Kinkle Exam 4 (clicker)
A species that has four sets of homologous chromosomes can have __ different combinations of chromosomes in its gametes? A. 4 B. 8 C. 12 D. 16
16
Which sequence of events correctly describes the initiation and elongation steps of translation in prokaryotic cells? 1) initator tRNA beinds start codon on mRNA 2) small ribosomal subunit binds to mRNA 3) large ribosomal subnit binds 4) tRNA entry and peptidyl transfer reaction 5) translocation of ribosome and release of tRNA A. 1, 2, 3, 4, 5 B. 1, 2, 3, 5, 4 C. 1, 3, 2, 4, 5 D. 2, 3, 1, 5, 4 E. 2, 1, 3, 4, 5
2, 1, 3, 4, 5
Once researchers identified DNA as the unit of inheritance, they asked how information was transferred from the DNA in the nucleus to the site of protein synthesis in the cytoplasm. What is the mechanism of information transfer in eukaryotes? A. DNA from a single gene is replicated and transferred to the cytoplasm, where it serves as a template for protein synthesis. B. Messenger RNA is transcribed from a single gene and transfers information from the DNA in the nucleus to the cytoplasm, where protein synthesis takes place. C. Proteins transfer information from the nucleus to the ribosome, where protein synthesis takes place. D. Transfer RNA takes information from DNA directly to a ribosome, where protein synthesis takes place.
Messenger RNA is transcribed from a single gene and transfers information from the DNA in the nucleus to the cytoplasm, where protein synthesis takes place.
In the process of transcription A. DNA is replicated B. RNA is synthesized C. proteins are synthesized D. mRNA attaches to ribosomes
RNA is synthesized
If the DNA triplet code were ATG CGT, the corresponding tRNA anticodons would be A. AUG CGU B. ATG CGT C. UAC GCA D. UAG CGU
UAC GCA
If the gene encoding the trp repressor is mutated such that it can no longer bind tryptophan, will transcription of the trp operon occur? A.Yes, because the trp repressor can only bind the trp operon and block transcription when it is bound to tryptophan B.No, because this mutation does not affect the part of the repressor that can bind the operator C.No, because the trp operon is repressed only when tryptophan levels are high D.Yes, because the trp operon can allosterically regulate the enzymes needed to synthesize the amino acid tryptophan
Yes, because the trp repressor can only bind the trp operon and block transcription when it is bound to tryptophan
A single base substitution mutation is least likely to be deleterious when the base change results in ________. A. a stop codon B. a codon that specificies the same amino acid as teh original codon C. an amino acid substitution that alters the teritary structure of the protein D. an amino acid substitution at the active site of an enzyme
a codon that specifies the same amino acid as the original codon
Why are viruses called obligate intracellular parasites? A.They must use a host cell's metabolic enzymes and pathways to obtain energy. B.They must use a host cell's ribosomes to synthesize proteins. C.They must use a host cell's nucleotides for transcription and replication. D.They must use a host cell's amino acids to synthesize proteins. E.All of the above.
all of the above
The mechanism by which the induce causes the repressor to detach the operator is an example of A. catabolite repression B. transcription C. transposition D. allosteric regulation E. recombination
allosteric regulation
What is the primary cause of virus specificity for certain hosts? A.The type of nucleic acid it contains, i.e. RNA or DNA B.Attachment to host C.Presence or absence of a capsid D.Presence of restriction enzymes
attachment to host
Which of the following are made up of prokaryotic cells? A.Bacteria and fungi B.Archaea and fungi C.Protozoa and animals D.Bacteria and archaea
bacteria and archaea
What do we call a virus that attacks a bacterium? A.Prion B.Viroid C.Bacteriophage D.Retrovirus
bacteriophage
In your group: Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift
base addition - frameshift
A sequence of three RNA bases can funciton as a A. codon B. anti codon C. gene D. both 1 and 2 E. both 1 and 3 F. 1, 2, 3
both 1 and 2
Codons are part of the molecular structure of _____ A. a protein B. mRNA C. tRNA D. rRNA
mRNA
A bacterial gene regulatory system is likely to have all of the following except A. genes. B. an operator. C. a promoter. D. one or more introns. E. an operon
one or more introns
Which of the following most closely resembles a polysaccharide in composition and structure? A.Peptidoglycan B.Chromosome C.Plasma membrane D.Flagella E.Biofilms made by oral bacteria
peptidoglycan biofilms made by oral bacteria
Enveloped viruses A.Have a thin layer of peptidoglycan in their envelope B.always contain RNA C.pick up their envelope from their host D.commonly infect bacteria, i.e. are bacteriophage
pick up their envelope from their host
To begin transcription, RNA polymerase must bind to a segment of DNA called the ____. A.initiation site B.primer C.inducer D.promoter
promoter
The three basic parts of an operon are the A. promoter, the operator, and the structural gene(s) B. promoter, the structural gene(s), and the termination codons C. promoter, the mRNA, and the termination codons D. structural gene(s), the mRNA, and the tRNAs
promoter, the operator, and the structural gene(s)
What would happen initially to cells that lack a functional ubiquitin? A.Nothing would happen. B.Transcriptional initiation would increase. C.Protein degradation would decrease. D.Histone modifications would increase.
protein degradation would decrease
Which is not a component of the translation machinery? A. mRNA B. tRNA C. Ribosomes D. Protein polymerase
protein polymerase
Transcription factors are A.RNA sequences that bind to RNA polymerase B.DNA sequences that regulate transcription C.proteins that bind to regulatory DNA sequences D.polysaccharides that bind to the transcripts
proteins that bind to regulatory DNA sequences
Transcription factors are A.RNA sequences that bind to RNA polymerase. B.DNA sequences that regulate transcription. C.proteins that bind to the DNA promoter sequence. D.histone proteins that open up DNA for transcription.
proteins that bind to the DNA promoter sequence
Expression of some eukaryotic genes can be regulated by translational control. One advantage of translational control is that it A.provides a means for rapid change in protein concentrations B.prevents synthesis of excess RNA C.directs proteins to their proper subcellular location D.occurs only in zygotes E.degrades proteins that are no longer needed.
provides a means for rapid change in protein concentrations
Producing alcohol benefits fermenting bacteria primarily by A.Producing NADH B.Killing viruses C.Regenerating NAD+ so that glycolysis can continue D.Producing ATP using a membrane bound ATPase and proton motive force
regenerating NAD+ so that glycolysis can continue
all viruses A.contain DNA B.contain RNA C.require host cells for reproduction D.contain ribosomes
require host cells for reproduction
Enhancers are the binding sites for the A.promoters of DNA synthesis. B.suppressor factors. C.co-activation factors. D.specific transcription factors.
specific transcription factors
A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is _____. A. 3' UCA 5' B. 3' UGA 5' C. 5' TCA 3' D. 3' ACU 5'
3' UCA 5'
If a bacterial population has a starting population of 1000 cells and a doubling time of 30 minutes, how many cells will there be in three hours? A.3,000 B.16,000 C.30,000 D.32,000 E.64,000 F.90,000
64,000
In positive control of several sugar-metabolism-related operons, the catabolite activator protein (CAP) binds to DNA to stimulate transcription. What causes an increase in CAP activity in stimulating transcription? A.An increase in glucose and an increase in cAMP B.A decrease in glucose and an increase in cAMP C.An increase in glucose and a decrease in cAMP D.A decrease in glucose and a decrease in the repressor
A decrease in glucose and an increase in cAMP
During elongation, which site in the ribosome represents the location where a codon is being rea? A. E site B. P Site C. A site D. the small ribosomal subunit
A site
During elongation, which site in the ribosome represents the location where a codon is being read to match the anticodon in a charged tRNa? A.E site B.P site C.A site D.the small ribosomal subunit
A site
Future kidney cells and heart cells can differentiate into their respective specialized cell types because they A.express a different set of genes during fertilization B.possess different genes C.arise from different embryonic stem cells D.express different genes and utilize different transcription factors during development
express different genes and utilize different transcription factors during development
If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone A. a missense mutation. B. gene amplification. C. a chromosomal translocation. D. retroviral insertion. E. a nonsense mutation.
gene amplification
How are inducible and repressible systems similar? A. they both control catabolic pathways. B. they both control biosynthetic pathways C. in both systems the regulatory molecules function by binding to the operator D. they both block transcription by default
in both systems the regulatory molecules function by binding to the operator
You thinly slice a carrot root and place the slices on a medium containing nutrients and hormones necessary for plant growth. After a few weeks, you see that there are many little entire carrot plants growing from the root slices. The cells in the root can give rise to an entire plant because many plant cells are A.totipotent B.unipotent C.embryonic D.pluripotent
totipotent
RNA polymerase by itself cannot bind to the chromosome and initiate transcription. It can bind and act only after regulatory proteins called _______ factors have been assembled. A.translation B.post-translation C.initiation D.transcription
transcription
When E. coli cells produce the amino acid tryptophan, a cluster of five genes is transcribed together. This cluster of genes is referred to as the A. trp transcriptional operator. B. trp regulator. C. trp suppressor. D. trp operon.
trp operon
_______ acts as a corepressor to block transcription of the tryptophan operon A. cAMP B. Lactose C. Tryptophan D. Methionine E. CRP
tryptophan
Which molecule is used to mark or label proteins for destruction? A.Proteases B.Proteasome C.Ubiquitin D.Methylation
ubiquitin
Jams, jellies, preserves, honey, and other foodstuffs with high sugar content hardly ever become contaminated by bacteria, even when the food containers are left open at room temperature. This is because bacteria that encounter such an environment A.experience lysis. B.are unable to metabolize the sugar and thus starve to death. C.undergo death as a result of water loss from the cell. D.are unable to swim through these thick and viscous materials.
undergo death as a result of water loss from the cell
There are ~ 4.6 million base pairs in an E. coli chromosome. If its DNA polymerase makes 1 mistake every 109 bases, about how many new mutations will there be in a colony containing 109 bacteria if it doubles in size? A.~50,000,000 B.~5,000,000 C.~500,000 D.~50,000
~5,000,000
How does the termination of translation take place? A. The end of the mRNA molecule is reached. B. A stop codon is reached. C. The 5' cap is reached. D. The poly-A tail is reached.
A stop codon is reached
You are studying the effects of specific transcription factors on the activation of gene expression. You notice that one particular transcription factor binds far away from the promoter of its target gene. What can explain this? A.The transcription factor transcribes small RNAs that then bind to the promoter and activate the gene's expression. B.The transcription factor tags the enhancer with ubiquitin to stimulate transcription. C.RNA looping brings the transcription factor closer to the promoter and initiates gene transcription. D.DNA looping brings the transcription factor closer to the promoter and initiates gene transcription.
DNA looping brings the transcription factor closer to the promoter and initiates gene transcription
The first repair of mistakes during DNA replication is made by A. the mismatch repair system B. DNA polymerase C. excision repair D. SOS repair E. post replication repair
DNA polymerase
a promoter is the region of A. a plasmid that binds the enzymes for replication. B. the mRNA that binds to a ribosome. C. DNA that binds RNA polymerase. D. the mRNA that binds tRNAs.
DNA that binds to RNA polymerase
The different components of the protein-synthesizing machinery used directly in translation include all of the following except A. mRNA. B. tRNA. C. ribosomes. D. amino acids. E. RNA polymerase.
RNA polymerase
Which of the following must happen for transcription to be initiated? A. DNA polymerase must have access to the DNA double helix and also must be capable of binding to the gene's promoter. B. RNA polymerase must have access to the DNA double helix and also must be capable of binding to the gene's promoter. C. DNA polymerase must have access to the RNA and also must be capable of binding to the gene's promoter. D. DNA ligase must have access to the DNA double helix and also must be capable of binding to the gene's promoter.
RNA polymerase must have access to the DNA double helix and also must be capable of binding to the gene's promoter
________ is to transcription as ________ are to translation. A.RNA spliceosome; ribosomes B.RNA polymerase; ribosomes C.DNA polymerase; RNA polymerases D.DNA polymerase; ribosomes
RNA polymerase; ribosomes
Post-translational modications of proteins may include the ___. A. removal of introns B. addition of a 5' cap C. addition of poly-A tail D. addition of carbohydrates to form a glycoprotein
addition of carbohydrates to form a glycoprotein
Post-translational modifications of proteins may include the _____. A.removal of introns B.addition of a 5' cap C.addition of a poly-A tail D.addition of carbohydrates to form a glycoprotein
addition of carbohydrates to form a glycoprotein
Which of the following are mutagens, and thus potential causes of human cancer?(There may be more than one correct answer) A. UV light B. Certain industrial chemicals like formaldehyde C. "Tar" in tobacco D. X-rays E. Hydrazines in mushrooms F. Estragole in basil G. Alcohol in beer
all correct
When the concentration of glucose in the medium falls, the concentration of ______ rises? A. CRP B. cAMP C. Repressors D. Inducers E. ATP
cAMP
A muscle precursor cell would be considered to be A.pluripotent. B.determined. C.differentiated. D.induced.
determined
Which of the following is not true of animal development? A.Genes regulate development B.Development occurs by loss of unneeded DNA C.Mitosis is involved in increasing the number of early embryonic cells D.Chemical signaling between cells is important
development occurs by loss of unneeded DNA
Transcriptional control-proteins called activators increase the rate of transcription by binding to A.mRNA sequences within the DNA. B.tRNA sequences within the DNA. C.operator sequences within the DNA. D.promotor sequences within the DNA. E.enhancer sequences within the DNA.
enhancer sequences within the DNA
Imagine that the TATA box for gene X becomes highly methylated. How will this affect the expression of gene X? A.There will be no effect. B.Gene X will be transcribed but not translated. C.Gene X will be transcribed if the transcription factors receive the appropriate environmental signal. D.Gene X will not be transcribed or translated.
gene x will not be transcribed or translated
A nonsense mutation in a gene ______ A. changes an amino acid in the encoded protein B. has no effect on the amino acid sequence of the encoded protein C. introduces a premature stop codon into the mRNA D. alters the reading frame of the mRNA
introduces a premature stop codon into the mRNA
What effect does the presence of ample glucose have on the amount of lac operon transcription? A.It increases the cAMP concentration, which in turn causes a decreased rate of transcription. B.It decreases the cAMP concentration, which in turn causes an increased rate of transcription. C.It increases the rate of transcription. D.It decreases the rate of transcription.
it decreases the rate of transcription
According to the central dogma, what molecule should go into the blank? DNA--> _________ --> Proteins A. mtDNA B. rRNA C. mRNA D. tRNA
mRNA
Translation directly requires A. mRNA, tRNA, DNA, and rRNA B. mRNA, DNA, and rRNA C. mRNA, tRNA, and rRNA D.. mRNA, tRNA, and DNA
mRNA, tRNA, and rRNA
In humans, the two-nucleotide deletion causes a pre-mature stop codon to be translated later on. This is an example of a: A. missense mutation B. nonsense mutation C. silent mutation D. frameshift mutation
nonsene mutation frameshift mutation
A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? A.nonsense mutation B.missense mutation C.silent mutation D.sense mutation
nonsense mutation
In neurons, the globin gene contains many methylated cytosines. The globin gene, therefore, is A.expressed only in males B.expressed only in females C.not expressed D.regulated by posttranscriptional control E.regulated by posttranslational control
not expressed
MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and an increased rate of cell division, then the mutated gene is called a(n) A. spliceosome. B. transposon. C. tumor-suppressor gene. D. oncogene.
oncogene
Several proteins are needed in the brain neuron cells for optimal thinking and learning, e.g. for answering this question. The genes encoding these proteins are located on several different chromosomes, however. How do your neuron cells get all the genes expressed at the same time since they are not located in operons, like in bacteria? A.Specific transcription factors B.Ubiquitin and Proteasomes C.Crossing over D.Alternative splicing
specific transcription factors
Transcription of structural genes in an inducible operon _____. A.occurs continuously in the cell B.starts when the pathway's substrate is present C.starts when the pathway's product is present D.stops when the pathway's product is present
starts when the pathway's substrate is present
Which of the following statements about stem cells is false? A.Stem cells can undergo mitosis. B.Some stem cells can differentiate into more than one type of specialized cell. C.Different types of stem cells vary in their potency. D.Stem cells are only found in embryos. E.Some stem cells can only differentiate into one cell type.
stem cells are only found in embryos
During translation elongation, the existing polypeptide chain is transferred to? A. the tRNA occupying the A site B. the tRNA occupying the P site C. the ribosomal rRNA d. a signal recognition particle
the tRNA occupying the A site
Fewer different tRNA molecules exist than might have been expected for the complexity of its function. This is possible because A. the third position of the codon does not have to pair conventionally B. the second position of the codon does not have to pair conventionally C. the anticodon does not have the conventional bases D. the code is degenerating
the third position of the codon does not have to pair conventionally
The citrullination of arginine in histones will: A. remove the R group from arginine B. change the packaging and expression of the genes in the chromatin C. remove an amino acid from the protein D. cause premature termination of translation
change the packaging and the expression of the genes in the chromatin
In eukaryotic cells, promoters are A.transcribed B.transcribed and translated C.neither transcribed nor translated D.transcribed and then removed E.sequences of RNA that are spliced out
neither transcribed nor translated
In a healthy cell, the rate of DNA repair is equal to the rate of DNA mutation. When the rate of repair lags behind the rate of mutation, what is a possible fate of the cell? A. The cell can be transformed to a cancerous cell. B. RNA may be used instead of DNA as inheritance material. C. The cell will become embryonic. D. DNA synthesis will continue by a new mechanism.
the cell can be transformed to a cancerous cell
If you isolate a pancreatic beta cell and put it in the proper growth conditions, it will divide by mitosis and produce new beta cells, but it will not produce pancreatic alpha cells or pancreatic cells that release digestive enzymes. The pancreatic beta cell is A.totipotent B.impotent C.unipotent D.multipotent E.pluripotent
unipotent
There are 45 different kinds of tRNA (anticodons) available to serve as amino acid carriers, but there are 64 mRNA codons. Why aren't the tRNA anticodons and mRNA codons equal in number? A. The third base pair on the tRNA allows some flexibility (wobble); thus, some tRNA anticodons can recognize more than one mRNA codon. B. Some tRNA anticodons can misread some of the mRNA codons, which creates a "wobble" in the tRNA anticodons that can be repaired by RNA repair enzymes. C. The third base pair on the mRNA codon allows some flexibility (wobble); thus, some tRNA anticodons can recognize more than one mRNA codon. D. The tRNA has the flexibility to choose which mRNA codons are necessary for building the polypeptide chain.
The third base pair on the tRNA allows some flexibility (wobble); thus, some tRNA anticodons can recognize more than one mRNA codon. OR The third base pair on the mRNA codon allows some flexibility (wobble); thus, some tRNA anticodons can recognize more than one mRNA codon.
Which of the following is most likely to have a small protein called ubiquitin attached to it? A.a cyclin protein, that usually acts in G1, in a cell that is in G2 B.a cell surface protein that requires transport from the ER C.an mRNA leaving the nucleus to be translated D.an mRNA produced by an egg cell that will be retained until after fertilization
a cyclin protein, that usually acts in G1, in a cell that is in G2
Which of the following types of mutation, resulting in an error in the mRNA just after the AUG start of translation, is likely to have the most serious effect on the polypeptide product? A. a deletion of a codon B. a deletion of two nucleotides C. a substitution of the third nucleotide in an ACC codon D. a substitution of the first nucleotide of a GGG codon
a deletion of two nucleotides
The most commonly occurring mutation in people with cystic fibrosis is a deletion of a single codon. This results in _____. A.a base-pair substitution B.a frameshift mutation C.a polypeptide missing an amino acid D.a nonsense mutation
a polypeptide missing an amino acid
Mitotic cyclins, which persist in the cell for only a few minutes, have one of the shortest life spans of all intracellular proteins. After a CDK-cyclin complex has performed its function, the associated cyclin is polyubiquitinated and destroyed by the proteasome, which provides directionality for the cell cycle. Which of the following is not a time point where you would expect to see an increase in cyclin degradation by proteasomes? A.After cytokinesis checkpoint B.After G2/M checkpoint C.After spindle checkpoint D.After G1/S checkpoint
after cytokineses checkpoint
The trp repressor blocks transcription of the trp operon when the repressor _____. A.binds to the inducer B.binds to tryptophan C.is not bound to tryptophan D.is not bound to the operator
binds to tryptophan
an inducer ____ A. combines with a repressor and prevents it from binding the promoter B. combines with a repressor and prevents it from binding the operator C. binds to the promoter and prevents the repressor from binding to the operator D. binds to the operator and prevents the repressor from binding at this site
combines with a repressor and prevents it from binding the operator
Which of the following occurs in prokaryotes but not in eukaryotes? A. post-transcriptional splicing B. concurrent transcription and translation C. translation in the absence of a ribosome D. gene regulation
concurrent transcription and translation
What type of nucleotide sequence would be present at the fusion site of the human chromosome #2? A. active telomere B. inactive centromere C. Active centromere D. inactive telomere
inactive telomere
Most repressor proteins are allosteric. Which of the following binds with the repressor to alter its conformation? A.Inducer B.Promoter C.transcription factor D.cAMP
inducer
The lactose analog isopropyl-b-D-thio-galactoside (IPTG) is often used to regulate gene expression systems in bacteria. IPTG does not act as a substrate for b-galactosidase, but can bind to, and inactivate, the repressor. In this case, IPTG serves as a(n) A. inducer. B. repressor. C. effector. D. operon
inducer effector
What amino acid sequence will be generated, based on the following mRNA codon sequence? 5' AUG-UCU-UCG-UUA-UCC-UUG 3' A. met-arg-glu-arg-glu-arg B. met-glu-arg-arg-glu-leu C. met-ser-leu-ser-leu-ser D. met-ser-ser-leu-ser-leu
met-ser-ser-leu-ser-leu
What does it mean when we say the genetic code is redundant? A. A single codon can specify the addition of more than one amino acid. B. The genetic code is different for different domains of organisms. C. The genetic code is universal (the same for all organisms). D. More than one codon can specify the addition of the same amino acid.
more than one codon can specify the addition of the same amino acid
The heart stem cell, or cardiac progenitor cells (hCPCs), are best described as: A.Determined B.Multipotent C.Totipotent D.Unipotent
multipotent
Which of the following is not a feature of TATA boxes in eukaryotes? A.They bind transcription factors B.They are found in the region of the promoter C.They are part of the intron consensus sequence D.They help specify the starting point for transcription E.They contain thymine-adenine base pairs
they are part of the intron consensus sequence
Retroviruses are called retro because A.they make DNA from their RNA genome B.evolutionarily they are very old C.they essentially enter the cell through the back door D.they only infect retro cells
they make DNA from their RNA genome
Why do dentists tell you to floss? A.They want my gums to bleed, which improves gum growth and health B.To remove food particles, preventing S. mutans from breaking down the enamel between my teeth, where it's difficult to reach with a toothbrush C.Most dentists own companies that produce dental floss and toothpaste D.They like to watchme suffer
to remove food particles, preventing S. mutans from breaking down the enamel between my teeth, where its difficult to reach with a toothbrush
What do we call a cell that is able to give rise to every cell in the adult body? A.Determined B.Unipotent C.Totipotent D.Morphogenic
totipotent
What proteins influence the ability of RNA polymerase to transcribe genes? A.DNA polymerases B.DNA helicases C.Transcription factors D.snRNPs
transcription factors
If the gene encoding the lac repressor is mutated so that the repressor can no longer bind the operator, will transcription of that operon occur? A.Yes, but only when lactose is present B.No, because RNA polymerase is needed to transcribe the genes C.Yes, because RNA polymerase will be able to bind the promoter and transcribe the operon D.No, because cAMP levels are low when the repressor is nonfunctional
yes, because RNA polymerase will be able to bind the promoter and transcribe the operon
The following mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA UCC UCC ACU CCU UGA-3' Use the following codons and the amino acids they encode. AUG = Start or Met; UUU, UUC = Phe; UUA, UUG = Leu; UCU, UCC = Ser; CCU, CCC = Pro; ACU, ACC = Thr; UGA = Stop. A. Thr-Phe-Thr B. Phe-Leu-Ser-Ser-Thr-Pro C. Met-Phe-Leu-Ser-Ser-Thr-Pro D. Thr-Phe-Thr-Phe-Leu-Ser-Ser-Thr-Pro E. Met-Phe-Leu-Ser-Ser
Met-Phe-Leu-Ser-Ser-Thr-Pro
Unlike lytic phage, lysogenic phage are able to A.Lyse their host B.Replicate in their host, making hundreds of copies of the virus C.Attach to the host membrane, then enter inside D.Insert themselves into the host genome
insert themselves into the host genome
_____ bacteria have a cell wall A.No B.Some C.Most D.All
most
What characteristic distinguishes stem cells from cancer cells? A.Stem cells are all totipotent B.Stem cells regulate their growth C.Stem cells are undetermined D.Stem cells can undergo mitosis
stem cells can regulate their growth
Which of the following is directly related to a single amino acid? A. base sequence of the tRNA B. the amino acetyl tRNA synthase C. the three-base sequence of mRNA D. the complementary of DNA and RNA
the three-base sequence of mRNA