich in adenines and thymines. What is the most likely reason for this?

This is the region where template and nontemplate strands separate, and A-T base pairs require less energy to separate than G-C base pairs.

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The arrowheads (>) represent the 3' ends. The promoter sequence is off the page to the RIGHT. -----> Promoter <------ Which strand is the template strand?

Top strand

Consider the stages of mitosis, depicted in the image below. In what order do the stages of mitosis occur?

V>II>IV>I>III prophase > prometaphase > metaphase > anaphase > telophase

Homologous chromosomes separate from each other in:

meiosis I.

Which of these is NOT true? In humans, if two sperm fertilize one egg (dispermy) then the zygote will

split into identical triplets

All of the following happen during mitosis except:

synthesis of DNA.

Which of these events includes a checkpoint in the cell cycle?

the transition from G1 to S phase There are three checkpoints in the cell cycle: the transition from G1 to S phase, the transition from G2 to M phase, and the transition from meta-phase to anaphase during M phase.

Rank the following events in order of occurrence in Meiosis

1. 2n cell completes G1, S, and G2 2. Homologous chromosomes synapse (pair) and crossover occurs 3. Homologous pairs align in the middle of the cell 4. Homologous chromosomes separate to opposite poles and cells divide 5. Sister chromatids separate 6. Gametes contain a single set of chromosomes

Select all that apply. Suppose that in humans the ability to roll the tongue (R) is dominant to being unable to roll it (r). Having freckles (F) is dominant to having no freckles (f). A freckled tongue-roller could have which genotypes?

1. RrFf 2. RRFF

Choose all that apply. Which of the following is true in a comparison of your skin cells to your kidney cells?

1. transcribe many different genes 2. have different transcription factors

Use the image below, to identify the best answer for each of the following. 1. The position that distinguishes between DNA and RNA is 2. The carbon that the phosphate group is attached to is 3. and the carbon that the base is attached to is 4. The next nucleotide in a growing strand would be attached to (pentagon branching off top left (f) a top middle counting clockwise)

Answer 1:c Answer 2:f Answer 3:b Answer 4:d

Mitosis generates dploid body cells while meiosis generates haploid gametes .

Answer 1:dploid body cells Answer 2:haploid gametes

Pick the best term for each definition or example 1. aabb or AaBb or aaBB. 2. The appearance of an individual. 3. Versions of a gene that may differ by as little as a single nucleotide.

Answer 1:genotypes Answer 2:phenotype Answer 3:alleles

1. In the figure below A represents 2. and B represents (2 identical chromosomes one blue and one red) (A is both B is 1 chromosome)

Answer 1:a pair of homologous chromosome (one from each parent) Answer 2:identical DNA molecules that are the product of S phase

A skin cell in G2 of interphase has _____ as much DNA as it had in G1.

twice

1. Recall that alleles of a single gene will segregate from one another during 2. This is the basis for Mendel's 3. When do alleles for two different genes—located in two different chromosomes—segregate?

Answer 1:anaphase I of meiosis Answer 2:First Law: the Law of Segregation Answer 3:anaphase I of meiosis

Sister chromatids form during

S phase of interphase

Homologs synapse (pair) only during _______

prophase I of meiosis

In the F2 generation of a homozygous yellow-seed (AA) X homozygous green-seed (aa) cross in peas, two peas are chosen at random. What is the probability that one is homozygous yellow (AA) and the other is homozygous green (aa)?

(1/4) x (1/4) = (1/16)

Which of these statements is true?

An exon is considered a "coding sequence" of DNA, and its information is retained in the processed mRNA within a cell.

If you made a big deletion of DNA in the promoter sequence of a gene, which of the following is likely to happen?

Transcription factors will not bind the DNA, thus mRNA will not be produced

Which of the following provides the 3' end (hydroxyl) that is needed to get DNA replication started?

RNA primer

Which choices accurately match each of the cellular processes to the stage of meiosis in which it occurs? Select all that apply. (5/9 of these are correct)

1. Chromosomes condense to thickened structures that are visible under the microscope in prophase I. 2. Microtubules attach to kinetochores at the centromere of each homolog in prometaphase I. 3. Sister chromatids move toward opposite poles of the cell in anaphase II. 4. Microtubules pull homologous chromosomes toward opposite poles in anaphase I. 5. The nuclear envelope begins to disappear in prophase I.

In humans , a widows peak hairline (H) is dominant to a straight hairline (h). Having freckles (F) is dominant to having no freckles (f). These traits assort independently. A person with a widows peak and freckles could have which of the following genotypes? (select all that apply)

1. HHFF 2. HhFf

Why does meiosis result in more genetic variation than can be explained by mutation alone? Select all that apply.

1. because of crossing over between homologs during prophase I 2. because of the random alignment of maternal and paternal homologs during metaphase of meiosis I

Select all that are true of a cell that is 2n = 10

1. it has 10 chromosomes 2. it has homologous pairs 3. it is diploid

Which stages of mitosis are correctly matched with the events that occur in the stage? Select all that apply.

1. metaphase; chromosomes line up in the middle of the cell 2. cytokinesis; a contractile ring of actin filaments forms at the cell equator

Suppose that in humans the ability to roll the tongue (R) is dominant to being unable to roll it (r), and having freckles (F) is dominant to having no freckles (f). If a woman heterozygous for both traits married a man with no freckles who couldn't roll his tongue, what is the probability that they would have a freckled, tongue-rolling child?

1/4

The FoxP2 gene is thought to be involved in language in humans. At prophase I, how many copies of the FoxP2 gene are present in a cell? Keep in mind that humans are diploid.

4 copies; 1 on each sister chromatid in a pair of homologous chromosomes

What anticodon in tRNAMet would pair with the codon 5'-AUG-3'?

5'-CAU-3'

The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. 5' CGAGCAUGCAAUCUAAUUAAUC 3'

5'CAU3' ; 5'UUG3' ; 5'AGA3'

Remember: 1) New nucleic acids are made 5' to 3'. 2) Base paired strands are antiparallel. Apply this knowledge and determine which areas on this replication bubble will have new DNA made as leading strands. (hint: Start with primers at the origin on the top and the bottom of the replication bubble.) (replication bubble 5' top left top- A and B bottom- C and D)

A and D

Genes A and D are independent. Two individuals with the genotypes AaDd x aaDd are crossed. 1. What is the probability of those two individuals having an offspring with the phenotype aD? 2. What is the probability of those two individuals having an offspring with the genotype AaDD? 3. What is the probability of those two individuals having a male offspring with the phenotype Ad?

Answer 1:3/8 Answer 2:none of these answers are correct Answer 3:1/16

A sequence of DNA is shown below. Assume it is in the middle of the gene, so no start codon present. The promoter is to the left as shown below (the arrow). A codon table is also provided. 5' GGC TTC CAA GGA 3' promoter --> 3' CCG AAG GTT CCT 5' What is the correct sequence of the mRNA transcribed using this DNA? 5' GGC UUC CAA GGA 3' What is the correct sequence of the polypeptide from this mRNA. Gly-Phe-Gln-Gly

Answer 1:5' GGC UUC CAA GGA 3' Answer 2:Gly-Phe-Gln-Gly

The cells shown above are NOT necessarily from the same organism. Assume that these organisms all have diploid body cells (somatic) and haploid gametes. For each diagram, the metaphase plate is vertical (shown as dashed line) and spindles are not shown. . Please identify the ploidy and stage of cell cycle for each. 1. In cell a. the chromosomes are different sizes 2. In cell b. the chromosomes are the same size. This is 3. In cell c. the chromosomes are the same size. This is

Answer 1:haploid (1n=2), metaphase of Meiosis II Answer 2:diploid (2n=2), metaphase of Meiosis I Answer 3:diploid (2n=2), metaphase of Mitosis

The correct sequence of steps in the eukaryotic cell cycle is:

G1→ S phase → G2→ mitosis → cytokinesis.

Which of the following statements are true? (choose all that apply)

Some amino acids are specified by just one codon, whereas others are specified by multiple codons.

At the end of what stage of mitosis has the amount of DNA per nucleus decreased?

Telophase

If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level?

The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made.

A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group of cells, high levels of phosphorylated p53 occur in the nuclei. What can she deduce about these cells?

These cells likely contain damaged DNA.

Sexual reproduction increases the genetic variability of a population more than does asexual reproduction because of

crossing over

Energy is required in order to add a nucleotide to the growing strand of mRNA during transcription. From where does that energy come?

nucleotide triphosphate

During DNA replication, a mistake occurred causing the third nucleotide of the corresponding codon (5'ACU3') to be deleted. This codon exists in the middle of the coding region of a gene. What effect would this new mutation have on the amino acid sequence of the polypeptide ?

very different polypeptide after this change (frameshift)

Put the statements relating to DNA replication and the cell cycle in the correct order.

1. Initiator protein binds the origin 2. Primase synthesizes an RNA primer 3. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction 4. Ligase catalyzes covalent bond formation between Okazaki fragments 5. The cell enters the G2 phase

Remember: 1) New nucleic acids are made 5' to 3'. 2) Base paired strands are antiparallel. Apply this knowledge and determine which areas on this replication fork will have new DNA made as leading strands. (hint: Start with primers at the ends of the open fork on the top and the bottom.) (together on left split on right, 5' top strand right left A on top B on bottom)

A

A student was studying cell growth using cells grown in laboratory cultures. The cultures were synchronized so that all of the cells passed through the same stage of the cell cycle at the same time. The cells were examined during five different periods of time, intervals (A-E). The amount of DNA present per cell was determined for each interval. The graph below shows the result of this study. 1. Most of the cells examined during interval A have half as much DNA as those measured in interval C. Therefore, most of the cells at interval B must have been in: 2. b. Most of the cells examined during interval D were in:M phase. 3. c. Most of the cells examined during interval C were in

Answer 1:S phase. Answer 2:M phase. specifically telophase of Mitosis Answer 3:G2 phase.

1. In fruit flies, brown body color (B) is dominant to black body color (b). You have an individual fruit fly with a brown body, but you do not know their genotype. To determine the genotype of the brown body fruit fly, you do a test cross. This means you cross the brown body fruit fly with 2. Before the test cross, you know that the brown body fruit fly has the genotype 3. If all fly offsprings are brown bodied this shows you 4. If only half the fly offsprings are brown bodied result shows you

Answer 1:a black body fruit fly Answer 2:BB or Bb Answer 3:the brown body fruit fly is homozygous dominant Answer 4:the brown body fruit fly is heterozygous

1. Mendel crossed true-breeding yellow-seed plants with true-breeding green-seed plants. The yellow color is a dominant trait. True-breeding means 2. What would the genotype of the offspring be? 3. What would the phenotype of the offspring be?

Answer 1:homozygous Answer 2:heterozygous for yellow and green alleles Answer 3:yellow-seed plants.

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The promoter sequence is off the page to the RIGHT. 3' . . .GGCTAAGCGTCACCACA. . .5' (Top strand) -----------------------------------Promoter 5' . . .CCGATTCGCAGTGGTGT. . .3' (Bottom strand)

Answer 1:top Answer 2:transcription factors

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The promoter sequence is off the page to the RIGHT. 5' . . .GGCTAAGCGTCACCACA. . .3' (Top strand) Promoter 3' . . .CCGATTCGCAGTGGTGT. . .5' (Bottom strand) Which DNA strand is the template strand? top In addition to RNA polymerase, what else is bound to the promoter sequence that helps control gene expression? transcription factors

Answer 1:top Answer 2:transcription factors

The Central Dogma states that DNA is ____ into RNA, which is _____ into a chain of______which folds into a protein.

Answer 1:transcribed Answer 2:translated Answer 3:amino acids

Protein polarity is described as having an N-terminus and a C-terminus. Consider a ribosome that is actively engaged in translation. As the ribosome moves along the mRNA, the protein grows at the ________ terminal end by addition of the amino acid that is bound to the tRNA at the _______ site.

C-terminus, A site

In translation, the dehydration synthesis reaction is catalyzed by which enzyme?

Ribosome

In order to test the effects of a new drug, you isolate the messenger RNA molecules from both treated and untreated eukaryotic cells and separate them according to size, using gel electrophoresis. In each lane of the gel, the shorter RNA molecules migrate more quickly through the gel and end up near the bottom of the gel, whereas the longer RNAs migrate more slowly and remain near the top.

These results suggest that the drug affects RNA processing.

A true-breeding black rabbit is crossed with a true-breeding white rabbit to produce an F1 generation of 16 individuals. If the black color trait is dominant, which of the outcomes represents the expected phenotype of an F1 generation cross?

all black rabbits