Mitosis/ Cell Cycle/ Meiosis MB HW- Unit 3

For the male Drosophila shown in Figure 13.1, what are the (1) haploid number, (2) ploidy, and (3) total number of chromosomes?

(1) 4, (2) 2n, and (3) 8

During transcription, in which direction is (1) RNA synthesized and in which direction is (2) the DNA template "read"?

(1) 5'—>3' (2) 3'—>5'

You can tell this diagram is showing transcription rather than replication because ...

(b) only one strand is being used as template.(c) the product contains U.

The karyotype of a trisomic individual is symbolized as ____.

2n+1

For the Meselson-Stahl experiment shown in Figure 15.5, what would be the composition of the DNA after three generations?

3/4 low-density and 1/4 intermediate-density

A cell containing 32 sister chromatid pairs at metaphase would, at its completion of mitosis, produce two cells containing how many chromosome each?

32

Sunflowers have 34 chromosomes in their somatic cells. If a sunflower were to have a monosomy for one of its chromosomes because of a pollen cell that experienced non-disjunction, how many chromosomes would we expect in that sunflower plant with a monosomy?

33

Given the following information, what would be the mRNA produced (assume we transcribe the whole molecule)? Coding Strand 5' A T C G G C A T G C A G G C T T G A C T C 3' 3' T A G C C G T A C G T C C G A A C T G A G 5' Template Strand

5' AUCGGCAUGCAGGCUUGACUC 3'

Imagine that the DNA strand shown below serves as the template for DNA synthesis. 5' CATGCATAGA 3' Assuming no errors in DNA synthesis, what would the new DNA look like?

5' TCTATGCATG 3'

The direction of synthesis of an RNA transcript is _____.

5' —> 3'

What proportion (percent) of chromosomes in a human skin cell are paternal chromosomes?

50

The organism which is undergoing mitosis in this representative cell would have a diploid number of ____ and a haploid number of ____.

6; 3

Just prior to the formation of a new peptide bond, the tRNA attached to the polypeptide chain occupies the _______ site of the ribosome.

P

Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

Phosphate groups

Which of the following enzymes creates a primer for DNA polymerase?

Primase

Which of the following statements about DNA synthesis is true?

Primers are short sequences that allow the initiation of DNA synthesis

A _____ is a sequence of DNA where RNA polymerase will bind in order to transcribe a specific gene. A(n) ____ is sequence of mRNA where a ribosome will begin translating.

Promoter; Start codon

In the diagram below, the gray unit represents _____. green: two blue strands:

RNA polymerase, the promoter, DNA

The synthesis of a new strand begins with the synthesis of a(n) _____.

RNA primer complementary to a preexisting DNA strand

During what phase of the cell cycle does the DNA become replicated?

S

Which of the following is directly produced by the process of DNA replication in the cell cycle?

Sister chromatids

The cell below is a ___ cell which you can tell because ___.

Somatic cell; each chromosome has a homologous chromosome

After DNA replication is completed, _____.

each new DNA double helix consists of one old DNA strand and one new DNA strand

The diagram below shows a replication bubble with synthesis of the leading and lagging strands on both sides of the bubble. The parental DNA is shown in dark blue, the newly synthesized DNA is light blue, and the RNA primers associated with each strand are red. The origin of replication is indicated by the black dots on the parental strands. Rank the primers in the order they were produced. If two primers were produced at the same time, overlap them.

earliest to latest a-h, b-g, c-f, d-e

The RNA segments joined to one another by spliceosomes are _____

exons

True or false? Mitosis takes place during M phase, which is the longest phase of the cell cycle.

false (shortest)

Meiosis typically produces _____ cells, each of which is _____.

four ... haploid

The first step in the replication of DNA is catalyzed by _____

helicase

Which nucleic acid is translated to make a protein?

mRNA

what is being depicted in the picture

meiosis

A point mutation that results in the substitution of one amino acid for another within a protein is a ______.

missense mutation

For the three structures below, please identify which cell division process(es) they will be present during.

mitosis meiosis- C both- B, A

During RNA processing a(n) _____ is added to the 5' end of the RNA.

modified guanine nucleotide

Okazaki fragments are found ______.

only on the lagging strand

Telomerase is needed to ______.

prevent the loss of DNA bases at the ends of linear chromosomes

Topoisomerase works to ______.

prevent twisting of DNA in front of the replication fork

This image depicts a view of _____ during meiosis.

prophase 2

5' caps and 3' poly(A) tails of eukaryotic mRNAs ______.

protect mRNA from degradation and enhance translation

The action of helicase creates _____.

replication forks and replication bubbles

Where does translation take place?

ribosome

The primers used for DNA synthesis are ______.

short RNA sequences

If the T and A in the box were changed to a C and G, respectively to create a mutant, what type of mutation would this be?

silent

The mRNA produced here will be ______ in sequence to strand ______.

similar, A

Which term describes two recently replicated DNA strands that are joined together just before cell division?

sister chromatids

Spliceosomes are composed of _____.

small RNAs and proteins

What is the function of primase?

synthesis of a short RNA, complementary to single-stranded DNA

components required for translation

tRNA, mRNA, ribosomes

Sort each description by the type of RNA it describes. Drag each item to the appropriate bin. tRNA mRNA rRNA

tRNA: contains an anticodon, has amino acids covalently attached mRNA: contains exons, specifies the amino acid sequence for a protein rRNA: is a component of ribosomes

Which of the choices properly lists the component that serves each of the functions noted below (in order)? Interacts with mRNA to change its code into amino acids Catalyzes transcription Increases the amount of time before mRNA is degraded in a eukaryotic cell

tRNA; RNA polymerase; Poly-A tail

Which stage of mitosis is characterized by the disintegration of mitotic spindles and the formation of two new nuclear membranes?

telophase

An old DNA strand is used as a _____ for the assembly of a new DNA strand.

template

The polarity of a DNA strand refers to the fact that ______.

the two ends of the strand have different chemical groups

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.

thymine ... cytosine

Translation occurs in the _____.

cytoplasm

In the diagram below, there is/are ______ replication bubble (s) and there is/are _____ replication forks.

1,2

Suppose a diploid cell with three pairs of homologous chromosomes (2n = 6) enters meiosis.How many chromosomes will the resulting gametes have in each of the following cases? 1.

1. 3 only 2. 2 or 4 3. 0 or 6 4. 2, 3, or 4 5. 0, 3, or 6

1. The new DNA strand that grows continuously in the 5' to 3' direction is called the ____. 2. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a _____. 3. After replication is complete, the new DNAs, called _____, are identical to each other. 4. ____ are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA 5. The enzyme that can replicate DNA is called _____.

1. leading strand 2. replication fork 3. daughter DNA 4. Okazaki fragments 5. DNA polymerase

In contrast to the leading strand, the lagging strand is synthesized as a series of segments called Okazaki fragments. The diagram below illustrates a lagging strand with the replication fork off-screen to the right. Fragment A is the most recently synthesized Okazaki fragment. Fragment B will be synthesized next in the space between primers A and B. Drag the labels to their appropriate locations in the flowchart below, indicating the sequence of events in the production of fragment B. (Note that pol I stands for DNA polymerase I, and pol III stands for DNA polymerase III.)

1. pol 3 binds to 3' end of primer B 2. pol 3 moves 5' to 3', adding DNA nucleotides to primer B 3. pol 1 binds to 5' end of primer A 4. pol 1 replaces primer A with DNA 5. DNA ligase links fragments A and B

As in most areas of biology, the study of mitosis and the cell cycle involves a lot of new terminology. Knowing what the different terms mean is essential to understanding and describing the processes occurring in the cell. Drag the terms on the left to correctly complete these sentences. Not all the terms will be used. 1. DNA replication produces two identical DNA molecules, called _____ , which separate during mitosis. 2. After chromosomes condense, the ____ is the region where the identical DNA molecules are most tightly attached to each other. 3. . During mitosis, microtubules attach to chromosomes at the____ . 4. In dividing cells, most of the cell's growth occurs during _____ . 5. The ____ is a cell structure consisting of microtubules, which forms during early mitosis and plays a role in cell division. 6. In most eukaryotes, division of the nucleus is followed by _____, when the rest of the cell divides. 7. The ____ are the organizing centers for microtubules involved in separating chromosomes during mitosis.

1. sister chromatids 2. centromere 3. kinetochore 4. interphase 5. mitotic spindle 6. cytokinesis 7. centrosome

Describe the sequence of events that occurs during translation as a protein elongates by one amino acid and the ribosome moves down the mRNA. Your answer should specify what is happening in the ribosome's A site, P site, and E site. Match the words in the left column to the appropriate blanks in the sentences on the right. Make certain each sentence is complete before submitting your answer. 1. A new ____ enters the A site. 2. A peptide bond forms between the polypeptide held by the___ in the ___ and the amino acid held by the ___ in the ___ . 3. The ribosome moves down the ___ . 4. An uncharged (no longer carrying an amino acid) tRNA leaves the ____ . 5. The now-uncharged tRNA that was in the ____ enters the ___ . 6. The ___ holding the polypeptide chain moves from the ____ to the ____. 7. A new ____ enters the newly-open ___ to begin the process again.

1. tRNA 2. tRNA, P site, tRNA, A site 3. mRNA 4. E site 5. P site, E site 6. tRNA, A site, P site 7. tRNA,A site

If you investigated somatic cells from a baby elephant (2n=56), you would find a total of _____ chromatids in a cell at the end of _____ phase of the cell cycle in mitosis.

112; G2

A diploid organism whose somatic (nonsex) cells each contain 32 chromosomes produces gametes containing _____ chromosomes.

16

An organism with a 2n (dipliod number) = 42 should have:

2 sets of 21 chromosomes

Normal human gametes carry _____ chromosomes.

23

At which site do new aminoacyl tRNAs enter the ribosome during elongation?

A site

Each codon shown below specifies an amino acid. For which one is it possible that a change in a single base could create a stop codon?

AAA

Which one of the following, if missing, would usually prevent translation from starting?

AUG codon

Based upon the mRNA synthesis diagram above, which letter likely designates where the ATG would be located in this gene that corresponds to the start codon in the mRNA?

B

Which answer correctly associates a phase of mitosis with what happens to chromosomes during that phase? Telophase: Chromosomes condense. Prometaphase: Chromosomes complete their migration to the middle of the cell. Prophase: Chromosomes are replicated. Anaphase: Sister chromatids separate.

Anaphase: Sister chromatids separate.

As the chromosomes of a parent cell are duplicated and distributed to the two daughter cells during cell division, the structure of the chromosomes changes. Answer the three questions for each phase of the cell cycle by dragging the yes and no labels to the appropriate locations in the table. Note: Assume that by the end of the M phase, the parent cell has not yet divided to form two daughter cells. Are sister chromatid present in all or part of this phase? Is the DNA condensed in all or part of this phase? Does the cell contain twice as much DNA in this phase as it did in the G1 phase?

Are sister chromatid present in all or part of this phase? G1-no S-yes G2-yes Beginning of M-yes End of M-noIs the DNA condensed in all or part of this phase?G1- no S-no G2-no Beginning of M-yes End of M-yesDoes the cell contain twice as much DNA in this phase as it did in the G1 phase?G1- no S-yes G2-yes Beginning of M- yes End of M-yes

During the elongation phase of translation, individual tRNAs move through the three sites of the ribosome in the following sequence _____.

A—>P—>E

Which of these gametes contains one or more recombinant chromosomes?

B and C

What would be the consequence(s) for DNA synthesis if primase were defective?

Both leading and lagging strand synthesis would be incomplete.

which is a correct drawing of a replication bubble

C

Codons are three-base sequences that specify the addition of a single amino acid. How do eukaryotic codons and prokaryotic codons compare?

Codons are a nearly universal language among all organisms.

Given the mRNA molecule below, what would the the primary sequence of the protein produced when it is translated? 5' AACCAUGCACGGAUGAUCAU 3'

N-term Met-His-Gly C-term

The Hershey-Chase experiment answered the question of whether protein or DNA was the genetic material by learning whether ______.

DNA or protein from a virus entered bacterial cells during infection

What catalyzes DNA synthesis?

DNA polymerase

Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?

DNA polymerase can assemble DNA only in the 5' to 3' direction

when are sister chromatids formed in a cell

DNA replication

what is the purpose of the following biological processes: DNA replication Mitosis Meiosis Transcription Translation

DNA replication: make sure that all of your cells have the full genome (chromosomes, DNA) Mitosis: create diploid somatic cells Meiosis: create halpoid gametes Transcription: make mRNA Translation: make proteins

What are the steps (in the correct order) that link a change in the base sequence of a gene to a change in the phenotype of an organism like a mouse or a human?

DNA—>RNA—>Protein

Which answer correctly identifies a cell-cycle checkpoint with a criterion for passing it? Metaphase checkpoint: DNA is undamaged. G2 checkpoint: Chromosomes have replicated successfully. G1 checkpoint: Chromosomes have replicated successfully. S checkpoint: DNA is undamaged.

G2 checkpoint: Chromosomes have replicated successfully.

A codon with the sequence CGU enters the open A site of a ribosome. The tRNA coming in would have the anticodon _____ and carry the amino acid _____.

GCA; Arginine (Arg)

Which of these correctly illustrates the pairing of DNA and RNA nucleotides?

GTTACG CAAUGC

How would genetic variation be affected if, during meiosis I, maternal chromosomes always lined up together on one side of the metaphase plate and paternal chromosomes always lined up on the other side (ignoring the effects of crossing over)?

Gametes would contain either maternal chromosomes only or paternal chromosomes only.

Which of the following options properly notes which structures separate in Anaphase I and Anaphase II (in order)?

Homologous chromosomes separate; sister chromatids separate

Which of the following mutations has the possibility of creating a knockout mutation?

Nonsense, frameshift, or missense only

How did the P site of the ribosome get its name?

It is where the polypeptide chain attached to the tRNA is transferred to the aminoacyl tRNA for peptide-bond formation.

If a cell lost the ability to produce microtubules (but could still make the microtubulin protein units), which cell cycle checkpoint would we expect the cell to arrest (stop) in during mitosis?

M checkpoint

5' UCAAAUGUUUAGGGACGGUUGACUCUAGUAUC 3'

Met-Phe-Arg-Asp-Gly-Stop

During which stage of mitosis are chromosomes lined up in the center of the cell?

Metaphase

Given the following information, what would be the primary sequence of the protein produced it were to be transcribed and translated? Coding Strand 5' A T C G G C A T G C A G G C T T G A C T C 3' 3' T A G C C G T A C G T C C G A A C T G A G 5' Template Strand

N-term Met-Gln-Ala C-term

For the experiment shown in Figure 12.6, which answer best describes what the prediction would be if chromosome movement were based on microtubule shortening at the spindle pole?

The darkened section will move toward the spindle pole but the distance between chromosomes and the darkened section will remain constant.

Which of the following steps occurs last in the initiation phase of translation?

The large ribosomal subunit joins the complex.

Which event does not take place before the start of mitosis?

The nuclear envelope disintegrates.

What is meant by translocation?

The ribosome slides one codon down the mRNA.

Which of the following statements about Okazaki fragments in E. coli is true?

They are formed on the lagging strand of DNA.

Which of the following enzymes is important for relieving the tension in a helix as it unwinds during DNA synthesis?

Topoisomerase

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

a frameshift deletion at the beginning of the gene

During RNA processing a(n) _____ is added to the 3' end of the RNA.

a long string of adenine nucleotides

A knock-out allele is ______.

a mutated form of a gene that does not make a functioning product

A promoter is ______.

a sequence in DNA that brings RNA polymerase near the site for transcription

What is the relationship between defective DNA repair and cancer?

defective DNA repair→→ the increased number of mutations→→ the increased probability that cancer-causing mutations will occur

Mitosis is responsible for what key process in multicellular eukaryotes? wound repair growth asexual reproduction All of the responses are correct.

all

During which substage of mitosis do sister chromatids break apart and start moving to opposite poles of the cell?

anaphase

During _____ sister chromatids separate.

anaphase II

what is the name of the process that prokaryotes such as bacteria use to divide their cells

binary fission

Which processes lead to most genetic variation in sexually reproducing organisms?

crossing over, random fertilization, independent assortment of chromosomes in meiosis

The division of the cytoplasm following mitosis is called _____.

cytokinesis

The statement, "It is a matter of chance which homolog goes to which daughter cell" best describes _____.

independent assortment

how would the telomeres of most students in the class compare with the telomeres of your old instructor

instructors telomeres are shorter

To which part of the centromere do mitotic spindle fibers attach during prometaphase?

kinetochore

Indicate at which step of the transcription-translation process each type of RNA first plays a role. During which step of the transcription-translation process does each type of RNA first play a role? Drag each item to the appropriate bin. transcription: translation:

transcription: mRNA translation: tRNA, rRNA

Beginning within the nucleus, the first step leading to the synthesis of a polypeptide is _____.

transferring of information from DNA to messenger RNA

The process of using the information in mRNA to synthesize a protein is ______.

translation

True or false? Single-stranded DNA molecules are said to be antiparallel when they are lined up next to each other but oriented in opposite directions.

true