BIO 111 Practice Exams and Test Questions

Which of the following shows the BEST example for the indicated energy transformation?

Dropping a pencil: potential energy→ kinetic energy

In the diagram above, what is indicated by the letter "D"? (pointing to circular part of phospholipid)

phospholipid's hydrphilic head

The first law of thermodynamics means that:

plant cells cannot create their own energy

the smallest biological units that can evolve are

populations

What is the name of letter D? (enzymatic reaction, pointing to two molecules produced)

products

Histone acetylation ________ transcription; whereas DNA methylation _________ transcription.

promotes; reduces

What differentiates a hypothesis from a theory?

A theory is a principle that has been formed in an attempt to explain things that have already been substantiated by decades of data.

A point mutation that changes a codon for an amino acid to a stop codon is called:

a nonsense mutation

Why is molecular oxygen (O 2) so important for plant and animal life on earth?

It is needed in the mitochondria in order to extract the greatest amount of ATP from glucose.

Dopamine is a neurotransmitter that functions as part of the reward-motivation behavior pathway. Which of the following is NOT true about this chemical?

It is only found in the brain.

Which of the following is TRUE regarding chitin?

It is similar to cellulose except for the group shown by the arrow in the chitin monomer structure

What is unique about 14C and how many protons does it have?

It is unstable and has 6 protons.

In taxonomic hierarchy, what is the correct order for the levels of classification of organisms? (Broadest to most specific)

Kingdom, phylum, class, order, family, genus, species

What is true about DNA?

Nearly every single organism alive uses the same genetic code

Electronegativity is the attraction of a particular atom for electrons in a covalent bond. Which type of bond has the largest difference in the electronegativity of the atoms being joined?

ionic

What kinds of molecules have the most trouble passing through a cell membrane?

ions

A scientific theory

is a carefully-formulated proposition, based on observations, and supported by an accumulation of experimental data

What is one major difference between prokaryotes and eukaryotes?

Prokaryotes are MUCH older (evolutionarily) than eukaryotes

Which of the following is an example of potential rather than kinetic energy?

molecule of glucose

The genetic code is redundant. What is meant by this statement?

more than one codon can specify the addition of the same amino acid.

The following type of karyotype is caused by: (big x and little y)

non-disjunction

Alfred Wallace is best known for what?

Suggesting natural selection as a mechanism for evolution

In the generic redox reaction: A + B → C + D,

one substrate gains electrons while the other substrate loses electrons.

NAD+ is the ______ form of NADH while NADH is the _____ form of NAD+.

oxidized; reduced

The final electron acceptor for cellular respiration is:

oxygen

At starbucks you take 3 packets of sugar and stir them into your cup of coffee until is disappears completely. In this example, the "pre-sugared" coffee is the _ and the sugar is the _.

solvent; solute

The end product(s) of photosynthesis in plants are oxygen and sugar stored as:

starch

Why can certain types of viruses promote cancer in humans especially?

They insert their DNA into the host genome and can cause massive damage.

Ultraviolet exposure can commonly result in which of the following forms of DNA damage?

Thymine dimer formation

Enantiomers are isomers that are mirror images of each other. Why are they SO important?

To the pharmaceutical industry as one will be effective, and one will not

Most of the organic material in plants is what? (What are plants made of)

air

What functional group is found in every single simple sugar?

carbonyl

Which of the following does NOT support the endosymbiotic theory?

chloroplasts and mitochondria have the same size

Which of the following does not completely follow Mendel's laws?

co-dominance

Which graphs are most likely from a human stomach where conditions are strongly acidic?

temp between 0 and 50 *C pH between 0 and 4

Which level of protein structure is the overall 3-D shape of a polypeptide?

tertiary

The first stage of translation and transcription is __________.

initiation

Which of the following is part of the cell theory?

the observation that cells arise from the division of existing cells

Which part is the centromere?

the place where the two strands connect in the middle (crossing point)

What is the chromosomal defect associated with Down syndrome, and what is the resulting number of chromosomes in somatic cells?

three copies of chromosome 21, 47 chromosomes total

Why is the one gene-one enzyme hypothesis not entirely accurate?

Some genes encode proteins that are not enzymes. Some genes encode a piece of a protein, not the entire protein. Some genes encode functional RNA molecules, not polypeptides.

Who, among the following, is the most biologically fit individual?

Someone with five children

Which of the following is NOT a function of a lipid?

Store genetic information

Which of the following allows water to move much faster across cell membranes?

aquaporins

When an enzyme speeds up metabolic reactions,

it lowers the activation energy necessary to break the bonds of the reactants.

Which of the following is NOT true about the Kreb's cycle?

it occurs in the cytoplasm so every living organism can do it

What type of covalent bonds exist in methane?

nonpolar

What is the primary benefit of storing energy in the form of sugar rather than ATP?

sugar is much more stable than ATP.

Given below is a list of events taking place during translation. Arrange these in proper sequence.

1. A small ribosomal subunit binds with mRNA 2. The anticodon of tRNA base pairs with the mRNA codon at the A site 3. Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site 4. Translocation of tRNA from the A site to the P site

Arrange the events taking place during transcription in order:

1. RNA polymerase binds to the promoter 2. Polymerase initiates RNA synthesis at the start point on the template strand 3. RNA polymerase moves downstream, unwinding the DNA 4. The pre-RNA undergoes processing

Put the following events in the order they occur during translation:

1. mRNA binds to small ribosomal subunit 2. Initiator tRNA, carrying the amino acid MET, binds to the start codon on the mRNA 3. large ribosomal subunit binds to complex 4. a tRNA binds in the A site in the ribosome

Substrate-level phosphorylation accounts for approximately what percentage of the ATP formed by the reactions of glycolysis?

100%

A solution with a pH of 9 has how many H+ ions compared to a solution with a pH of 6?

1000 times less

Given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have?

11

In the absence of oxygen, suppose a single yeast cell undergoes fermentation and uses 56 molecules of glucose. How many molecules of ATP will be generated?

112

A particular triplet of bases in the template strand of DNA is 5'-AGT-3'. What would be the corresponding codon for the mRNA that is transcribed?

3'-UCA-5'

How much NaCl would you need to make a 0.100 L of a 0.5 molar solution? (MM = 58.44)

2.9 g

A particular eukaryotic protein is 800 amino acids long. Which of the following could be the maximum number of nucleotides in the coding sequence of the mature mRNA that codes for the amino acids in this protein?

2400

The brown-eye allele is dominant over blue-eye allele. A couple currently has 3 children with brown eyes. What is the probability that their next baby will have blue eyes if both parents are heterozygous for eye color?

25%

What is the valence number of nitrogen?

3

If two people with 'sickle-cell trait' have offspring what would be the predicted ratio of phenotypically normal to affected (sickle-cell disease) offspring?

3:1

The fluid inside a thylakoid of a chloroplast has 1000 times the concentration of H+ ions as the fluid in the stroma of the chloroplast. If the stroma fluid pH is 7.5, what is the pH of the thylakoid fluid?

4.5

If liver cells (somatic) of turkeys of 80 chromosomes, how many chromosomes do its sperm cells (germ line) have?

40

Which of the following sequences is complementary to the DNA strand with sequence: 5' -TCCGAGCTA- 3'?

5' -TAGCTCGGA- 3'

Below is a piece of double-stranded DNA. If RNA polymerase is moving from left to right, what is the product? 3' GGACT 5' 5' CCTGA 3'

5' CCUGA 3'

Phoebe's mother is red-green colorblind and her father is not. What is the probability that Phoebe's son is red-green colorblind?

50%

Under aerobic conditions, _____ moles of CO2 are produced for each mole of glucose oxidized.

6

How many different genotypes are possible to produce from a self-fertilization of a plant with genotype AaBbCc?

8

In a genetic cross between a heterozygous tall plant with homozygous purple flowers and a homozygous short plant with heterozygous purple flowers, how many short plants will you expect in the next generation if you sample 16 individuals? Both tall and purple flowers are dominant.

8

Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?

8%

Which binding site on the ribosome does the recruited tRNA bind to first?

A

Which of the following is NOT common to both prokaryotic and eukaryotic cell division

A checkpoint will be activated if the spindle does not attach to a kinetochore.

The genetic code is essentially the same for all organisms. From this, one can logically assume which of the following statements to be true?

A gene from one organism can be introduced in and expressed by another organism

Which of the following is an example of cooperativity?

A molecule binding at one unit of a tetramer, allowing faster binding at each of the other three

A cell uses a molecule of ATP to help reactants X and Y form a product X-Y. What is left of the ATP after this reaction?

ADP and a phosphate group

What is the source of energy during the energy investment phase of glycolysis?

ATP

The primary products produced by the light reactions are required by the dark reactions are which of the following?

ATP and NADH

Eukaryotic cells use millions of ATP molecules per minute. How does the cell constantly replenish its ATP supply to keep up with this intense demand?

ATP is regenerated by adding a phosphate group to ADP during the process of cellular respiration

You can make a cell extract that is able to perform glycolysis in vitro (in a test tube) if glucose is added. Arsenate is a potent inhibitor of triose phosphate dehydrogenase, the enzyme required for the 6th step in glycolysis. If both arsenate and glucose are added to the cell extract, what happens?

ATP levels decrease.

One can measure ATP production from isolated mitochondria in vitro (in a test tube). Changing the pH of the solution that the mitochondria are in results in a similar change the pH of the intemembrane space. If the pH of the solution that the isolated mitochondria are in is raised and everything else remains constant, what is the effect on ATP synthesis?

ATP synthesis is decreased.

During cellular respiration, what happens to the 6 carbons in glucose?

All 6 carbons are completely oxidized to CO2.

The cell theory is one of the 4 major theories in biology. Which is correct?

All cells arise from existing cells.

Which of the following is not a tenet of the cell theory?

All cells must have a nucleus

As diverse as life is, there is also evidence of remarkable unity, with characteristics that unite everything from the smallest bacteria to the largest mammal. Which of the following is NOT one of those characteristics?

All living organisms grow via mitosis.

Which of the following statements is TRUE?

An isolated system cannot exchange either matter or energy with its surroundings.

A father with blood type O and a mother with blood type AB have 2 children. One child has blood type A. Which of the following is a possible blood type of the other child?

B

Mendel's law of segregation applies to:

Both monohybrid and dihybrid crosses

What major event happens during the Calvin Cycle?

CO2 is fixed by RUBISCO

Arrange the following molecules according to increasing rate of diffusion across a lipid bilayer without the aid of any membrane protein: glucose, Ca2+ N2, H2O.

Ca2+ < glucose < H2O < N2

Which type of functional group is depicted above? (Fructose)

Carbonyl (ketone)

Which of the following effects might be caused by reduced or very little active telomerase activity?

Cells age and begin to lose function.

Match the following events with the appropriate stage/ process of cell division:

Centrosome movement: Prophase I Homologous chromosomes separate: Anaphase I DNA exchange: Crossing over Chromatids separate: Anaphase II

A tall plant has been found, but its zygosity is unknown. Tall is dominant over short height. The following can be done to determine its zygosity:

Cross to a true breeding short plant

Which characteristic is NOT shared by bacteria and archaea?

identical cell wall composition

Which of the following best describes the difference between DNA and RNA?

DNA is a very stable molecule; RNA is very unstable (ever-changing, degrading)

What is one major difference between RNA and DNA?

DNA is very stable, RNA is very unstable.

A biochemist isolates, purifies, and combines in a test tube a variety of molecules needed for DNA replication. When she adds some DNA to the mixture, replication occurs, but each DNA molecule consists of a normal strand paired with numerous segments of DNA a few hundred nucleotides long. What has she probably left out of the mixture?

DNA ligase

Which of the following is true of enzymes?

Enzymes increase the rate of chemical reactions by lowering the activation energy.

(T/F) A photosynthetic plant cell does not need mitochondria.

False

Which of the following shows carbohydrates arranged according to increasing number of sugar units?

Fructose -> sucrose -> chitin

Which of the following is true?

Functional groups cause particular properties and reactions to occur when added to basic chains of carbon molecules.

The drug thalidomide has two different enantiomers, which of the following is NOT true about the drug?

Given the appropriate enantiomer, women can now safely take it.

Which graph best shows the relationship between glucose levels and ATP production by a cell in an otherwise closed system?

Glucose concentration (y) vs. ATP concentration (X). Decreasing much faster in anaerobic.

Pick the metabolic process that is endergonic.

Going from CO2 into glucose

A researcher found a method she could use to manipulate and quantify phosphorylation and methylation in embryonic cells in culture. In one set of experiments, she succeeded in increasing acetylation of histone tails in the chromatin of the cells. Which of the following results would she most likely see in these cells?

Increase in gene expression

What is not true about this guy? (Borlaug)

He is a very famous botanist from UT Austin

Which of the following statements correctly describes the structure or function of chromatin?

Heterochromatin is highly condensed, whereas euchromatin is less compact.

Which of the following is FALSE about glycogen as a storage polysaccharide?

Hydrolysis of glycogen releases fructose, a sugar that is sweeter than glucose and thus gives off more stored energy

Which of the following is true of osmosis?

In osmosis, water moves across a membrane from areas of lower solute concentration to areas of higher solute concentration.

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following?

Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

In liver cells, the inner mitochondrial membranes are about 5 times the area of the outer mitochondrial membranes. What purpose must this serve?

It increases the surface for oxidative phosphorylation

Which of the following statements best describes the effect a nonsense mutation would have on a gene?

It introduces a premature stop codon into the mRNA

Which of the following statements about the above transport is INCORRECT

It is a pump for passive transport of two K+ into the cell and three Na+ out of the cell

As you were taking lettuce in the grocery store, you were surprised when the water sprinklers suddenly went on, spraying fresh water on the produce. When you got home, you immersed the lettuce in a salt solution, and within several minutes they became limp and soft. What is the explanation/observation?

Lettuce cells are hypertonic to fresh water making them turgid and fresh-looking, but hypotonic to the salt solution, hence plasmolyzed.

Which class of biomolecules is NOT considered a true polymer?

Lipids

Match the organelles to their respective functions.

Lysosome- breakdown of ingested macromolecules and other substances Nucleus- physically separate the DNA from most metabolic processes Mitochondria- convert energy to forms that cells can use for work Peroxisome- metabolic compartment enclosed by a single membrane Vacuole- storage and waste disposal Golgi apparatus- protein, glycoprotein and phospholipid modificati

Which of the following DOES NOT support the fluid mosaic model?

Membrane proteins from cells of two different organisms will never be found mixed together in a hybrid cell.

In his transformation experiments, what phenomenon did Griffith observe?

Mixing a heat-killed pathogenic strain of bacteria with a living non-pathogenic strain can convert some of the living cells into the pathogenic form.

Refer to the plot showing the rate of an enzyme-catalyzed reaction as a function of substrate concentration. Why is the curve starting to level off?

Most of the active sites of the enzyme are occupied by the substrate.

In oxidative phosphorylation, what is being oxidized and what is being phosphorylated?

NADH; ADP

Which of the following is NOT TRUE for mitosis?

Non-sister chromatids exchange DNA

Household bleach has a pH of 12. How many OH- ions and H+ ions does it have?

OH: 10^-2 H+: 10^-12

cells (e.g. bacteria) are ingested for food by other cells (e.g. an amoeba) by which of the following?

Phagocytosis

Match the type of endocytosis to its main features or examples.

Phagocytosis- Vesicle which pinches off does not have a coated pit Pinocytosis- Cell continually takes in droplets of extracellular fluid into vesicles Receptor-mediated endocytosis- Taking in cholesterol for membrane synthesis in humans

In what way does RNA differ from DNA?

RNA (gene expression) can change hourly in organisms

Ribosomes are composed of _ and directly synthesize _.

RNA and proteins; polypeptides

Despite the human genome being significantly larger than the genome of bacteria such as E. coli, it does not take a human cell significantly longer to replicate its genome. Why?

Replication in human chromosomes uses multiple origins of replication that move in both directions

List all possible gametes produced by a plant with genotype RrYy.

Ry, ry, RY, and rY

Taxol is a drug that comes from the bark of a tree that binds and irreversibly stabilizes microtubules. It is often used during chemotherapy to kill dividing cancer cells. How does taxol block cell division?

Taxol prevents spindle formation and separation of chromatids.

Telomere shortening puts a limit on the number of times a cell can divide. Research has shown that telomerase can extend the life span of cultured human cells. How might adding telomerase affect cellular aging?

Telomerase greatly reduces telomere shortening and slows aging.

Which of the following is FALSE about the relationship between canabolism and anabolism?

The ATP generated from anabolic reactions drives catabolic reactions

Which of the following is FALSE about the relationship between catabolism and anabolism?

The ATP generated from anabolic reactions drives catabolic reactions.

A new, lethal genetic disorder has been discovered. The disease allele is dominant, yet it persists in the population. The simplest reason to explain this disease allele is:

The allele is dominant, but affects individuals beyond the reproductive age.

When two alleles express equally in a heterozygous individual then the following is true:

The alleles are co-dominant

A white mouse (bb) mates with a black (BB) mouse and all the babies are gray in color. Which of the following is true for the alleles responsible for coat color of the mice?

The alleles have incomplete dominance.

Which of the following statements about atomic mass or atomic number is correct?

The atomic number is the number of protons an element has.

In Engelmann's experiment, he places a filament of green algae on a slide and then created a light spectrum across the slide using a prism. He then "painted" the slide with oxygen-dependent bacteria and discovered what?

The bacteria grew best in the blue and red portions of the spectrum.

Which of the following statements is a reasonable explanation for why unsaturated fatty acids help keep a membrane more fluid at lower temperatures?

The double bonds form kinks in the fatty acid tails, preventing adjacent lipids from packing tightly.

Which of the following DOES NOT pertain to the first law of thermodynamics?

The energy of the universe is never constant.

According to the second law of thermodynamics:

The entropy of the universe increases with any energy change that occurs.

Which of the following statements describes the second law of thermodynamics?

The entropy of the universe never decreases

Which unique property of water reduces variation in temperature along lake shores and coastal areas?

Water absorbs heat from the air that it warmer and releases it to the air that is cooler

Imagine that you've isolated a yeast mutant that contains histones resistant to acetylation. What trait/characteristic would you predict for this mutant?

The mutant will show decreased levels of gene expression.

Your patient was involved in a serious accident and lost a large quantity of blood. In an attempt to replenish body fluids, your rookie nurse adds distilled water (equal to the volume of blood lost) to the patient's blood directly via one of his veins, without consulting you. What will be the most probable result of this transfusion?

The patient's red blood cells will swell and possibly burst as the water moves into the cells.

Which most accurately describes why leaves change colors in fall?

The plant stops making chlorophyll and the accessory pigments that were already there become visible.

A patient experienced great blood loss. In an attempt to quickly replenish body fluids, a volume of distilled water equal to the blood lost was introduced into a blood vein. What is the most likely result of this treatment?

The red blood cells are in danger of bursting because they were subjected to a hypotonic environment

When you put aspirated spinach leaf disks in a beaker of sodium bicarbonate and place them in different colors of light, some disks float faster and more abundantly than others dependent on what color, if any, they were in. What made them able to float?

The release of O2 from the process of photosynthesis

Which of the following does NOT take place during the S-phase of the cell cycle?

The spindle is formed in preparation for chromatid separation.

Which of the following is NOT true of DNA?

The two strands are held together along the bases with strong covalent bonds

Which of the following is FALSE regarding the DNA double helix?

The two strands are parallel

What is so unique about the chemistry/ecology of serpentine soils?

They are extremely deficit in essential plant nutritients (e.g. N, P, Ca, etc.)

Both chloroplasts and mitochondria have evolved from an endosymbiotic event. What is a line of evidence for this theory?

They both reproduce via binary fission

Which of the following is true about bacteriophages?

They can be used to kill bacteria that have acquired antibiotic resistance They are VERY specific to infect either a single or few closely related bacteria

Which of the following is NOT true about hydrocarbons?

They easily dissolve in water

Two pea plants were crossed and 93 of 200 progeny were short and the rest were tall. Tall is dominant. The most likely genotypes of the parents are:

Tt and tt

A series of enzymes catalyze the reaction X->Y->Z->A. Product A binds to the enzyme that converts X to Y at a position remote from its active site. The binding decreases the activity of the enzyme. Substance A is what?

a feedback inibitor

A biologist is studying a cell that has enzymes, DNA, a plasma membrane, ribosomes, and mitochondria. Given only this information, the cell COULD BE

a plant cell or animal cell, but not a bacterial cell

In the genetic code,

a sequence of three bases translates into one amino acid.

Which of the following DNA mutations is most likely to damage the protein it specifies?

a single base-pair deletion

On the basis of energy requirement, which does NOT belong in the group?

active transport

The figure above depicts the movement of a substance across a cell membrane. The best way to describe what is occurring in the figure would be: (contains ATP + P + ADP)

active transport

You need to make a half liter of 1M solution of maltose (C12H22O11) for your fermentation lab. How will you do that?

add 171 g to 500 mL of water

Which of the following is a CORRECT match of monomer and macromolecule?

amino acid- protein

A hereditary disease never passed from father to son is:

an X chromosome linked disease.

Element deficiencies can cause a lot of issues for all living organisms. What does a lack of iron (Fe) cause in humans?

anemia

In which stage of polymerase chain reaction (PCR) are the specific primers added to the DNA strands?

annealing

Which of the meiotic cell divisions shown below could give rise to a healthy offspring with no genetic disorder (given that the other participating gamete does not have any errors in chromosome number or structure)?

any that are capable of producing products with only one chromosome

The light reactions take place in this location

blocks on diagram

Which of these structures is found in plant cells but not animal cells?

cell wall

HIV is the virus that causes AIDS. In the mid-1990s, researchers discovered an enzyme in HIV called protease. Once the enzyme's structure was known, researchers began looking for drugs that would fit into the active site and block it. If this strategy for stopping HIV infections were successful, it would be an example of what phenomenon?

competitive inhibition

The anticodon of a particular tRNA molecule is:

complementary to the corresponding mRNA codon.

Last week, biologists in Tel Aviv released a ground breaking discovery. There were the first group to find a multicellular organism that _?

completely lacks a mitochondrial genome

hypothesis based science requires

control groups

This cell is in: (split into two)

cytokinesis

The Calvin cycle take place in this location:

cytoplasm (the empty space on diagram)

The construction of macromolecules requires a series of _ reactions that form _ bonds between monomers.

dehydration; covalent

Folding in a protein is damaged or destroyed by

denaturation

The bases for dividing prokaryotes into two domains is

differences in genome sequences

In its simplest and broadest version, how do we define natural selection?

differential reproductive success

natural selection is

differential reproductive success of different phenotypes

Cyanide inhibits the transport of electrons to oxygen. Cyanide is most likely inhibiting:

electron transport chain

A chemical reaction that has a positive delta G is best described as ____ while one with a negative delta G is ____?

endergonic; exergonic

What is produced when yeasts undergo fermentation?

ethanol (ETOH)

What do mitochondria and chloroplasts have in common?

found in almost all plant cells, evolution from endosymbiotic events

What list ranks the molecules from most information to least information?

genome, chromosome, gene, nucleotide

Mating between a tiger and a lion can produce two types of offspring. A mating event between a male tiger and female lion produces a tigon, which is often smaller than either parent. A mating event between a male lion and a female tiger produces a liger, which is much larger than either parent. This is an example of:

genomic imprinting

What is the substrate for the first step in glycolysis?

glucose

Which group composes the endomembrane system?

golgi apparatus, vacuole, endoplasmic reticulum

What improves the productivity of cellular respiration?

highly folded surface of the inner mitochondrial membrane

Darwin's mechanism for evolution requires

inheritance of characteristics that enhance survival and reproduction

quartenary structure

is the overall shape of two or more polypeptide chains that associate to form one functional macromolecule

Which of the following does NOT describe a biological membrane?

its protein and lipid components are symmetrically distributed

What is produced when animals undergo fermentation?

lactic acid

The energy source for photosynthesis is:

light

Five dialysis bags, constructed of a type membrane that is permeable to water and impermeable to sucrose, were filled with various concentrations of sucrose and then placed in separate beakers containing an initial concentration of 0.6 M sucrose solution. At 10-minute intervals, the bags were massed (weighed) and the percent change in mass of each bag was graphed. Which line in the graph represents the bag that contained a solution isotonic to the 0.6 M solution at the beginning of the experiment?

line decreasing linearly

Which organelle is responsible for containing degradative enzymes enclosed in a membrane that help remove water products?

lysosomes

This cell is in: (chromosomes bundled in middle)

metaphase

which of the following is NOT considered part of the cell's endomembrane system?

mitochondria

When an error occurs in replication, it changes the nucleotide sequence of the DNA. This phenomenon is called a [A].

mutation

In a genetic cross between AaBbCcDdEe and Aabbccddee what fraction of the offspring will be homozygous for all dominant alleles?

none

Which of the following basic molecular building blocks would be found in chromosomes?

nucleotides and amino acids

As a researcher, you were asked to grow a cell in a medium containing radioactive nucleotides, which then get incorporated into DNA. Upon later examination, the radioactivity appeared to be concentrated in the

nucleus.

The genetic code is said to be redundant because

one amino acid can be encoded by more than one triplet codon.

The following figure shows a replication bubble. The correct labeling for this figure is:

origin of replication: splits diagram down middle leading strand: runs 3'-5', lagging strand: runs 5'-3', synthesized by okazaki fragments d- Okazaki fragment; e- RNA primers

We discussed brewery syndrome while talking about fermentation. Which of the following is NOT true about this condition?

overgrown bacteria mix with carbs to undergo fermentation

Nearly every organism functions on a 24 hour cycle. What does this circadian clock control/do?

regulate a bunch of stuff (hormone production and cell regeneration) affect feeding patterns determine when certain medicines should be taken to heighten their effect affect sleep patterns

The purpose of a spliceosome is to:

remove non-coding portions of RNA

At midnight, what process is mostly occurring in the leaf of a plant?

respiration

When heterozygous tall plants with purple flowers self pollinate to give rise to tall and dwarf plants with purple flowers, it demonstrates the following:

segregation of alleles

Mendel's laws of inheritance are valid for

sexual reproductive

From the graph above, where in the human body would you most likely find pepsin? (pH 0-4)

stomach

Where in your body is an exception the the "neutral" pH?

stomach

What is the function of the polysaccharides cellulose and chitin in the cell?

structural support

Hydrolysis is involved in everything EXCEPT

the conversion of glucose to starch

In a eukaryotic cell, electron transport takes place within:

the inner mitochondrial membrane.

The flexibility and fluidity of membranes that contain a large amount of unsaturated fatty acid acyl chains are due to

the kinks caused by double bonds prevent close packing.

Which of the following distinguishes a prokaryotic cell from a eukaryotic cell?

the presence or absence of internal membranes partitioning the cell

Competitive inhibition differs from non-competitive inhibition by:

the site that the inhibitor binds to the enzyme.

What mainly determines whether a molecule will be transported via endocytosis/exocytosis or via passive transport?

the size of the molecule to be transported

During photosynthesis, light reactions take place in _ and the Calvin Cycle takes place in _.

thylakoid (objects floating in cytoplasm); stroma (cytoplasm)

What is the function of DNA polymerase?

to add nucleotides to the 3' end of a growing DNA strand

The process of converting DNA to RNA is called _______.

transcription

Below are 3 plant cells. One of these plants has been placed in pure, filtered water. Which is it?

turgid

Translation is a molecular process that

uses the information in an mRNA sequence to synthesize a protein