Genetics Test 2

Which region of DNA contains the coding information for a protein in a eukaryote? A) Exons B) Introns C) Enhancers D) Promoters

A) Exons

The experimental process of determining the relative location of genes or other segments of DNA along individual chromosomes is called __________. A)mapping B)metagenomics C)DNA sequencing D)proteomics

A) Mapping

Before the discovery of PCR, it was very difficult to isolate single genes. A) TRUE B) FALSE

A) TRUE

Pseudo exons are sequences that used to be introns but have changed by mutation. A) TRUE B) FALSE

A) TRUE

This pre-mRNA contains 8 exons and 7 introns. A mutation that happens in intron 2 can have an effect on the sequence of the resulting protein A) TRUE B) FALSE

A) TRUE Despite not being in the coding sequence, a mutation in the intron could change the its sequence and make it look like an exon to the splicing machinery and hence be included in the mature mRNA.

Mutations in the 5' UTR can: A) control transcript levels B) Affect mRNA translation rates through the creation of DNA binding elements C) RNA-based cis-regulatory motifs. D) All of the above E) None of the above

A) control transcript levels B) Affect mRNA translation rates through the creation of DNA binding elements C) RNA-based cis-regulatory motifs. D) All of the above

This pre-mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 4 are not readily recognized by the splicesome. In addition, a splicing repressor prevents the recognition of the 3' splice site in exon 7. What exons will be present in the mature mRNA? A)1, 2, 3, 5, 6, 8 B)1, 2, 3, 4, 5, 6, 7, 8 C)1, 2, 3, 4, 5, 6, 8 D)1, 2, 3, 5, 6, 7, 8 E)1, 2, 3, 5, 6

A)1, 2, 3, 5, 6, 8 If all exons were included, the mature mRNA would contain exons 1, 2, 3, 4, 5, 6, 7, 8. However, because the splice sites surrounding exon 4 are not well recognized by the splicesome, it is not included. Similarly, a repressor binding to the 3' splice site of exon 7 will block its inclusion. Therefore, the final mature mRNA will contain exons 1, 2, 3, 5, 6, 8.

An acceptable E-value for a nucleotide sequence alignment is A. 10^-6 B. 1.00 C. 0.01 D. 3.841 E. 0.05

A. 10^-6 The Expect value (E) is a parameter that describes the number of hits one can "expect" to see by chance when searching a database of a particular size. It decreases exponentially as the Score (S) of the match increases. Essentially, the E value describes the random background noise. For example, an E value of 1 assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see 1 match with a similar score simply by chance. The lower the E-value, or the closer it is to zero, the more "significant" the match is. However, keep in mind that virtually identical short alignments have relatively high E values. This is because the calculation of the E value takes into account the length of the query sequence. These high E values make sense because shorter sequences have a higher probability of occurring in the database purely by chance. For more details please see the calculations in the BLAST Course. The Expect value can also be used as a convenient way to create a significance threshold for reporting results. You can change the Expect value threshold on most BLAST search pages. When the Expect value is increased from the default value of 10, a larger list with more low-scoring hits can be reported.

The steps on the right take place to sequence DNA using dideoxy chain termination. What is the correct order? Steps to sort: 1. primer annealing 2. laser detection 3. electrophoretic separation 4. termination 5. denaturation 6. extension (elongation) 7. DNA purification A. 7, 5, 1, 6, 4, 3, 2 B. 5, 2, 1, 4, 6, 3, 7 C. 5, 2, 1, 4, 6, 3, 7 D. 7, 1, 2, 3, 4, 6, 5 E. 7, 1, 5, 6, 4, 2, 3

A. 7, 5, 1, 6, 4, 3, 2

A gene codes for an 859 amino acid protein. One (1) in-frame insertion of three bases and three (3) in-frame deletions of nine (9) bases has occurred. How many codons would exist in the mRNA molecule of the mutated gene? 2577 A. 858 B. 859 C. 861 D. 2751 E. 2752

A. 858 If the original protein has 859 amino acids and one stop codon, then that's 860 codons. Now, have one insertion or 3 bases (1 codon), it becomes 861, but then the deletion of 9 bases (3 codons) that's 858.

BLAST stands for_________ A. Basic Local Alignment Search Tool B. Bioinformatics Log Alignment Sequence Tool C. Biological Lookup Alignment Sequence Transfer D. Biochemical Local Arrangement Sequence Test E. Biometric Logical Assignment Sequencing Test

A. Basic Local Alignment Search Tool

Below is the alignment between a mutant gene sequence against the wild type genome of an unspecified organism. What can be concluded? (Query is the mutant) A. The mutant gene has a 3 base deletion and a point mutation. B. The mutant gene has a 3 base insertion and a point mutation. C. The mutant gene is nonfunctional. D. The mutant gene has a 3 base insertion. E. The mutant gene has a point mutation.

A. The mutant gene has a 3 base deletion and a point mutation.

DNAse is an enzyme that catalyzes the hydrolysis of the covalent bonds that join nucleotides together. What would first happen to DNA molecules treated with DNAase? A. The phosphodiester bonds between deoxyribose sugars would be broken. B. The two strands of the double helix would separate. C. All bases would be separated from the deoxyribose sugars. D. The pyrimidines would be separated from the deoxyribose sugars. E. The purines would be separated from the deoxyribose sugars.

A. The phosphodiester bonds between deoxyribose sugars would be broken.

You have purified a novel protein from Drosophila virilis and obtained the partial amino sequence: PLEASEHELPMEASAP. To find the gene DNA sequence through NCBI BLAST, which of the following search programs should you use? A. tblastn B. blastp C. blastn D. tblastx E. blastx

A. tblastn

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' A)7 B)8 C)10 D)13

B) 8 Once the start codon (AUG) is identified, then the adjacent codons can be determined and translated using the genetic code until an in-framestop codon (UGA in this particular mRNA)is reached.

CpG islands are associated with which of the following? A)Nucleosome location B)DNA methylation C)Steroid hormone activity D)cAMP pathway

B) DNA Methylation

If the gene was successfully transcribed, it's a guarantee that it will be translated A) TRUE B) FALSE

B) FALSE

The phenomenon in which a particular type of disease or trait may be caused by mutations in two or more different genes is called multiple gene action. A) TRUE B) FALSE

B) FALSE It is called Locus heterogeneity

Heterozygosity and heterogeneity are synonyms and describe the state of an individual that has both the dominant and the recessive alleles. A) TRUE B) FALSE

B) FALSE Locus heterogeneity refers to the phenomenon that a disease can be caused by mutations in two of more different genes.

Single Nucleotide Polymorphisms (SNPs) alterations in the non-coding DNA sequences can lead to some types of cancer. A) TRUE B) FALSE

B) FALSE read the abstract of the following paper Lim, Y., Arora, S., Schuster, S.L. et al. Multiplexed functional genomic analysis of 5' untranslated region mutations across the spectrum of prostate cancer. Nat Commun 12, 4217 (2021). https://doi.org/10.1038/s41467-021-24445-6

Mutations that happen in the Untranslated regions (UTRs) could affect the phenotype A) FALSE, it does not affect the phenotype because that region not translated. B) TRUE

B) TRUE

Amino acids from a hypothetical protease from Homo sapiens are compared to the same protease in other species using the BLAST program. The following results are obtained. The sequence from which species has the highest E value? H. sapiens SSTNQLLKHRRAALSTMVIITNQKRSAA P. catodon SSTNQLLKHRSAALSTMVIITNQKRSAA M. mulatta SSTNQIIKHRRAALSTMVLLTNQKRSAK F. cattus ASTNQLLKHRSAALSTMVIITNQKRSAK C. cristata SSTNQLLKHRRAALSTMVIITNQKRSAA A)P. catodon B)M. mulatta C)F. cattus D)C. cristata

B)M. mulatta A very small E value occurs when sequences are very similar and are likely to have derived from the same ancestral sequence. A large E value occurs when there are many differences between sequences. In comparing each of these sequences to the human sequence, we see the following number of differences: P. catodon: 1difference M. mulatta: 5differences F. cattus:3 differences C. cristata: 0differences Therefore M. mulattahas the highest E value.

When a scientist is attempting to use haplotype analysis to link a disease-causing allele to a molecular marker, it is important for the marker to be close to the disease-causing allele, otherwise __________ may occur. A)additional mutation B)crossing over C)linkage disequilibrium D)founder effect

B)crossing over

Haplotype mapping would be least useful in the study of __________. A)dizygotic twins B)monozygotic twins C)brothers and sisters D)grandparents and grandchildren

B)monozygotic twins Since haplotype mapping is the mapping of genetic differences between individuals and monozygotic twins should be nearly identical if not identical, it would be of least use in these individuals.

Genome wide association studies are used __________. A)to identify the mutation that causes a disease B)to identify single nucleotide polymorphisms that are near disease causing genes C)to find the total variation that occurs in human genomes D)to describe the number of alleles for a specific gene

B)to identify single nucleotide polymorphisms that are near disease causing genes

Which of the following is a start codon found in a FASTA file? A. UAA B. ATG C. UAG D. ATU E. AAU

B. ATG

In general, why are the BLAST cutoff E-values for DNA alignments lower than for protein alignments? A. The length of chromosomes is far greater than the length of proteins. B. DNA is made of 4 different nucleotides, proteins can be made of 20 different amino acids. C. All organisms contain the same content of DNA, but they differ in protein content. D. DNA sequence alignments require more computing time than protein sequence alignments. E. The DNA sequence database is much larger than the protein sequence database.

B. DNA is made of 4 different nucleotides, proteins can be made of 20 different amino acids.

Several sequences from different species that align to one another may be A. Paralogous B. Homologous C. Analogous D. Orthologous E. None of the above

B. Homologous Two genes that align together are homologs, which means have some sequence similarity, but we didn't say anything about their function here, because they could have some similarity but could have different functions. But when that similarity is very high AND these two genes catalyze the same reaction, they are called orthologs.

A protocol requires the addition of 12.6 µl of a solution. Which micropipette should be used for this? A. P10 B. P20 C. P200 D. P2 E. P1000

B. P20

Which of the following attributes of a DNA molecule is crucial to its accurate duplication? A. Phosphate groups B. Specific base pairing C. Phosphodiester linkages D. Helical structure E. Base composition

B. Specific base pairing

One of the characteristics of retrotransposons is that A. they contribute a significant portion of the genetic variability seen within a population of gametes. B. they code for an enzyme that synthesizes DNA using an RNA template. C. their amplification is dependent on a retrovirus. D. they generally move by a cut-and-paste mechanism. E. they are found only in animal cells.

B. they code for an enzyme that synthesizes DNA using an RNA template.

Genomic imprinting is a result of ___________. A)nucleosome location B)histone activation C)DNA methylation D)serine to leucine changes in the genetic code

C) DNA Methylation

Which RNA encodes the sequence of amino acids for a functional protein? A)tRNA B)snRNA C)mRNA D)rRNA E)scRNA

C) mRNA

A SNP would best be described as __________. A)a gene that comes in multiple different alleles B)a balanced polymorphism system C)a single nucleotide difference between two DNA sequences D)the most likely mutation to affect protein function

C)a single nucleotide difference between two DNA sequences

If mutations in two different genes give rise to a single disease then the disease exhibits __________. A)multiallelic variation B)locus dimorphism C)locus heterogeneity D)an inheritance pattern that looks as though it is autosomal dominant

C)locus heterogeneity

How many codons would exist in a mRNA molecule coding for a protein 1,251 amino acids long? A. 1250 B. 1251 C. 1252 D. 418 E. 3753

C. 1252 Since it has 1251 codons for amino acids and one stop codon.

Below is a DNA sequencing chromatogram (in black and white) representing a short stretch of sequence using the Sanger method. What is the reverse complement of this sequence? A. 5'GCAAAGTCCAGCTGGCTC3' C. 5'CTCGGTCGACCTGAAACG3' D. 5'CGTTTCAGGTCGACCGAG3' E. 3'CGTTTCAGGTCGACCGAG5'

C. 5'CTCGGTCGACCTGAAACG3'

Which of the following is unique to DNA sequencing reactions and not present in PCRs? A. a specific primer(s) B. DNA polymerase C. dideoxynucleoside triphosphates D. deoxynucleoside triphosphates E. a DNA template

C. dideoxynucleoside triphosphates

A limitation to the polymerase chain reaction is that it A. can only amplify eukaryotic DNA. B. can only amplify DNA sequences less than 1,000 bp in length. C. requires partial knowledge of a target DNA sequence to be amplified. D. cannot be used to generate DNA for cloning purposes E. requires highly purified DNA as a template.

C. requires partial knowledge of a target DNA sequence to be amplified.

PCR primers are short segments of deoxyribonucleotides. What functions as natural primers during DNA replication in eukaryotic cells? A. telomeric sequences B. sequences near the origin of replication. C. short segments of ribonucleotides D. inverted regions of introns E. specific tRNA molecules

C. short segments of ribonucleotides

Genomic DNA was isolated from wild type flies and from flies with a mutation in single gene. PCR with identical conditions and forward and reverse primers that flanked the same region in the genome were used. Below is a gel analyzing the results: lane 1 is a 1Kb standard DNA ladder; lane 2 is wild type; and lane 3 is the mutant. Which of the following best explains the nature of the mutation? A. the mutant allele is missing an intron B. the mutant allele is missing an exon C. the mutant allele has a deletion of about 330 bp D. the mutant allele has an insertion of about 330 bp E. the mutant allele contains a transposon

C. the mutant allele has a deletion of about 330 bp The mutant has a deletion of about 330 bp. While options A or B could be correct, we don't know for sure the deletion exactly is.

Two equal peaks, larger than the others, in a FinchTV chromatogram indicates A. a very good sequence read. B. that any of the four bases could be located at that position. C. two of the bases can be ruled out as being located at that position. D. that the base at that position is Thymine.

C. two of the bases can be ruled out as being located at that position.

Which of the following is the most direct benefit of high-throughput Sanger sequencing? A) Bases can be identified as soon as they are added to the template. B) RNA can be directly sequenced without first reverse transcribing it into DNA. C) An entire chromosome can be sequenced without disrupting it into smaller fragments. D) Many DNA samples can be sequenced simultaneously.

D) Many DNA samples can be sequenced simultaneously.

What is the term for two genes from two different species that are similar in sequence and serve the same function in each species? A)Related genes B)Paralogs C)Gene family D)Orthologs

D) Orthologs

The program BLAST would be best used for what purpose? A)Determining what restriction sites are present in a fragment of DNA B)Identifying a promoter sequence C)Identifying splice donor and acceptor sites D)Identify related sequences to a given DNA sequence in a database

D)Identify related sequences to a given DNA sequence in a database

In an analysis of the nucleotide composition for any double stranded DNA molecules, which of the following relationships of the nitrogenous bases will not be found? A. A = T B. C = G C. (A + T) + (C + G) = 100 % D. (A + T) - (C + G) = 0 % E. A + C = G + T

D. (A + T) - (C + G) = 0 %

An acceptable E-value for an amino acid sequence alignment is A. 4.21 B. 1.01 C. 10000 D. 6 x 10^-4 E. 0.01

D. 6 x 10^-4 Moreover, DNA:DNA alignment statistics are less accurate than protein:protein statistics; while protein:protein alignments with expectation values < 0.001 can reliably be used to infer homology, DNA:DNA expectation values < 10−6 often occur by chance, and 10^−10 is a more widely accepted threshold for homology based on DNA:DNA searches.

What is the approximate length in base pairs for the PCR product in lane 3 of the agarose gel below? A.500 B. 750 C. 6250 D. 625 E. 5000

D. 625

What are the three stop codons? A. UAA, AUU, GUU B. TAU, AUT, UTA C. ATT, TAA, ATG D. UAA, UAG, UGA E. None are correct

D. UAA, UAG, UGA

Sequencing an entire genome, such as that of C. elegans, a nematode, is most important because___________________ A. the nematode is a good animal model for developing cures for viral illnesses. B. it allows researchers to use the sequence to build a "better" nematode, resistant to disease. C. a sequence that is found to have no introns in the nematode genome is likely to have acquired the introns from higher organisms. D. a sequence that is found to have a particular function in the nematode is likely to have a closely related function in vertebrates. E. it allows research on a group of organisms we do not usually care much about.

D. a sequence that is found to have a particular function in the nematode is likely to have a closely related function in vertebrates.

The genetic information of DNA is contained in A. the variation in the structure of nucleotides that make up the DNA molecule. B. the sequence of amino acids that make up the DNA molecule. C. the types of sugars used in making the DNA molecule. D. the sequence of nucleotides along the length of the two strands of the DNA molecule. E. all of the above

D. the sequence of nucleotides along the length of the two strands of the DNA molecule.

Suppose you have just discovered a Drosophila gene that has a sequence similar to a gene of interest in humans. You need to have mutants of the Drosophila gene because___________ A. you need to see whether fly mutants have a defect in the same system B. you want to compare the mutant Drosophila sequence to each mutant human sequence. C. you need to have as many alleles in Drosophila as you have found in humans. D. you need to see whether the Drosophila mutant disrupts the same metabolic pathway. E. you need to see whether the mutant produces the same phenotype.

D. you need to see whether the Drosophila mutant disrupts the same metabolic pathway. I thought that was a little tricky and more than one answer could be correct but I would go with D. You need to see whether the Drosophila mutant disrupts the same metabolic pathway. Generally, when we study simpler organisms/systems, it's to gain insight about it's pathway and interactions in other more interesting species like humans.

Which of the following would inhibit amplification of DNA during the polymerase chain reaction? A. 25 mM Tris-HCl pH 8.4 B. 1,000 copies of the initial template DNA C. excess Taq DNA polymerase D. 50 mM KCl E. 0.5% SDS

E. 0.5% SDS

How many common amino acids are found in Eukaryotes? A. 21 B. 42 C. 64 D. 5 E. 20

E. 20

Which of the following best describes the addition of nucleotides to a growing DNA chain? A. A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of phosphate. B. A nucleoside monophosphate is added to the 5' end of the DNA. C. A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate D. A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate. E. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

E. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

Which of the plots below correctly depicts the amplification profile for a typical polymerase chain reaction? A. A B. B C. C D. D E. E

E. E

Which of the following DNA molecules would require the most heat to separate? Note only one strand is shown, the other strand would be the complement. A. GAAATTTC B. AGTCGAAT C. GGATCCTG D. CTGCATAC E. GCGTGCAC

E. GCGTGCAC because it has the largest number of Gs and Cs which are known to have 3 hydrogen bonds vs two for the AT

Of the following, which is the most fundamental description of a gene? A. a unit of heredity that causes formation of a phenotypic characteristic B. a DNA-RNA sequence combination that results in an enzymatic product C. a DNA subunit that codes for a single complete protein D. a discrete unit of hereditary information that consists of a sequence of amino E. a DNA sequence that is expressed to form a functional product: either RNA or polypeptide

E. a DNA sequence that is expressed to form a functional product: either RNA or polypeptide

Thomas Hunt Morgan didn't know about the specific structure of DNA. However, which of Morgan's contributions were necessary when Watson and Crick proposed a model for DNA structure? A. dominance vs. recessiveness B. sex-linkage C. the usefulness of Drosophila D. genetic distance and mapping E. the particulate nature of the hereditary material

E. the particulate nature of the hereditary material

DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration. ⊚ true ⊚ false

False

Map units correspond to fixed physical distances. ⊚true ⊚false

False

Below is a basic structure for the coding strand of the human insulin gene. Various positions are identified A-E. A point mutation at which position(s) would not affect the function of insulin? A. A B. B C. C D. D E. E

No right answers. Actually, all mutations, whether in introns, exons, UTRs, could have an effect on the protein, translation, sequence, and or function.

If a portion of a transcription factor's domain is structurally similar in a variety of organisms, it is called a motif. ⊚true ⊚false

True

In sequencing by synthesis (SBS) methods, the sequence of a sample is directly determined as nucleotides are incorporated into a DNA strand by DNA polymerase. ⊚ true ⊚ false

True