Practice Exam 1 Questions

Which would be the easiest to do in the laboratory? a. Isolate a prototroph from a population of auxotrophs. b. Isolate an auxotroph from a population of prototrophs

a. Isolate a prototroph from a population of auxotrophs

A bacterium that grows on MacConkey agar is a.... a. chemoorganoheterotroph b. chemolithoautotroph c. chemolithoheterotroph d. photoautotroph e. photolithotroph

a. chemoorganoheterotroph (energy source: organic compounds, carbon source: organic compounds)

Which of the following about endospores is FALSE? They can.... a. multiply. b. germinate. c. withstand high temperatures d. withstand antibacterial chemicals e. withstand dryness.

a. multiply

All of the following are matching pairs EXCEPT... a. penicillin - enzyme that degrades peptidoglycan b. lysozyme - targets peptidoglycan c. Gram positive cell wall - teichoic acids d. general secretory pathway - exports proteins e. porin proteins - Gram negative cells

a. penicillin - enzyme that degrades peptidoglycan (Penincillin is a group of antibiotics used to treat wide range of bacterial infections. The enzyme that degrades peptidoglycan is_________. Peptidoglycan is a substance forming the cell walls of many bacteria; a polymer that's composed of polysaccharide & peptide chains and is found in bacterial cell walls)

All of the following are matching pairs EXCEPT... a. thermophile - human body b. mesophile - leaf of an indoor plant c. psychrophile - glacier-fed lake d. psychrotroph - refrigerator e. hyperthermophile - hydrothermal vent

a. thermophile - human body (thermophile are bacterium/other microorganism that grows best at higher than normal temps)

Which of following is FALSE? a. Archaea are often extremophiles b. Bacillus anthracis belongs to the species Bacillus c. Prions are composed of only protein d. Viroids are composed of nucleic acid only e. Algae are photosynthetic

b. Bacillus anthracis belongs to the species Bacillus.

Which of the following about hydrothermal vent communities is FALSE? a. Chemolithotrophic prokaryotes function as primary producers. b. Bacteria in the digestive tract of tube worms break down unusual polysaccharides. c. In some animals, bacteria function as endosymbionts, living within a trophosome. d. Some prokaryotes that live in the environment can survive autoclave temperatures. e. The communities form around geysers on the seafloor, often over a mile deep.

b. Bacteria in the digestive tract of tube worms break down unusual polysaccharides.

With respect to fate of their electrons, which pair is most similar? a. NADH - NADPH b. NADH - FADH2 c. NADPH - FADH2

b. NADH - FADH2

Using the genetic code (illustrated below), what is the consequence of the first nucleotide in the codon AGA being converted to a U? a. missense b. nonsense c. silent d. frameshift e. real sense

b. Nonsense (nonsense is a mutation in which the substitution of a single base pair leads to appearance of a stop codon, where previously, there was a codon specifying an amino acid)

All of the following are matching pairs EXCEPT... a. bacterial mRNA - monocistronic and polycistronic b. bacteria mRNA - introns are removed by splicing c. bacteria - translation begins before transcription is complete d. eukaryotic mRNA - poly A tail e. eukaryotic mRNA - translation usually begins at the first AUG

b. bacterial mRNA - introns are removed by splicing

All of the following about bacterial structures/processes are matching pairs EXCEPT.... a. flagella rotation - propeller-like b. energy for flagella rotation - ATP c. peritrichous flagella - arrangement that surrounds cell d. sex pili - prelude to DNA transfer e. flagellin - structural subunit of flagella

b. energy for flagella rotation - ATP (energy for flagella rotation is driven by a flow of charged ions across the bacterial plasma membrane; it's the electrochemical potential difference bw the inside and outside of the cell)

Thiomargarita and Thioploca species must both cope with the fact that... a. their large size prevents easy uptake of nutrients. b. their energy source and terminal electron acceptor are found in different their locations in the water column. c. their prey is highly motile. d. they live in environments where temperatures sometimes exceed 95oC. e. their nitrogenase is O2 sensitive.

b. their energy source & terminal electron acceptor are found in different their locations in the water column.

Based on the sequence of mRNA below, where did transcription start? (the letter indicates the position on the template strand) 3'UACGACUAAUAGGCGCAUCCUCGAUC5' a. A b. B c. C d. D

c. C.

You are working with a pharmaceutical company interested in developing an antibacterial drug that targets a transport protein. Interfering with which group of transporters is most likely to affect the bacterium without harming the patient? a. Facilitated diffusion b. Active transport c. Group translocation

c. Group translocation (only bacteria)

All of the following describe components of peptidoglycan EXCEPT.... a. NAG (N-acetylglucosamine) b. NAM (N-acetylmuramic acid) c. LPS (lipopolysaccharide) d. glycan e. peptide side chain

c. LPS (lipopolysaccharide)

All of following are reasons why studying bacteria is important EXCEPT: a. They are important cause of morbidity b. They are essential to life on this planet c. They provide a model for understanding prions. d. They provide a model for understanding human cells.

c. They provide a model for understanding prions. (Prions consist only of protein; no DNA or RNA; misfolded versions of normal cellular proteins that cause the normal versions to misfold)

All of the following are matching pairs EXCEPT.... a. niacin - coenzyme b. NAD - coenzyme c. active site - binding site of allosteric inhibitor d. mercury - non-competitive enzyme inhibitor e. lipase - enzyme

c. active site - binding site of allosteric inhibitor (substrate binds to active site. The allosteric site is the binding site for allosteric inhibitor)

Adding large quantities of a substance that has a high BOD to a small lake would.... a. make the water clearer b. kill fish due to its toxicity. c. decrease the amount of dissolved O2 in the water. d. precipitate the phosphates so they're easily removed from the water. e. promote the growth of algae.

c. decrease the amount of dissolved O2 in the water

Staphylococcus aureus is a Gram-positive coccus. Which of the following describes the appearance of a properly stained S. aureus cell? a. pink & spherical b. pink & elongated c. purple & spherical d. purple & elongated

c. purple & spherical

All of the following are matching pairs EXCEPT: a. phenotype - observable characteristics of an organism b. genotype - the sequence of nucleotides in the DNA of an organism c. wildtype - strain for which the phenotype corresponds to the genotype d. prototroph - strain that grows on minimal medium e. auxotroph - strain that lacks the ability to synthesize a nutrient.

c. wildtype - strain for which the phenotype corresponds to the genotype (Wildtype: a phenotype, genotype, or gene that predominates in a natural population of organisms or strain of organisms in contrast to that of natural or laboratory mutant forms; also : an organism or strain displaying the wild type)

Which of the following statements is FALSE? a. Cells of some types of bacteria can sense the density of cells within their own population. b. Cells of some types of bacteria randomly alter their gene expression. c. Once the DNA of a protein-encoding region has been sequenced, the "plus" strand is used to determine the amino acid sequence of the protein. d. Alternative sigma factors are used to direct transcription of the central metabolic pathways. e. Enzymes involved in amino acid synthesis are typically repressible.

d. Alternative sigma factors are used to direct transcription of the central metabolic pathways (Alternative bacterial sigma factors enable bacteria to change the promoter specificity of the core RNA polymerase to enable the expression of genes that give them advantages in particular situations; bind the catalytic core RNA polymerase to confer promoter selectivity on the holoenzyme)

Which of the following statements is FALSE? a. Proofreading by a cellular enzyme that synthesizes DNA would be more important than proofreading by a cellular enzyme that synthesizes RNA. b. Transposons cause spontaneous mutations as well as induced mutations. c. X-rays can introduce single- and double-stranded breaks in DNA. d. Intercalating agents chemically modify purines and pyrimidines. e. Ultraviolet radiation can cause thymine dimers to form.

d. Intercalating agents chemically modify purines & pyrimidines (intercalating agent: a substance that inserts itself into the DNA structure of a cell & binds to the DNA, this causes DNA damage.)

Myxobacteria are interesting to scientists because these bacteria... a. grow at high temperatures (100oC). b. cause disease in animals. c. cause disease in plants. d. cooperate amongst themselves, behaving as a multicellular organism. e. fix nitrogen.

d. cooperate amongst themselves, behaving as a multicellular organism

A bacterial cell moving towards which of the following is an example of chemotaxis? a. a magnet b. a warm heating element c. a cold heating element d. glucose

d. glucose (Chemotaxis: the directed motion of an organism toward envtal conditions it deems attractive and/or away from surroundings it finds repellent)

All of the following are matching pairs EXCEPT.... a. endocytosis - pinocytosis b. endocytosis - phagocytosis c. actin - cell movement d. rickettsia - ancestor of a nucleus e. cyanobacteria - photosynthesis

d. rickettsia - ancestor of a nucleus (Rickettsia: a diverse collection of obligately intracellular Gram-negative bacteria found in ticks, lice, fleas, mites, mammals; any group of small bacteria that includes the causative agents of typhus & other various febrile diseases in humans; like viruses, many can only grow in living cells & are freq transmitted by mites, ticks, or lice)

Two bacterial isolates have significant difference in the nucleotide sequences of their 16S ribosomal RNA genes. Based on this information, you can conclude that... a. only one is susceptible to antibiotics that target the ribosome. b. one has 80S ribosome and the other has 70S ribosomes. c. one has a 30S ribosomal subunit and the other has a 50S ribosomal subunit. d. they are likely not members of the same species. e. one is a rod and the other a coccus.

d. they are likely not members of the same species

An experiment began with 6 cells and ended 2 hours later with 96 cells. How many generations did the cells go through during the 2-hour experiment? a. 48 b. 24 c. 8 d. 6 e. 4

e. 4

All of the following are matching pairs EXCEPT... a. biosynthesis - anabolism b. energy released - exergonic c. oxidation - loss of electrons d. oxidation - loss of hydrogen e. NAD+ - reducing power

e. NAD+ - reducing power (NAD+ is an oxidizing agent, it accepts electrons from other molecules and becomes reduced)

Which of the following about the bacterial cytoplasmic membrane is TRUE? a. Water enters the cell via active transport proteins b. The membrane is composed of a triple layer of phospholipids. c. ATP is able to diffuse across the membrane. d. The membrane is located just outside the cell wall, anchored to the wall's outer surface. e. Protein complexes within the membrane eject protons from the cell.

e. Protein complexes within the cell membrane eject protons from the cell.

Which type of DNA repair is the most error prone? a. Excision repair b. Light repair c. Mismatch repair d. Proofreading e. SOS

e. SOS (the SOS response is a global response to DNA damage in which the cell cycle is arrested & DNA repair & mutagenesis is induced. The SOS response can lead to mutations which can lead to resistance to antibiotics. The increased rate of mutation during the SOS response is caused by 3 low-fidelity DNA Polymerases: Pol II, Pol IV, & Pol V; The SOS response entails the induction of multiple proteins that serve to promote the integrity of DNA; it also includes error-prone factors that allow for improved survival & continuous replication in the presence of extensive DNA damage, but at the cost of elevated mutagenesis)

Answers can be used more than once or not at all. A. aerobic respiration, B. anaerobic respiration, C. fermentation, D. A & C, E. B & C i.) can occur in aerobic envts: ______ ii.) can occur in anaerobic envts: _____ iii.) results in production of only 6 of the precursor metabolites: _________

i.) D. (Aerobic respiration & Fermentation can occur in aerobic envts) ii.) E. (Anaerobic respiration & Fermentation can occur in anaerobic envts) iii.) C. (Fermentation results in the production of only 6 of the precursor metabolites.)

Options can be used more than once or not at all. A. glycolysis, B. TCA cycle chain, C. pentose phosphate pathway, D. A & C, E. electron transport i.) Glucose is the starting compound __________ ii.) Produces the most reducing power __________ iii.) Consumes reducing power _________

i.) D. (Glucose is the starting compound of glycolysis & pentose phosphate pathway) ii.) B. (TCA cycle produces the most reducing power) iii.) E. (Electron transport chain consumes reducing power.)

Answers may be used more than once, or not at all. A. transcription, B. translation, C. replication, D. A & B, E. A and C i.) The final produce is a component of ribosomes: __________ ii.) Involves Okazaki fragments: ______ iii.) Expression of the beta-galactosidase gene requires this process: _________ iv.) RNA interference destroys the product of this process: _______ v.) Uses subunits that have a 3'OH: ____ vi.) A sequence called a terminator halts this process: _______

i.) D. (The final product of transcription and translation is a component of ribosomes) ii.) C. (Replication involves Okazaki fragments) iii.) D. (Expression of the beta-galactosidase gene requires transcription and translation) iv.) A. (RNA interference destroys the product of transcription) v.) E. (Transcription & Replication uses subunits that have a 3'OH) vi.) A. (A sequence called a terminator halts transcription)