MLS340 Chapters 4-7

Why do you block in a southern blot?

"pre-hybridization" soak in buffer and blocking agents to block nonspecific spots on membrane (reduces the background during probe hybridization)

What are buffer additives?

denaturing agents (formamide or urea) that break the H-bonds and prevent reannealing of complementary strands

What are longer and shorter probes used for?

longer probes = probe genomic DNA shorter probes = mutation analysis - for single base pair mismatch

What is the difference between a polyclonal and monoclonal probe?

protein probes (antibodies) polyclonal - recognize more than one epitope, not as specific, may give multiple bands, "robust" signal monoclonal - recognize only one epitope on antigen, more specific, lower background only one band

If a purity ratio is low of an isolated DNA what is the sample contaminated with? If the purity ratio is high?

purity ratio low = protein contamination purity ratio high = RNA contamination

What is the Purity ratio and what does it show in relation of DNA/RNA isolation?

purity ration = absorbance at 260nm: absorbance at 280nm shows quality (ideally between 1.6-2.0)

What is the difference between a regular comb and a houndstooth comb?

regular comb's wells are separated by an "ear" of gel and a houndstooth comb's wells are immediately adjacent

What is RFLP?

restriction fragment length polymorphisms (patterns of DNA fragments) - original molecular method for mapping human identification - chromosome structural changes associated with disease

When a DNA fragment is resolved by slab gel electrophoresis, a single sharp band is obtained. What is the equivalent observation had this fragment been fluorescently labeled and resolved by capillary electrophoresis?

results will be a single peak on an electropherogram

What is RGE?

rotating gel electrophoresis - rotating gel with fixed poles

Which of these 3 phases is highly reproducible? a. solid phase b. liquid phase inorganic c. liquid phase organic

solid phase

The ______ of the sample determines the method of extraction

source

What is the difference between a southern, northern and western blot?

southern = DNA northern = RNA western = proteins

What is another name for liquid phase inorganic extraction?

"salting out"

After completion of the electrophoresis of DNA fragments along with the proper molecular weight standard on an agarose gel, suppose (a) or (b) below was observed. What might be the explanation? (a) The gel is blank (no bands, no molecular weight standards) (b) Only the molecular weight standard is visible

(a) most likely staining was omitted (b) the DNA fragments were not loaded or methods to produce the fragments were unsuccessful

How is polyacrylamide gel made?

*powdered acrylamide is a neurotoxin* gel is acrylamide mixed with a cross-linker (methylene bis-acrylamide) and is a synthetic consistent polymer. It is catalyzed by amonium persulfate (APS) and TEMED or light activation. APS + TEMED produces free radicals needed for polymerization (excess O2 reduces polymerization so the solution must b deaerated)

What is degredation? And what is denaturation?

- Degredation: nucleases cleave at phosphate-sugar backbone - Denaturation: complete unwinding and separation of dsDNA (DNA is thermodynamically stable - need heat or formamide/urea)

How is the sample prepared in expression array?

- RNA extracted - use reverse transcriptase to produce cDNA - label cDNA with dual color (control labeled and diseased labeled) - hybridization

What types of labels are used for probe detection?

- Radioactive with 32P incorporated (x-ray used to detect) - Biotin and Digoxygenin (non-radioactive) chemiluminescent - Added onto UTP or CTP (modified uracil or cytosine)

What is a microarray?

- analyze tens of thousands of genes - glass chip, automated depositing - high density oligonucleotide arrays - used for mutation analysis

What is a macroarray?

- analyze up to several thousand genes - nitrocellulose membrane, chemiluminescent signal or radioactive, phosphoimager instead of x-ray - limitations: need a large volume of sample

What is a reverse dot blot?

- dot known gene sequence on membrane - hybridize with sample (labeled with detection) - macro and microarray

What affects stringency?

- formamide: concentration increases stringency, lowers temp - heat: increases stringency, more precise matching - lower salt: increase stringency - increase salt: lower stringency, shields charges, less precise matching

What are the procedures for a microarray?

- glass chip - sample prepared - add sample and allow hybridization - wash - visualize

What is gene expression array?

- high throughput assay, many genes scanned at one time - fast way to get a global view of proteome - measure the expression of genes in normal vs diseased - up ad down regulated with diseased states - measuring the "central dogma" (DNA -> RNA -> protein)

What is hybridization dependent on?

- melting temp (Tm) - probe size - sequence composition (GC vs AT hydrogen bonds) - salt concentration - denaturing agent concentration

What is a dot blot and slot blot?

- used when determining molecular size of target is not of interest - sample less complex, PCR product of mRNA - analyze a large # of samples but only tests for one gene or gene product - target (sample) is deposited on membrane

Three DNA preps have the following A(260) and A(280) readings: 1) 0.419 and 0.230 2) 0.258 and 0.225 3) 0.398 and 0.174 For each sample, based on the A(260)/A(280) ratio, is each prep suitable for further use? If not, what is contaminating?

1) ratio: 1.82 2) ratio: 1.15 = protein contamination 3) ratio: 2.29 = RNA contamination

Describe then compare and contrast these 4 stains: 1. EtBr 2. SyBr Green I 3. SyBr Green II 4. Silver Stain

1. EtBr: positively charged and intercalates dsDNA between bases - emits orange light under UV - carcinogen 2. SyBr Green I: dsDNA - not a carcinogen - more sensative - needs special cameras to detect 3. SyBr Green II: ssDNA 4. silver nitrate - can easily over stain - gel is fixed with methanol and acetic acid then stained - metallic silver is deposited with interaction with nucleic acid or protein - biohazard

Name 3 factors that will affect the yield of RNA from a paraffin-embedded tissue sample.

1. Isolation of RNA is affected by the fixative 2. The age and length of storage affects degredation 3. The preliminary handling of specimen before it is preserved

What are 3 DNA buffers and their purposes?

1. TAE (tris acetate EDTA) DNA migrates faster 2. TBE (tris borate EDTA) greater buffering capacity = higher voltage for longer times 3. TPE (tris phosphate EDTA)

Explain the 3 different blotting or transfer techniques in a southern blot.

1. capillary - membrane placed on gel and sandwiched between paper towels, buffer on bottom and "wicked" through the paper, gel and membrane - DNA follows the buffer and binds to membrane 2. electrophoretic - membrane on top of gel and sandwiched between supports and paper towels - buffer with electrodes in wells on ether side of sandwich - wicking of buffer and current transfers the DNA to membrane 3. Vacuum - set up like capillary - put under vacuum to draw the buffer through gel:membrane sandwich

Describe mitochondrial DNA isolation

1. isolate total DNA 2. cenrifuge slowly to pellet cellular debris 3. centrifuge fast to pellet mitochondria 4. lyse with detergent, DNA precipitates with cold ethanol

Describe the steps taken in total RNA extraction using solid phase isolation

1. lysate in high salt 2. wash the matrix 3. RNA eluted in low salt

Describe the 4 phases of liquid phase organic isolation of DNA

1. lysis of cell with high salt buffer 2. acidify with low pH to dissolve lipids and collect cellular debris 3. extract using organic solvents (phenol and chloroform) to form layers 4. precipitate using ethanol and salt

Describe the 4 phases of liquid phase inorganic isolation of DNA

1. lysis of cell with with SDS detergent, EDTA Tris buffer 2. low pH and high salt (selectively precipitates proteins) 3. DNA remains in solution 4. Isopropanol precipitates DNA

Describe the steps taken in total RNA extraction using organic phase isolation

1. lysis: detergent and high salt 2. phase separation (organic solvents - protein bottom layer, RNA top layer, DNA in interphase) 3. RNA layer removed 4. Ethanol precipitates RNA (2:1) isopropanol (1:1) 5. wash to remove salt

What are the 7 steps of a southern blot?

1. restriction enzyme cutting 2. elecrophoresis 3. denature 4. transfer - UV to permanently bind DNA to matrix 5. blocking/ prehybridization 6. probing/ hybridization 7. detection

Describe the 4 phases of solid phase DNA isolation

1. silica spin columns or magnetic beads 2. high salt, pH add to lysate and then to column 3. DNA absorbs (wash column to elute cell debris) 4. elute DNA with LOW salt buffer

Name two ways to determine the quantity of isolated DNA.

1. spectrophotometry (direct reading, includes all DNA, RNA and free nucleotides) 2. fluorometry (indirect reading, assay using dyes and standard curves, very small amounts)

You wish to perform an electrophoresis resolution of your restriction-enzyme digested DNA. The size of the expected fragments ranges from 100-500bp. You discover 2 agarose gels polymerizing on the bench. One is 0.5% agarose the other is 2% agarose. Which one might you use to resolve your fragments?

2% - smaller pore size

What is the Beer-Lambert Law and how can we use it to calculate concentrations of samples?

A = ebc = absorbance = (molar absorptivity)(path length)(concentration) e = 50 DNA and 40 RNA c = A x (constant for DNA or RNA) x dilution factor

What is the efficiency of hybridization?

C0t1/2 - time required for half of ds sequence to anneal under a given set of conditions (the more complex = the more time)

What is comparative genomic hybridization array?

CGH - screen genome loci (deletions and amplifications), chip has immobilized, denatured normal chromosomes test and reference DNA are labeled by incorporation of nucleotides covalently bonded to fluorescent dyes differences between normal and reference will be revealed (amplification = test color dominates, deletion = reference color dominates)

What is the difference between RNA and DNA extractions

DNA extractions are relatively easy, fairly stable and can remain at room temp with little degredation RNA extraction is not so easy, not as stable, easily degraded by RNAses, needs to remain on ice (RNAse is tough to denature and is found everywhere)

What is the movement of molecules by an electrical current?

Electrophoresis

Name the 4 types of pulse field gel electrophoresis

FIGE (field inversion gel electrophoresis) TAFE (transverse alternative field electrophoresis) RGE (rotating gel electrophoresis) CHEF (contour-clamped homogenous electric field)

After agarose gel electrophoresis, a 0.5ug aliquot of DNA isolated from a bacterial culture produced only a faint smear at the bottom of the gel lane. Is this an acceptable DNA sample?

No, DNA is double stranded and heavy so it won't travel far down the lane. Most likely all the DNA denatured and traveled far towards the bottom of the gel because of all the small fragments present

A blood sample was held at room temp for 5 days before being processed for RNA isolation. Will this sample likely yield optimal RNA?

No, because RNAse activity is high at room temperature which degrades RNA and changes the gene expression

How does PFGE separate larger fragments more efficiently than standard electrophoresis?

PFGE forces large fragments through the gel matrix by repeatedly changing the direction of the electrical current, thus realigning the sample with the spaces in the gel matrix

Why does DNA not resolve well in solution (without a gel matrix)?

Particles move in solution base on their charge/mass ratio. As the mass of DNA increases, slowing migration, its negative charge increases counteracting the effect of mass

What is the T-value of an acrylamide gel?

Percent of acrylamide:bis in the gel (typically 19:1)

What would you use to determine the quality of DNA/RNA that has been isolated and what would you use to determine the quantity?

Quality - electrophoresis (quantity can be compared but not quantified exactly) Quantity - spectrophotometer (DNA absorbs at 260 nm)

What is the difference between the storage of RNA and DNA?

RNA must be stored at -80C in an aqueous buffer or -20C in ethanol (for repeated use, aliquot to avoid freezing and thawing) DNA must be stored in tris-EDTA buffer at 4C

When isolating RNA what preparations need to occur in the lab?

RNAse free bench equipment, certified RNAse free disposables, reagents must be certified RNAse free (add DEPC and test with RNAse Alert), add RNAsin to reactions

Compare and contrast the measurements of DNA concentration by spetrophotometry with analysis by fluorometry with regards to staining requirements and accuracy.

Spectrophotometry requires no DNA staining. Fluorometry requires staining of DNA to generate a fluorescent signal. Fluorometry may be more accurate than spectrophotometry, since dsDNA must be intact to stain and generate a signal, whereas single nucleotides will absorb light in spectrophotometry

Why is SyBr Green I less toxic than EtBr?

SyBr Gren is a minor groove binding dye, it does not disrupt the nucleotide sequences of DNA. EtBr is an intercalating agent that slides in between the nucleotide bases and can cause mutations

A gel separation of RNA yields aberrantly migrating bands and smears. Suggest 2 possible explanations for this observation.

The RNA could be degraded or improper gel conditions were used to separate the RNA

A 6% solution of 19:1 acrylamide is mixed, dearated, and poured between glass plates for gel formation. After an hour, the solution is still liquid. What might be one explanation for the gel not polymerizing?

The nucleating agent of the polymerizing catalyst were not added to the gel solution

Describe capillary electrophoresis.

Thin fused silica glass tube lined with a polymer DNA must be denatured Quick sensitive way to separate small amounts of DNA Need fluorescent tag on the sample to detect the sample after separation electrokinetic injection of sample

Calculate the melting temperature of the following DNA fragment: AGTCTGGGACGGCGCGGCAATCGCA TCAGACCCTGCCGCGCCGTTAGCGT

Tm = 4C (GC) + 2C (AT) Tm = 4C (17) + 2C (8) Tm = 84C

What is the melting temp?

Tm = the temp at which 50% of nucleic acid is hybridized to complementary strand = 4C (GC) + 2C (AT)

An RNA prep has the following absorbance readings: A(260) = 0.208 and A(280) = 0.096 Is this prep satisfactory for use?

Yes, using the purity ratio for DNA the value is calculated to be 2.17 which means the sample is high in RNA

Calculate the RNA concentration in ug/mL from the following: a. A = 0.307 at 260nm from 1:100 dilution b. A = 0.307 at 260nm from 1:50 dilution c. A = 0.172 at 260nm from 1:100 dilution d. A = 0.088 at 260nm from 1:100 dilution If the volume of the above RNA solutions was 0.5mL, calculate the yield.

a. c = 0.307 x 40 x 100 = 1228 ug/mL b. c = 0.307 x 40 x 50 = 614 ug/mL c. c = 0.172 x 40 x 100 = 688 ug/mL d. c = 0.088 x 40 x 100 = 352 ug/mL a. 1228 ug/mL x 0.5mL = 614ug b. 614 ug/mL x 0.5mL = 308ug c. 688 ug/mL x 0.5mL = 344ug d. 352 ug/mL x 0.5mL = 176ug

Calculate the DNA concentrations in ug/mL for the following: a. A = 0.307 at 260nm from 1:100 dilution b. A = 0.307 at 260nm from 1:50 dilution c. A = 0.172 at 260nm from 1:100 dilution d. A = 0.088 at 260nm from 1:100 dilution If the volume of the above DNA solutions was 0.5mL, calculate the yield.

a. c = 0.307 x 50 x 100 = 1535 ug/mL b. c = 0.307 x 50 x 50 = 767.5 ug/mL c. c = 0.172 x 50 x 100 = 860 ug/mL d. c = 0.088 x 50 x 100 = 440 ug/mL a. 1535 ug/mL x 0.5mL = 767.5ug b. 767.5 ug/mL x 0.5mL = 383.75ug c. 860 ug/mL x 0.5mL = 430ug d. 440 ug/mL x 0.5mL = 220ug

What is the difference between these 3 fluorescent dyes? a. PicoGreen b. OliGreen c. SyBrGreen II

a. double stranded, brighter, detection to 25pg/mL b. single stranded, 100pg/mL c. RNA gel stain, 2ng/mL, non-specific (will stain dsDNA)

What is the target and what is the probe for each of these blots: a. southern b. northern c. western d. southwestern e. eastern

a. southern = target DNA, probe nucleic acid b. northern = target RNA, probe nucleic acid c. western = target protein, probe protein d. southwestern = target protein, probe protein e. eastern = target protein, probe lectin or protein

What is the difference between agarose gel and polyacrylamide gel?

agarose is made from seaweed and polyacrylamide is synthetic polyacrylamide is best for very small DNA or single stranded DNA and proteins polyacrylamide is more consistent between batches due to its synthetic consistency

What is hybridization?

binding of probe to target, conditions are important for correct probe binding - volume of hybridization buffer is kept small so that increases concentration of probe

Name 2 dyes that are used to monitor migration of nucleic acid during electrophoresis.

bromophenol blue and xylene cyanol green

What charge does the cathode and anode hold?

cathode = negative and anode = positive

What is CHEF?

contour-clampe homogenous electric field - alternating polarity in an electrode array

What are the general components of loading buffer used for introducing DNA samples to submarine gels?

density agent and tracking dye

What is stringency?

describes the conditions under which hybridization takes place - conditions in which target is exposed to probe - effects the way in which the probe interacts with samples on the membrane (low = unrelated binding & high = may not bind)

Describe a rapid extraction

detergents and strong base added, sample boiled with detergent (quick but can degrade DNA)

What step is omitted in a northern blot from a southern blot?

do not need to denature

What is the purpose of the denaturation step in a southern blot?

dsDNA is run on the gel but DNA must be denatured for blotting transfer

What does a tracking dye consist of and why is it used?

dye mixed with a density agent to monitor the DNA migration

What is the difference between an expression array and comparative genomic hybridization (CGH)?

expression array = up or down regulated genes with disease samples CGH = amplifications or deletions (chromosomal)

What is FIGE?

field inversion gel electrophoresis - alternating pos and neg poles

How is the ideal hybridization estimated?

from the Tm (melting temp)

What provides a barrier to the moving molecules, prevents diffusion and allows the molecules to form a band in electrophoresis?

gel matrix

What are some common problems associate with horizontal and vertical gels?

horizontal gels are dependent on the thickness of the gel and volume of the buffer (affects the current and migration) vertical gels are hard to maintain constant temp throughout the gel (edges are cooler and slow migration = "gel smile")

How are antibodies produced?

immunization - polyclonal (animal injected with antigen and produces immune response and creates antibody)

What happens when you alter the T and C-values of polyacrylamide gel?

increasing T decreases the pore size (resolve smaller molecules) a C value of 5% is the highest resolution (changing this value also alters pore size) and is standard for DNA and RNA

In the electrophoresis step of a southern blot what do different types of bands and smears mean?

large band at top = no digestion band at bottom = DNA degredation "smear" of DNA = billions of fragments and proper digestion

What is the C-value in acrylamide gel?

percent between acrylamide and bisacrylamide (typical T value of 19:1 yields a 1/19 = 5% C-value)

What is PAGE?

polyacrylamide gel electrophoresis

What is a probe in a southern blot?

probe determines what fragments are seen on the blot - specific (complementary) to target gene - covalently attached signal molecule

What are the pros and cons of gene expression assay?

pros: fast easy way to get a global view of gene expression (many genes one chip) cons: only done on one person, can't be standardized to represent all gene expressions, results need to be validated, many different stringency conditions that need to be standardized

What is the buffer's role in electrophoresis?

protect sample = keep pH constant carry current using salt ions increasing buffer concentration will increase conductivity and increase the heat which will decrease the gel stability

What is the difference between samples in a northern/southern vs western?

sample is serum, cell lysate or protein extract and is treated with denaturant before running on an SDS-PAGE

What is array-based hybridization?

simultaneous analyze a large number of targets/samples (amplification/deletion, expression, mutation)

What is pulse-field gel electrophoresis?

the current direction is changed at set points, helps to resolve very large DNA molecules and mostly used in microbial epidemiology

What is the purpose of denaturation of ds target DNA after electrophoresis and prior to transfer in southern blot?

to allow hybridization to the probe (also, ssDNA binds to nitrocellulose filters)

What is TAFE?

transverse alternative field electrophoresis - transverse-angles reorientation on vertical gel

Describe the process of isolation of mRNA

use of bead or column with poly U or T (binds the poly A tail)

What is a buffer?

weak acid and its conjugate base

What is a "gel smile"?

when the edges of a vertical gel cool and slow migration

What is yield and how does it pertain to DNA isolation?

yield = total amount of DNA/RNA yield = concentration x volume of sample